CN106868115A - For detecting the specific primer of strongylid and its application after pig lunge - Google Patents
For detecting the specific primer of strongylid and its application after pig lunge Download PDFInfo
- Publication number
- CN106868115A CN106868115A CN201710061745.2A CN201710061745A CN106868115A CN 106868115 A CN106868115 A CN 106868115A CN 201710061745 A CN201710061745 A CN 201710061745A CN 106868115 A CN106868115 A CN 106868115A
- Authority
- CN
- China
- Prior art keywords
- pig
- dna
- primer
- strongylid
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The present invention provides a kind of specific primer that can be used to detecting strongylid after pig lunge, and the nucleotides sequence of specific primer including sense primer MeJB3 F and anti-sense primer MeJB4.5 R, MeJB3 F is classified as：The nucleotides sequence of 5'TGAAAGAATTCATGAATTGAAAACG 3', MeJB4.5 R is classified as：5'‑AGATTTCATATTGTATTTAATTTTTG‑3'.The present invention also provide it is a kind of can be used for detect pig lunge after strongylid detection kit, detection kit includes that, for the DNA lysates cracked to sample DNA, the PCR reaction solutions expanded to sample DNA and primer mixed liquor, primer mixed liquor includes foregoing specific primer.The present invention also provides a kind of application of foregoing specific primer strongylid after pig lunge is detected.The specific primer and detection kit that the present invention is provided have the characteristics of specificity is high, detection efficiency is high, the holding time is long.
Description
Technical field
The invention belongs to technical field of gene detection, more particularly to a kind of specificity for detecting strongylid after pig lunge
Primer and its application.
Background technology
Strongylid is circular mesh, Hou Yuanke, rear circle category after pig, is strongylid, Metastrongylus pudendotectus, Sa Mushi after pig lunge
Afterwards after 3 kinds of strongylid strongylid general name, pig metastrongylosis be it is a kind of by nematosis in pig bronchus and bronchiole
Nematodiasis, because polypide is in thread, parasitizes lungs, therefore also known as pig lung filariasis or hoose.
Strongylid is susceptible to sheep, ox, pig after pig, occasionally in sheep, deer, ox and other ruminate beast, also occasionally in people, mainly
Occur in young pig, the death rate is higher, endanger larger.Pig lung filariasis is in endemic conditions, multiple in river valley area and low-heat area.
China, Jiangxi Province's pig metastrongylosis infection rate is 40%, and Liaoning Province is 59.81%, and Hunan Province is 5.93%, and Hebei province is
18.5%, Jiangsu Province is 43.6%, and Sichuan Province is 20.7, and in significantly ascendant trend year by year.
Accurate Diagnosis to pig metastrongylosis are this sick premises of effective prevention and control, and the main basis of existing detection method is faced
Bed symptom, Epidemiology, pathological change, tentative diagnosis is carried out, and made a definite diagnosis further combined with stool examination worm's ovum, though
Right existing detection method is simple and easy to apply, there is certain accuracy to adult, but for being difficult to differentiate between species in form.It is particularly each
Nematode is planted to be difficult to differentiate between in worm's ovum and larval stage, and it is round after strongylid, pig Metastrongylus pudendotectus, pig Sa Mushi after pig lunge
Strongylid is also difficult to differentiate between each other after 3 kinds of nematode, at the same existing detection method detection efficiency, detection accuracy it is relatively low, detection
The examined personnel's experience influence of result is big.
Therefore, it is necessary to do further exploitation to strongylid detection after existing pig lunge, there is provided a kind of detection method detection
Efficiency high, detection accuracy are high, the examined personnel's experience influence of testing result is small detection kit and its application method.
The content of the invention
The technical problems to be solved by the invention are to overcome the shortcomings of to be mentioned and defect in background above technology, there is provided one
Kind can be used to detecting the specific primer of strongylid and its application after pig lunge, it has, and testing result is accurate, detection efficiency is high
Advantage.
In order to solve the above technical problems, technical scheme proposed by the present invention is：
The present invention provides a kind of specific primer that can be used to detecting strongylid after pig lunge, and the specific primer includes
Sense primer MeJB3F and anti-sense primer MeJB4.5R,
The nucleotides sequence of the MeJB3F is classified as：5'-TGAAAGAATTCATGAATTGAAAACG-3'；
The nucleotides sequence of the MeJB4.5R is classified as：5'-AGATTTCATATTGTATTTAATTTTTG-3'.
The strongylid cox1 genes after comparing many boars, for relatively stablize conserved regions design described in MeJB3F and
MeJB4.5R, it is contemplated that amplified fragments size is about 400bp or so.G+C contents are 40%~60% in primer sequence, and upstream and downstream is drawn
Thing does not exist secondary structure, and interworking possibility is low, and primer has specificity.
The present invention also provide it is a kind of can be used for detect pig lunge after strongylid detection kit, the detection kit bag
Include for the mixing of the DNA lysates cracked to sample DNA, the PCR reaction solutions expanded to sample DNA and primer
Liquid, the primer mixed liquor includes above-mentioned specific primer.
The detection kit of strongylid after above-mentioned pig lunge, also including positive control solution, the positive control solution includes pig
Strongylid DNA after lunge.
The detection kit of strongylid after above-mentioned pig lunge, the DNA lysates are main by 100mM NaCl70 μ l, pH value
For 8.0 the μ l of 10mM Tris-Cl 30, the μ l of 25mM EDTA150 μ l, 1%W/V lauryl sodium sulfate 30 that pH value is 8.0 and
The μ l of 1.7 μ g/ μ L Proteinase Ks 200 are constituted.The DNA lysates use suitable proportional arrangement, it is to avoid the wasting of resources.
Above-mentioned detection kit, the PCR reaction solutions include PCR buffer solutions, 25mM MgCl2Solution and 2.0mM deoxidations
Ribonucleotide acid solution.
Above-mentioned detection kit, the concentration of MeJB3F and MeJB4.5R is described in the primer mixed liquor
100pmol/μL。
The present invention also provides a kind of application of specific primer described above strongylid after pig lunge is detected.
Above-mentioned application, detection kit is made using the specific primer, and the detection kit is included for right
DNA lysates that sample DNA is cracked, the PCR reaction solutions expanded to sample DNA and primer mixed liquor, it is described to draw
Thing mixed liquor includes the specific primer, and the application method of the detection kit is comprised the following steps：
(1) extraction of DNA：Take polypide sample distilled water to be measured and blow and beat flushing repeatedly, remove distilled water, add DNA to split
Solution liquid is placed in 16-18h in 37~55 DEG C of incubators, then extracts DNA, prepares sample DNA；
(2) PCR amplifications：Take sterilizing ddH2O, PCR reaction solution, Taq enzyme and primer mixed liquor are by suitable PCR reaction systems
Add in centrifuge tube, packing is obtained many parts of packing liquid in being put into multiple centrifuge tubes after mixing, takes the sample DNA of step (1) preparation,
Each sample DNA is corresponding to add simultaneously label, mixing in a packing liquid, is placed in PCR amplification instrument by suitable PCR amplification conditions
Reaction, is obtained pcr amplification product；
(3) PCR primer observation：The pcr amplification product for taking step (2) preparation is loaded onto 1.0% Ago-Gel according to label
On, 120~130V electrophoresis are after 20~40 minutes, are placed under ultraviolet transilluminator and see whether band occur, if there is 400bp
The band of~410bp sizes, then polypide sample to be measured is strongylid after pig lunge；If in the absence of the bar of 400bp~410bp sizes
Band, then polypide sample to be detected is not strongylid after pig lunge.
The application method of above-mentioned detection kit, in the step (2) PCR reaction systems be the μ L of PCR buffer solutions 2~3,
The MgCl of 25mM2The μ L of 3~4 μ L, 2.0mM deoxyribonucleotides solution of solution 2, the μ L of Taq enzyme 0.25~0.3 of 5U/ μ L, sample
DNA, primer mixed liquor 0.8~1.2 μ L, balance of sterilizing ddH2O is mended to 25 μ L.
The application method of above-mentioned detection kit, PCR amplification conditions are in the step (2)：94 DEG C of predegeneration 5min；
94 DEG C of denaturation 30sec, 52~58 DEG C of annealing 30sec, 72 DEG C of extension 30sec, totally 38 circulations；72 DEG C of extension 5min.
Compared with prior art, the advantage of the invention is that：
1st, purpose fragment can be effectively amplified by designing MeJB3F and MeJB4.5R, so as to justify after detecting pig lunge
Nematode, while strongylid is reactionless after pig Metastrongylus pudendotectus and pig Sa Mushi to belonging to together, distinguishes from gene aspect；
2nd, the specificity of detection kit is high, detection is accurate, detection efficiency is high；
3rd, by the application method of detection kit, clearly band can be amplified, for testing and analyzing, and operation one
Cause property is high；
4th, detection kit is readily transported in itself, to deposit shelf lives long.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
The accompanying drawing to be used needed for having technology description is briefly described, it should be apparent that, drawings in the following description are the present invention
Some embodiments, for those of ordinary skill in the art, on the premise of not paying creative work, can also basis
These accompanying drawings obtain other accompanying drawings.
Fig. 1, to use the pcr amplification product electrophoretogram of the preferred embodiment of detection kit one for providing of the invention；
Fig. 2, is used to detect the pcr amplification product of the preferred embodiment of different nematodes one for the detection kit that the present invention is provided
Electrophoretogram；
Fig. 3, the pcr amplification product electrophoretogram prepared after being deposited 10 months for the detection kit that the present invention is provided.
Specific embodiment
For the ease of understanding the present invention, do more complete to inventing herein below in conjunction with Figure of description and preferred embodiment
Face, meticulously describe, but protection scope of the present invention is not limited to specific examples below.
Unless otherwise defined, all technical terms used hereinafter are generally understood that implication phase with those skilled in the art
Together.Technical term used herein is intended merely to describe the purpose of specific embodiment, is not intended to limitation of the invention
Protection domain.
Unless otherwise specified, various raw material, reagent, instrument and equipment used in the present invention etc. can be by city
Field is commercially available or can be prepared by existing method.
Unless otherwise specified, DNA extraction kit is used for Pu Luomaige (Beijing) biotechnology has in the present invention
The WizardTM DNA Clean-Up System that limit company provides.
Embodiment 1
The present invention provide it is a kind of can be used for detect pig lunge after strongylid specific primer, specific primer include upstream
Primer MeJB3F and anti-sense primer MeJB4.5R,
The nucleotides sequence of MeJB3F is classified as：5'-TGAAAGAATTCATGAATTGAAAACG-3'；
The nucleotides sequence of MeJB4.5R is classified as：5'-AGATTTCATATTGTATTTAATTTTTG-3'.
The present invention provide it is a kind of can be used for detect pig lunge after strongylid detection kit.Detection kit it is main by
DNA lysates, PCR reaction solutions, positive control solution and primer mixed liquor composition.
It is 8.0 by the μ l of 100mM NaCl 70, the μ l of 10mM Tris-Cl 30 that pH value is 8.0, pH value that DNA lysates are main
The μ l of 25mM EDTA150 μ l, 1%W/V lauryl sodium sulfate 30 and the μ l of 1.7 μ g/ μ L Proteinase Ks 200 composition.
PCR reaction solutions include PCR buffer solutions, 25mM MgCl2Solution and 2.0mM deoxyribonucleotide solution.
Positive control solution contains strongylid DNA after pig lunge.
Primer mixed liquor include specific primer, specific primer include MeJB3F and MeJB4.5R, wherein MeJB3F and
The concentration of MeJB4.5R is 100pmol/ μ L.MeJB3F and MeJB4.5R are respectively the cox1 sequences spy of strongylid after pig lunge
Different in nature upstream and downstream primer, it is contemplated that amplified fragments size is about 400bp.
The present invention also provides a kind of application of above-mentioned specific primer strongylid after pig lunge is detected.Drawn using specificity
Thing is made detection kit, detection kit include for sample DNA is cracked DNA lysates, sample DNA is carried out
The PCR reaction solutions and positive control solution and primer mixed liquor of amplification, primer mixed liquor include specific primer.Above-mentioned detection
The application method of kit is comprised the following steps：
(1) extraction of DNA：Take polypide sample to be measured to be placed in the centrifuge tube of 1.5mL, blow and beat flushing 6 repeatedly with distilled water
More than secondary, the water in centrifuge tube, plus DNA lysate digesting proteins are removed, discharge genomic DNA, 55 DEG C of incubator 16-18h, system
Polypide suspension is obtained, the polypide suspension that will be prepared extracts sample DNA, the sample that extraction is obtained by DNA extraction kit operation instruction
DNA directly uses or is put in -20 DEG C of Refrigerator stores standby.
(2) PCR amplifications：The suitable PCR reaction systems of selection, if n is sample DNA quantity, with (n+3) times PCR reactants
The proportioning of system to sequentially added in centrifuge tube sterilizing ddH2O, PCR buffer solution, MgCl2, deoxyribonucleotide, primer mixed liquor,
Taq enzyme, in the present embodiment, the quantity of sample DNA is 3, then to sequentially adding 84 μ L sterilizings ddH in centrifuge tube2O、21μL
PCR buffer solutions, 12 μ L MgCl2, 6 μ L deoxyribonucleotides, 3 μ LMeJB3F, 3 μ LMeJB4.5R, 1.5 μ L Taq enzymes, whirlpool
Concussion is mixed, and packing is obtained 5 parts of packing liquid in being put into 5 centrifuge tubes of 0.2 μ L after mixing, and often pipe places 24 μ L.Take step (1)
The sample DNA of preparation, each sample DNA is corresponding to add simultaneously label, mixing in a packing liquid, is placed in PCR amplification instrument by suitable
The PCR amplification conditions reaction of conjunction, is obtained pcr amplification product；
Negative control is set simultaneously to ensure pollution-free detection kit, experimental implementation specification, reliable experiment result, it is negative
Control is that sample DNA is added without in liquid is dispensed using abovementioned steps treatment, difference, adds same volume
ddH2O；Set positive control conveniently to compare with sample P CR amplified productions, it is ensured that reliable experiment result, positive control is used
Abovementioned steps treatment, difference is that sample DNA is added without in liquid is dispensed, and adds the positive control solution of same volume.
Table 1 is referred to, is 25 μ L PCR reaction systems.Specifically, PCR reaction systems use 25 μ L bodies in the present embodiment
System, proportioning that in other embodiments can also be as needed to table 1 carries out the change of equal proportion.
The μ L PCR reaction systems of table 1 25
PCR amplification conditions are：
(3) PCR primer observation：The pcr amplification product of the sample DNA prepared in step (2), the PCR of negative control is taken to expand
The pcr amplification product of volume increase thing and positive control is loaded onto on 1.0% Ago-Gel respectively, and 128V electrophoresis 30 minutes is placed in
Result and photographic analysis are observed under ultraviolet transilluminator, if there is the band of 400bp~410bp sizes, polypide sample to be measured is
Strongylid after pig lunge；If in the absence of the band of 400bp~410bp sizes, polypide sample to be detected is not circle after pig lunge
Nematode.
Fig. 1 is referred to, to use the pcr amplification product electrophoresis of the preferred embodiment of detection kit one for providing of the invention
Figure.Wherein, swimming lane M is Marker；The pcr amplification product that swimming lane 1~3 is obtained for strongylid sample after pig lunge, swimming lane 4 is the moon
Property control, swimming lane 5 be positive control.Can be drawn by Fig. 1, a clearly band occurs in swimming lane 1~3, the size of band is
400bp or so, meets design of primers.Negative control is reactionless.There is the clear band of a 400bp or so in positive control, with
The pillar location of swimming lane 1~3 is the same, meets experimental design.Obtained pcr amplification product in step (2) is sequenced, then will be surveyed
Sequence result is compared with NCBI gene databases, is consistent with design of primers, is strongylid DNA after pig lunge.
Embodiment 2
The application method of the detection kit that the detection kit and the present invention provided using the present invention are provided, to pig ascarid
Circle after strongylid, pig Metastrongylus pudendotectus, pig Sa Mushi after worm, Trichocephalus, Oesophagostomum, Schistosoma japonicum, pig lunge
Nematode is detected.Specific method is as follows：
(1) extraction of DNA：The learnt from else's experience ascaris suum of DNA validation verifications, Trichocephalus, Oesophagostomum, Japanese blood is inhaled
The DNA sample of strongylid is standby after strongylid, Metastrongylus pudendotectus, Sa Mushi after worm, pig lunge；
(2) PCR amplifications：By 9 times of suitable PCR reaction systems, to sequentially added in centrifuge tube sterilizing ddH2O, buffering
Liquid, MgCl2, deoxyribonucleotide, primer mixed liquor, Taq enzyme, whirlpool concussion mix, after mixing packing be put into multiple 0.2 μ L
Centrifuge tube in many parts of packing liquid are obtained, each centrifuge tube places 24 μ L, and each sample DNA for taking step (1) preparation adds one
Simultaneously label, mixing, is placed in PCR amplification instrument and is reacted by suitable PCR amplification conditions in part packing liquid, prepared pcr amplification product；
Negative control and positive control are set simultaneously, and negative control is prepared using abovementioned steps, difference is to divide
Sample DNA is added without in dress liquid, the ddH of same volume is added2O, positive control is prepared using abovementioned steps, and difference exists
In, sample DNA is added without in liquid is dispensed, add the positive control solution of same volume.
Specifically, using 25 μ L PCR reaction systems in the present embodiment.Table 2 is referred to, is 25 μ L PCR reaction systems.
The μ L PCR reaction systems of table 2 25
PCR amplification conditions are：
(3) PCR primer observation：Take the PCR amplifications of pcr amplification product, negative control that sample DNA is prepared in step (2)
The pcr amplification product of product and positive control is loaded onto 128V electrophoresis 30 minutes on 1.0% Ago-Gel, is placed in ultraviolet transmission
Result and photographic analysis are observed under instrument, if there is the band of 400bp~410bp sizes, polypide sample to be measured is for after pig lunge
Strongylid；If in the absence of the band of 400bp~410bp sizes, polypide sample to be detected is not strongylid after pig lunge.
Fig. 3 is referred to, for the detection kit that the present invention is provided is used to detect that the PCR of the preferred embodiment of different nematodes one expands
Volume increase thing electrophoretogram.Wherein, swimming lane M is Marker；Swimming lane 1~7 is respectively by the different polypide samples of DNA validation verifications
Pcr amplification product, be followed successively by strongylid after ascaris suum, Trichocephalus, Oesophagostomum, Schistosoma japonicum, pig lunge, pig multiple
Strongylid after strongylid, pig Sa Mushi after the moon.Can be drawn by Fig. 1, swimming lane 1~4 is without band, it was demonstrated that detection kit is to pig ascarid
Worm, Trichocephalus, Oesophagostomum, Schistosoma japonicum are reactionless.Swimming lane 5 has a clearly band, and the size of band is
400bp or so, meets design of primers, is strongylid amplified production after pig lunge.Swimming lane 6~8 is without band, it was demonstrated that detection reagent
Box is reactionless to strongylid after pig Metastrongylus pudendotectus and pig Sa Mushi.Pcr amplification product prepared by step (2) is surveyed
Sequence, then sequencing result is compared with NCBI gene databases, it is consistent with design of primers, sequencing result is circle after pig lunge
Nematode DNA, further checking detection kit energy effective detection goes out strongylid after pig lunge, and is distinguished with nematodes.
Ascaris suum, Trichocephalus, Oesophagostomum, Schistosoma japonicum on the morphosis and biological classification with pig after circle
Nematode is similar, strongylid, pig Metastrongylus pudendotectus and strongylid belongs to rear strongylid, above-mentioned line after pig Sa Mushi after pig lunge
The existing detection method of worm is difficult to differentiate between.Lunge round wires are gone out using strongylid detection kit energy effective detection after pig lunge
Worm, simultaneously for similar ascaris suum, Trichocephalus, Oesophagostomum, Schistosoma japonicum, and round wires after the multiple the moon of the pig for belonging to together
Strongylid distinguishes after worm and pig Sa Mushi, its high specificity.
By detection kit in 4 DEG C and -20 DEG C preservations, set and place 1 month, 2 months, 3 months, 4 months, 5 months, 6
Individual month, 7 months, 8 months, 9 months, 10 months, detected using the above-mentioned detection kit for placing different time respectively, examined
Application method of the survey method with reference to above-mentioned detection kit.Fig. 3 is referred to, for the detection kit that the present invention is provided deposits 10
The electrophoretogram of the pcr amplification product prepared after month, wherein swimming lane M is Mark, and swimming lane 1~5 is to be deposited 10 months using at 4 DEG C
The amplified production of detection kit, 6~10 is the amplified production pig lunge using the detection kit that 10 months are deposited at -20 DEG C
Strongylid afterwards, swimming lane 11 is：Negative control.By Fig. 2 it is observed that swimming lane 1~~10 can produce clearly band, and
Stripe size is consistent with design of primers.Amplified production is sequenced, then sequencing result is compared with NCBI gene databases
It is right, it is consistent with design of primers and is combined into strongylid DNA after pig lunge.Show to use the detection kit of storage 10 months still can be with
Effective detection goes out strongylid after pig lunge, i.e. detection kit can at least be preserved 10 months at 4 DEG C and -20 DEG C.
<110>Agricultural University Of Hunan
<120>For detecting the specific primer of strongylid and its application after pig lunge
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence
<400> 1
tgaaagaatt catgaattga aaacg 25
<210> 2
<211> 26
<212> DNA
<213>Artificial sequence
<400> 2
agatttcata ttgtatttaa tttttg 26
Claims (10)
1. it is a kind of can be used for detect pig lunge after strongylid specific primer, it is characterised in that the specific primer includes
Sense primer MeJB3F and anti-sense primer MeJB4.5R,
The nucleotides sequence of the MeJB3F is classified as：5'-TGAAAGAATTCATGAATTGAAAACG-3'；
The nucleotides sequence of the MeJB4.5R is classified as：5'-AGATTTCATATTGTATTTAATTTTTG-3'.
2. it is a kind of can be used for detect pig lunge after strongylid detection kit, it is characterised in that the detection kit includes
For the DNA lysates cracked to sample DNA, the PCR reaction solutions expanded to sample DNA and primer mixed liquor,
The primer mixed liquor includes specific primer as claimed in claim 1.
3. detection kit according to claim 2, it is characterised in that the detection kit also includes positive control
Liquid, the positive control solution includes strongylid DNA after pig lunge.
4. detection kit according to claim 2, it is characterised in that the DNA lysates are main by 100mM
NaCl70 μ l, the μ l of 10mM Tris-Cl 30 that pH value is 8.0,25mM EDTA150 μ l, 1%W/V dodecanes that pH value is 8.0
The μ l of the base sodium sulphate 30 and μ l of 1.7 μ g/ μ L Proteinase Ks 200 are constituted.
5. detection kit according to claim 2, it is characterised in that the PCR reaction solutions include PCR buffer solutions,
25mM MgCl2Solution and 2.0mM deoxyribonucleotide solution.
6. detection kit according to claim 2, it is characterised in that in the primer mixed liquor, the MeJB3F and
The concentration of MeJB4.5R is 100pmol/ μ L.
7. the application of a kind of specific primer as claimed in claim 1 strongylid after pig lunge is detected.
8. application according to claim 7, it is characterised in that be made detection kit using the specific primer, institute
Stating detection kit is included for the DNA lysates cracked to sample DNA, the PCR expanded to sample DNA reactions
Liquid and primer mixed liquor, the primer mixed liquor include the specific primer, the application method bag of the detection kit
Include following steps：
(1) extraction of DNA：Take polypide sample distilled water to be measured and blow and beat flushing repeatedly, remove distilled water, add DNA lysates
16-18h in 37~55 DEG C of incubators is placed in, then extracts DNA, prepare sample DNA；
(2) PCR amplifications：Take sterilizing ddH2O, PCR reaction solution, Taq enzyme and primer mixed liquor are added by suitable PCR reaction systems
In centrifuge tube, packing is obtained many parts of packing liquid in being put into multiple centrifuge tubes after mixing, takes the sample DNA of step (1) preparation, each
Sample DNA is corresponding to add simultaneously label, mixing in a packing liquid, is placed in PCR amplification instrument anti-by suitable PCR amplification conditions
Should, pcr amplification product is obtained；
(3) PCR primer observation：The pcr amplification product for taking step (2) preparation is loaded onto on 1.0% Ago-Gel according to label,
After 120~130V electrophoresis 20~40 minutes, be placed under ultraviolet transilluminator and see whether band occur, if exist 400bp~
The band of 410bp sizes, then polypide sample to be measured is strongylid after pig lunge；If in the absence of the bar of 400bp~410bp sizes
Band, then polypide sample to be detected is not strongylid after pig lunge.
9. application according to claim 8, it is characterised in that PCR reaction systems are buffer solution 2~3 in the step (2)
The MgCl of μ L, 25mM2The μ L of 3~4 μ L, 2.0mM deoxyribonucleotides solution of solution 2, the μ L of Taq enzyme 0.25~0.3 of 5U/ μ L,
The μ L of sample DNA 0.8~1, primer mixed liquor 0.8~1.2 μ L, balance of ddH2O is mended to 25 μ L.
10. application according to claim 8, it is characterised in that PCR amplification conditions are in the step (2)：94 DEG C of pre- changes
Property 5min；94 DEG C of denaturation 30sec, 52~58 DEG C of annealing 30sec, 72 DEG C of extension 30sec, totally 38 circulations；72 DEG C of extension 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710061745.2A CN106868115A (en) | 2017-01-26 | 2017-01-26 | For detecting the specific primer of strongylid and its application after pig lunge |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710061745.2A CN106868115A (en) | 2017-01-26 | 2017-01-26 | For detecting the specific primer of strongylid and its application after pig lunge |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106868115A true CN106868115A (en) | 2017-06-20 |
Family
ID=59158148
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710061745.2A Pending CN106868115A (en) | 2017-01-26 | 2017-01-26 | For detecting the specific primer of strongylid and its application after pig lunge |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868115A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921844A (en) * | 2010-07-16 | 2010-12-22 | 浙江农林大学 | Method for rapidly detecting pine-wood nematode and kit thereof |
| CN103841827A (en) * | 2011-08-08 | 2014-06-04 | 加利福尼亚技术学院 | Small molecule compounds that control plant- and insect-pathogenic nematodes |
-
2017
- 2017-01-26 CN CN201710061745.2A patent/CN106868115A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921844A (en) * | 2010-07-16 | 2010-12-22 | 浙江农林大学 | Method for rapidly detecting pine-wood nematode and kit thereof |
| CN103841827A (en) * | 2011-08-08 | 2014-06-04 | 加利福尼亚技术学院 | Small molecule compounds that control plant- and insect-pathogenic nematodes |
Non-Patent Citations (2)
| Title |
|---|
| JANE C. CONOLE ET AL.: "Intraspecific and interspecific variation in the second internal transcribed spacer (ITS-2) sequence for Metastrongylus（Nematoda: Metastrongyloidea）detected by high resolution PCR-RFLP", 《INTERNATIONAL JOURNAL FOR PARASITOLOGY》 * |
| 李智红灯: "猪肺炎支原体与其它病原体的相互作用", 《国外畜牧学—猪与禽》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Djurhuus et al. | Evaluation of filtration and DNA extraction methods for environmental DNA biodiversity assessments across multiple trophic levels | |
| CN107475402B (en) | A kind of gene detecting kit for indication mesenchymal stem cell Osteoblast Differentiation potential in early days | |
| CN103642945B (en) | A kind of highly sensitive Epstein-Barr FLuorescent quantitative PCR kit containing internal reference | |
| CN107326100A (en) | Aftosa and the double real-time fluorescence quantitative PCR detection kit of Sai Nika paddy virus | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN102703603B (en) | Real-time fluorescence nucleic acid constant temperature amplification detection kit of general influenza a virus (IAV) | |
| CN103757139A (en) | Canine distemper virus and canine parvovirus duplex TaqMan-MGB fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof | |
| CN107460242A (en) | A kind of detection kit that can detect a variety of high drug resistant genes simultaneously and its application | |
| CN107058632A (en) | A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method | |
| CN104017891A (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN103388033A (en) | Enterovirus type 71 (EV71) real-time fluorescent nucleic acid isothermal amplification detection kit | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN107312874A (en) | Primer, probe and the kit and method of highly sensitive real time fluorescent quantitative detection HBV nucleic acid | |
| CN102534051A (en) | Kit for detecting enterovirus | |
| CN106636376A (en) | Nucleic acid and kit for detecting human ROS1 fusion genes and application method of kit | |
| CN105671205B (en) | Detect the RT-LAMP primer sets and kit of apis cerana metacercoid virus | |
| CN107653308A (en) | One group is used to distinguishing active tuberculosis patient and is combined with the primer pair of non-tuberculous pneumonia patient and kit | |
| CN102002533A (en) | Kit and method for simultaneously detecting four common epidemic diseases causing egg drop | |
| CN106868115A (en) | For detecting the specific primer of strongylid and its application after pig lunge | |
| CN106591481A (en) | Specific primers for detecting swine metastrongylus salmi and application thereof | |
| CN109680101A (en) | A kind of rapid detection method for distinguishing the strong and weak poison of H7N9 subtype avian influenza virus | |
| CN103789447B (en) | Method for detecting 5'end tRNA semi-molecules | |
| CN110144386A (en) | For detecting the primer, probe and kit of POLE gene mutation | |
| CN108949920A (en) | A kind of relevant flora quantitative amplification method of disease | |
| CN107974505A (en) | HTERT genes are directly detecting the purposes in blood plasma in cfDNA contents using qPCR as reference gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170620 |
|
| RJ01 | Rejection of invention patent application after publication |