CN106868211B - Visualization method for detecting cytomegalovirus nested PCR product - Google Patents
Visualization method for detecting cytomegalovirus nested PCR product Download PDFInfo
- Publication number
- CN106868211B CN106868211B CN201710144061.9A CN201710144061A CN106868211B CN 106868211 B CN106868211 B CN 106868211B CN 201710144061 A CN201710144061 A CN 201710144061A CN 106868211 B CN106868211 B CN 106868211B
- Authority
- CN
- China
- Prior art keywords
- amplification
- cytomegalovirus
- pcr
- primer
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a visualization method for detecting cytomegalovirus nested PCR products, which is a novel, simple and convenient visualization method for detecting cytomegalovirus nested PCR products with low cost by simulating peroxidase activity by means of the characteristic that the G quadruplex structure changes color after encountering hemin dye. The method can effectively detect whether the serum sample contains the cytomegalovirus or not by detecting clinical samples (20 patients and 20 healthy control groups), and provides an effective method for clinically detecting the cytomegalovirus.
Description
Technical Field
The invention belongs to the field of biochemical analysis, and particularly relates to a visualization method for detecting cytomegalovirus nested PCR products, which can detect whether human serum contains cytomegalovirus with low cost and high efficiency. The method is provided for clinical specificity detection of the cytomegalovirus in the future, and particularly, the method is simple, convenient, rapid, sensitive and low-cost and can be popularized for large-scale cytomegalovirus screening work of developing countries and third-world population, so that the method has great potential application value and profound influence significance.
Background
Cytomegalovirus infections are ubiquitous in the human population and do not normally cause serious consequences. However, when cytomegalovirus infects people with low immunity, it may threaten the life of the patient, especially when pregnant women are infected with cytomegalovirus, and the physiological defect of newborn babies is often caused. Therefore, it is clinically important to diagnose the giant cell infection timely and accurately.
Enzyme-linked immunosorbent assay (ELISA) and Polymerase Chain Reaction (PCR) are commonly used in clinic to detect cytomegalovirus infection. ELISA is used for judging whether a patient is infected by detecting cytomegalovirus antibodies IgG and IgM in serum of the patient, IgG positive usually means previous infection, IgM positive usually means current infection, but some patients or children with low immunity cannot generate antibodies, so that the accuracy of a detection result is often influenced. At present, qPCR has the advantages of higher sensitivity and stronger specificity compared with common PCR and can carry out quantitative detection on megaviruses, so that the qPCR is widely applied to clinical detection. The scholars think that the developing countries do not need to screen cytomegalovirus because the seropositive rate is high and the probability of the pregnant women delivering sick newborns is low, but the studies show that the prevalence rate of the newborns of the population with high seropositive rate is not obviously different from the prevalence rate of the newborns of the population with low seropositive rate, so the developing countries also need to screen viruses. However, qPCR is limited in its use for cytomegalovirus screening due to its expensive equipment and reagents, and since it is not cost-effective to screen for cytomegalovirus using qPCR method, general PCR is limited in its use for cytomegalovirus detection due to its low sensitivity.
To address these problems, we used nested PCR (nest PCR) to detect cytomegalovirus in this study, which has two pairs of primers and can amplify the target DNA twice, thus having very high specificity and sensitivity. The inherent disadvantage of nested PCR is that the products cannot be quantified due to its two amplifications and must be detected by gel electrophoresis, which is a solution to the problem of using G quadruplex to mimic peroxidase activity instead of gel electrophoresis. Meanwhile, the PCR product is detected by the aid of a G quadruplex-hemin complex with peroxidase activity, and visualization detection of cytomegalovirus is realized.
The following description is a new method for visually detecting cytomegalovirus by combining a G-quadruplex structure with Nest PCR, which is designed by the inventor, and the detection sensitivity is improved by amplifying target DNA twice. Then, a specific molecular beacon DNA sequence is designed, and the hairpin part of the DNA sequence can be specifically opened by the primer, so that the detection specificity is greatly improved. After the hairpin structure is opened, the molecular beacon can form a G quadruplex structure, and is combined with hemin to catalyze the substrate to change the color of the substrate, so that the visual detection of the target object is realized. Clinical specimen verification shows that the method has higher detection efficiency, provides a new method for clinically detecting the specificity of the cytomegalovirus in the future, and particularly improves a simple, convenient, quick, sensitive and low-cost popularizable method for the large-scale screening of the cytomegalovirus of developing countries and third world population, so that the method has great potential application value and profound influence significance.
Disclosure of Invention
The invention aims to provide a visualization method for detecting cytomegalovirus nested PCR products by simulating peroxidase activity through a G quadruplex structure, so that a method for detecting whether human serum contains cytomegalovirus or not with low cost and high efficiency is realized.
The clinical detection method for detecting whether human serum contains cytomegalovirus mainly comprises enzyme-linked immunosorbent assay (ELISA) and Polymerase Chain Reaction (PCR). The ELISA method has high false negative rate, which often affects the accuracy of the test result; PCR, and particularly qPCR, is highly sensitive, but the cost of detection is too high, limiting its application to large-scale screening in developing countries and third world populations.
In order to solve the problems, the invention utilizes a nested PCR technology to amplify target DNA for two times, and simultaneously utilizes the characteristic that a G quadruplet-hemin compound can catalyze a substrate to generate color change, thereby constructing a visualization method with high sensitivity, strong specificity and low detection cost, and being used for detecting whether human serum contains cytomegalovirus.
The method for visually detecting the cytomegalovirus constructed based on the nested PCR technology comprises the following steps:
1) the designed gene sequence is as follows:
the DNA primer sequence (primer) used in the present invention was synthesized and purified by Biotechnology, Inc. (China, Shanghai), and the specific sequence was as follows:
2) the experimental steps of the invention are as follows:
① extraction of Cytomegalovirus DNA
The subject was first withdrawn 1mL of venous blood using a sterile syringe, injected into a sterile 1.5mL Eppendoff tube, and allowed to stand overnight at 4 ℃. The upper serum (note that no erythrocytes were taken) was pipetted into another sterile 1.5mL Eppendoff tube, which was the serum specimen. 50 μ L of serum was added to 50 μ L of DNA extract and stirred well, incubated at 100 ℃ for 10 minutes, centrifuged at 12,000 rpm for 5 minutes, and 5 μ L of supernatant (containing viral DNA) was taken for PCR amplification.
② Nest PCR amplification
First round amplification: 50uL of the test system contained 5uL of template, 1uL of forward and reverse primers, 2U of Taq enzyme, 5uL of PCR buffer (100 mM Tris-HCl, 400mM NaCl, 15mM MgCl. sub.15 mM)2PH = 8.3), 1uL of dNTP, and the remainder was made up with sterile double distilled water. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 4min, amplification at 95 ℃ for 30s, amplification at 52 ℃ for 30s, amplification at 72 ℃ for 30s, and 30 cycles.
And (3) second round amplification: 25uL of the template diluted by 10000 times, 0.5uL of front and back primers, 1U of Taq enzyme, 2.5uL of PCR buffer and 0.5uL of dNTP in the system to be detected are filled with sterilized double distilled water. And (3) PCR reaction conditions: after pre-denaturation at 95 ℃ for 4min, amplification is carried out for 30s at 95 ℃, 30s at 57 ℃ and 30s at 72 ℃ for 30 cycles.
③ visual colorimetric reaction
Adding 1uL of MB to the product, heating at 95 deg.C for 5min, cooling to room temperature, adding 2uL of hemin reagent, reacting for 10min, adding the mixture to 60uL of TMB solution, reacting for 10min, adding an equal volume of H2SO4The reaction was terminated. Finally, the concentration was measured by an ELISA at a wavelength of 450 nm.
④ polyacrylamide gel electrophoresis verification result
Prepare 10mL of 8% polyacrylamide gel: methylene bisacrylamide 2.66mL, distilled water 5.27mL, 5 TBE2mL, NH2SO470uL, TEMED 3.5uL, set at 90v, electrophoresed for 45min, stained with EB for 15min, and finally exposed on a gel imager.
The invention has the advantages that:
1. by adopting the nested PCR technology, a visualization method capable of detecting cytomegalovirus in human serum is constructed, the detection cost is reduced, the detection time is shortened, and the detection specificity is improved.
2. The target is subjected to PCR amplification twice, so that the concentration of target DNA in a detection sample is improved, and the detection sensitivity is greatly improved.
2. By adopting the visual detection method, the dependence of the detection result on the instrument can be avoided, and the convenient detection target which can be identified by naked eyes can be realized. Meanwhile, a new detection method is provided for large-scale screening of cytomegalovirus of developing countries and third world population.
Drawings
FIG. 1 is an experimental schematic of the design of the present invention.
FIG. 2 shows the experimental results of the present invention. Wherein a) the native polyacrylamide gel electrophoresis is performed, the second lane shows the result of the normal PCR, and the third lane shows the result of the nested PCR. b) And (3) colorimetric reaction: the experimental group (yellow) is on the left and the control group (light yellow) is on the right. c) The results were measured at 450nm with a microplate reader, and the error bar represents the standard deviation of 5 independent samples.
FIG. 3 is a graph showing the specificity of the assay results. Wherein a) is non-denaturing polyacrylamide gel electrophoresis, the primer ratios from left to right are respectively 1:1, 1:20, 1:40, 1:60, 1:80 and 1:100, four bands can be seen on an electric lane of asymmetric PCR, and the four bands are respectively single-stranded DNA, single-stranded DNA with a specific sequence, double-stranded DNA and double-stranded DNA with a specific sequence. b) The results of the colorimetric reaction show that the different primer ratios allow for visual differences in sample color. c) The results were measured at 450nm with a microplate reader, and the error bar represents the standard deviation of 5 independent samples.
Detailed Description
Example 1
The method for visually detecting the cytomegalovirus constructed based on the nested PCR technology comprises the following steps:
1) the designed gene sequence is as follows:
the DNA primer sequence (primer) used in the present invention was synthesized and purified by Biotechnology, Inc. (China, Shanghai), and the specific sequence was as follows:
oligonucleotide chains were purchased from Biotechnology engineering, Inc. (China, Shanghai), Tris-HCl, hemin (hemin), dimethyl sulfoxide (DMSO), sodium chloride, magnesium chloride, all from Sigma. Hydrogen peroxide (H)2O2) 30% methylene bisacrylamide, ammonium persulfate ((NH)4)2S2O8) Tetramethylethylenediamine (TEMED), TBE buffer were purchased from Dingguo, dNTP, Taq enzyme from GeneView. In the experimental process, 20 patient specimens and 20 healthy control group specimens are collected totally, and all serum specimens come from the first hospital affiliated to Fujian medical university and meet the requirements of human ethics.
2) Setting experimental instruments and experimental parameters:
Milli-Q ultrapure water systems (Millipore, Bedford, USA), and all the experimental water is the ultrapure water purified by the system;
PHS-3C type precision acidometer (Shanghai Dapu Instrument Co., Ltd.);
FINNPIPETTE Adjustable pipettors (Shanghai thermoelectric instruments, Inc.);
a PCR amplification instrument; reaction conditions in the first round of PCR amplification: pre-denaturation at 95 ℃ for 4min, amplification at 95 ℃ for 30s, amplification at 52 ℃ for 30s, amplification at 72 ℃ for 30s, and 30 cycles. Reaction conditions in the second round of PCR: after pre-denaturation at 95 ℃ for 4min, amplification is carried out for 30s at 95 ℃, 30s at 57 ℃ and 30s at 72 ℃ for 30 cycles.
Performing polyacrylamide gel electrophoresis; the electrophoresis parameters during the experiment are set as follows: voltage 90v, EB staining for 15 min.
3) The principle of the new method for visually detecting the cytomegalovirus constructed based on the nested PCR technology is as follows:
the target DNA is subjected to first amplification under a first primer pair (primer 1 and primer 2) and then to second amplification under a second primer pair (primer 3 and primer 4), so that the concentration of the target DNA is sufficiently increased, and the detection sensitivity is improved. Meanwhile, a second pair of primers is modified, a specific DNA sequence is added at the 5' end of the primers, the specific DNA sequence can be used as a template to generate a specific sequence in the amplification process, the specific sequence can be complementary with the DNA sequence of the molecular beacon, after the hairpin structure of the molecular beacon DNA is opened, the molecular beacon can immediately form a G quadruplex structure and is combined with hemin to form a G quadruplex-hemin complex, and the complex can catalyze a substrate to change the color of the G quadruplex-hemin complex. Therefore, whether the serum to be tested contains cytomegalovirus can be judged through the color change.
4) The experimental steps of the invention are as follows:
① extraction of Cytomegalovirus DNA
The subject was first withdrawn 1mL of venous blood using a sterile syringe, injected into a sterile 1.5mL Eppendoff tube, and allowed to stand overnight at 4 ℃. The upper serum (note that no erythrocytes were taken) was pipetted into another sterile 1.5mL Eppendoff tube, which was the serum specimen. 50 μ L of serum was added to 50 μ L of DNA extract and stirred well, incubated at 100 ℃ for 10 minutes, centrifuged at 12,000 rpm for 5 minutes, and 5 μ L of supernatant (containing viral DNA) was taken for PCR amplification.
② Nest PCR amplification
First round amplification: 50uL of the test system contained 5uL of template, 1uL of forward and reverse primers, 2U of Taq enzyme, 5uL of PCR buffer (100 mM Tris-HCl, 400mM NaCl, 15mM MgCl. sub.15 mM)2PH = 8.3), 1uL of dNTP, and the remainder was made up with sterile double distilled water. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 4min, amplification at 95 ℃ for 30s, amplification at 52 ℃ for 30s, amplification at 72 ℃ for 30s, and 30 cycles.
And (3) second round amplification: 25uL of the template diluted by 10000 times, 0.5uL of front and back primers, 1U of Taq enzyme, 2.5uL of PCR buffer and 0.5uL of dNTP in the system to be detected are filled with sterilized double distilled water. And (3) PCR reaction conditions: after pre-denaturation at 95 ℃ for 4min, amplification is carried out for 30s at 95 ℃, 30s at 57 ℃ and 30s at 72 ℃ for 30 cycles.
③ visual colorimetric reaction
Adding 1uL of MB to the product, heating at 95 deg.C for 5min, cooling to room temperature, adding 2uL of hemin reagent, reacting for 10min, adding the mixture to 60uL of TMB solution, reacting for 10min, adding an equal volume of H2SO4The reaction was terminated. Finally, the concentration was measured by an ELISA at a wavelength of 450 nm.
④ polyacrylamide gel electrophoresis verification result
Prepare 10mL of 8% polyacrylamide gel: methylene bisacrylamide 2.66mL, distilled water 5.27mL, 5 TBE2mL, NH2SO470uL, TEMED 3.5uL, set at 90v, electrophoresed for 45min, stained with EB for 15min, and finally exposed on a gel imager.
5) The reaction conditions of the present invention are optimized
In the invention, the reaction time of MB and hemin is respectively optimized for 30min, 20min and 10min, each group of independent experiments is 5 times, three times of different time differences cannot be respectively distinguished by naked eyes, the experimental results are statistically analyzed by SPSS, and an ANOVA method is used for testing, so that the differences of the three are found to have no statistical significance (P is more than 0.05), and the reaction time is set to be 10 min.
6) Repetitive study of the invention
The 20 serum samples infected with cytomegalovirus and 20 healthy control samples were collected, and the absorbance mean value obtained by subtracting the absorbance mean value of the blank group from the absorbance mean value of the experimental group was 0.1768, the standard deviation was 0.01065, and the calculated RSD =6.02%, thus indicating that the experiment was very reproducible.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian medical university
<120> visualization method for detecting cytomegalovirus nested PCR product
<130>5
<160>5
<170>PatentIn version 3.3
<210>1
<211>18
<212>DNA
<213> Artificial sequence
<400>1
gcactgaggc aagttctg 18
<210>2
<211>19
<212>DNA
<213> Artificial sequence
<400>2
tgaggataag cgggagatg 19
<210>3
<211>56
<212>DNA
<213> Artificial sequence
<400>3
acttgagcac ggagtagtcg tcggaaggga gtaggtggtc ttagggaagg ctgagt 56
<210>4
<211>36
<212>DNA
<213> Artificial sequence
<400>4
acttgagcac ggagtaggtc ttagggaagg ctgagt 36
<210>5
<211>61
<212>DNA
<213> Artificial sequence
<400>5
tgggtagggc gggttgggaa cttgagcacg gagtagtcgt cggaagggag tatcccaacc 60
c 61
Claims (2)
1. A primer for detecting cytomegalovirus nested PCR products is characterized in that: the primers are as follows:
Primer 1：GCACTGAGGCAAGTTCTG；
Primer 2：TGAGGATAAGCGGGAGATG；
Primer 3: ACTTGAGCACGGAGTAGTCGTCGGAAGGGAGTAGGTGGTCTTAGGGAAGGCTGAGT;
Primer 4: ACTTGAGCACGGAGTAGGTCTTAGGGAAGGCTGAGT;
MB: TGGGTAGGGCGGGTTGGGAACTTGAGCACGGAGTAGTCGTCGGAAGGGAGTATCCCAACCC。
2. the visualization method for detecting cytomegalovirus nested PCR products by using the primer of claim 1, wherein: the method comprises the following specific steps:
(1) extraction of Cytomegalovirus DNA
Firstly, 1mL of venous blood of a detected person is extracted by a sterile injector, injected into a sterile 1.5mL Eppendoff tube, kept stand overnight at 4 ℃, and upper serum is sucked into another sterile 1.5mL Eppendoff tube, namely a serum specimen; adding 50 mul DNA extracting solution into 50 mul serum, stirring uniformly, keeping the temperature at 100 ℃ for 10 minutes, centrifuging at 12,000 rpm for 5 minutes, and taking 5 mul virus-containing DNA supernatant to perform PCR amplification;
(2) nest PCR amplification
First round amplification: 50uL of template containing 5uL, 1uL of Taq enzyme of a forward Primer1 and a backward Primer2, 2U, and 5uL PCR buffer containing 100mM Tris-HCl, 400mM NaCl and 15mM MgCl2dNTP with PH =8.3, 1uL, and the rest is complemented by sterilized double distilled water; and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 4min, amplification at 95 ℃ for 30s, amplification at 52 ℃ for 30s, amplification at 72 ℃ for 30s, and 30 cycles;
and (3) second round amplification: 25uL of template diluted by 10000 times, 0.5uL of front and back primers Primer3 and Primer4, 1U of Taq enzyme, 2.5uL of PCR buffer, and 0.5uL of dNTP residual volume are complemented by sterilized double distilled water; and (3) PCR reaction conditions: after pre-denaturation at 95 ℃ for 4min, amplification is carried out for 30s at 95 ℃, 30s at 57 ℃ and 30s at 72 ℃ for 30 cycles;
(3) visual colorimetric reaction
Adding 1uL of MB to the product, heating at 95 deg.C for 5min, cooling to room temperature, adding 2uL of hemin reagent, reacting for 10min, adding the mixture to 60uL of TMB solution, reacting for 10min, adding an equal volume of H2SO4Terminating the reaction; finally, detecting the concentration by an enzyme-linked immunosorbent assay with the wavelength of 450 nm;
(4) polyacrylamide gel electrophoresis verification result
Prepare 10mL of 8% polyacrylamide gel: methylene bisacrylamide 2.66mL, distilled water 5.27mL, 5 TBE2mL,NH2SO470uL, TEMED 3.5uL, set at 90v, electrophoresed for 45min, stained with EB for 15min, and finally exposed on a gel imager.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710144061.9A CN106868211B (en) | 2017-03-13 | 2017-03-13 | Visualization method for detecting cytomegalovirus nested PCR product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710144061.9A CN106868211B (en) | 2017-03-13 | 2017-03-13 | Visualization method for detecting cytomegalovirus nested PCR product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106868211A CN106868211A (en) | 2017-06-20 |
| CN106868211B true CN106868211B (en) | 2020-03-27 |
Family
ID=59171797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710144061.9A Expired - Fee Related CN106868211B (en) | 2017-03-13 | 2017-03-13 | Visualization method for detecting cytomegalovirus nested PCR product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868211B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334612A (en) * | 2020-03-27 | 2020-06-26 | 倍科为(天津)生物技术有限公司 | Primer group, detection method and kit for detecting drug resistance of cytomegalovirus |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103627822A (en) * | 2013-12-13 | 2014-03-12 | 温州医科大学 | Novel and highly-sensitive detection method for latent human cytomegalovirus (HCMV) in cell |
| CN105331698A (en) * | 2015-11-05 | 2016-02-17 | 瀚吉康生物科技（北京）有限公司 | Reagent kit for multi-type detection of human cytomegalovirus (HCMV) and application thereof |
-
2017
- 2017-03-13 CN CN201710144061.9A patent/CN106868211B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN106868211A (en) | 2017-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101818207B (en) | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| Sauvage et al. | Viral metagenomics applied to blood donors and recipients at high risk for blood-borne infections | |
| CN109777893A (en) | The invisible hepatitis B detection kit of droplet type digital pcr | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| CN102337351A (en) | Typing detection kit for influenza virus | |
| CN109852731A (en) | The application of primer combination of probe and its kit in HBV detection | |
| CN101712973A (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN106676198A (en) | High-sensitivity quantitative detection kit for herpes virus 4 and herpes virus 5 | |
| CN106868211B (en) | Visualization method for detecting cytomegalovirus nested PCR product | |
| Ozoemena et al. | Comparative evaluation of measles virus specific TaqMan PCR and conventional PCR using synthetic and natural RNA templates | |
| CN106566889B (en) | Primer, probe, kit and method for detecting proteus mirabilis | |
| CN112195274A (en) | Novel coronavirus virus sample treatment liquid and treatment method and rapid constant-temperature reverse transcription amplification kit for detecting viruses | |
| CN108603226A (en) | The quantitative measurment of hepatitis B virus C CCDNA | |
| CN109852732A (en) | The invisible hepatitis B detection kit of quantitative fluorescent PCR | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| CN111057791A (en) | Kit for detecting HBV pgRNA in blood | |
| CN104278024B (en) | For identifying Primer composition and their application of human adenovirus 55 type | |
| LU500740B1 (en) | REAL-TIME FLUORESCENT PCR DETECTION PRIMERS AND PROBES, KIT AND METHOD FOR NOVEL CORONAVIRUS 2019-nCoV | |
| AU2020102421A4 (en) | A primer combination for detecting 2019ncov by loop-mediated isothermal amplification | |
| CN106929609A (en) | Differentiate the PCR detection kit and its primer special of CSFV and bovine viral diarrhoea bovine diarrhoea virus | |
| CN104073570A (en) | Primer pair and primer probe composition used for identifying human adenovirus type 55, and application thereof | |
| CN105441588A (en) | Dengue I, II, III, IV-type RT-PCR one-step MIX detection kit, and detection method thereof | |
| CN104480221A (en) | Quick high-flux dengue fever virus detection typing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200327 Termination date: 20210313 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |