CN106866800B - In vivo induction antigen of actinobacillus pleuropneumoniae and application thereof - Google Patents

Abstract

The invention discloses an in vivo induced antigen of actinobacillus pleuropneumoniae and application thereof. The invention firstly discloses an in vivo induced antigen of actinobacillus pleuropneumoniae, and the amino acid sequence of the in vivo induced antigen is shown as SEQ ID NO: 1-6, a method for preparing the antigen, the use thereof, and a vaccine prepared by using the same are also disclosed. The 6 in-vivo induced antigens can effectively promote lymphocyte proliferation and stimulate an organism to generate actinobacillus pleuropneumoniae specific antibodies and cytokines such as gamma-interferon, IL-4 and the like, and have the advantages of strong protectiveness, strong stability, good safety and excellent clinical application prospect.

Description

In vivo induction antigen of actinobacillus pleuropneumoniae and application thereof

Technical Field

The invention relates to an in vivo induction antigen of actinobacillus pleuropneumoniae and application thereof.

Background

Porcine contagious pleuropneumonia is one of important respiratory diseases which endanger the pig industry, and the pathogen of the porcine contagious pleuropneumonia is Actinobacillus pleuropneumoniae (Actinobacillus pleuropneumoniae). The disease is spread by the respiratory system, causing porcine cellulosic pleurisy and hemorrhagic pneumonia. Actinobacillus pleuropneumoniae was isolated from pig lungs in 1957 and is an important respiratory pathogenic microorganism in pigs. APP causes contagious pleuropneumonia (PCP) in pigs, which presents a serious hazard to the world pig industry. It has been found that treatment of swine pneumonia results in an increase in resistance to pathogenic bacteria. The daily use of antibacterial agents as growth promoters also enhances the resistance to pathogenic bacteria. The increase of the cost of the breeding industry caused by the residue of antibiotics and the enhancement of the drug resistance of pathogenic bacteria gradually draws attention of people.

Commercial inactivated APP vaccines have been widely used for the control of PCP. Furthermore, some recombinant antigens of APP are demonstrated to be immunoprotective antigens. Most commercial vaccines currently in use are traditional inactivated vaccines, which provide partial immune protection and reduce mortality, but not morbidity. In a country or region where multiple circulating serotypes prevail, and there are several dominant serotypes, inactivated vaccines are usually derived from one or several dominant sera. Due to the lack of effective cross-protection between different serotypes, it is difficult to effectively control PCP using commercial inactivated vaccines. Some conserved virulence factors of APP (such as apx toxin) are found to provide some cross-protection as vaccine candidate factors.

However, it is not easy to prepare recombinant virulence proteins with good protective effect.

Disclosure of Invention

In order to solve the above problems, the present invention provides a novel in vivo-inducing antigen of actinobacillus pleuropneumoniae and uses thereof.

The amino acid sequence of the in vivo induction antigen of the actinobacillus pleuropneumoniae is shown as SEQ ID NO: 1 to 6, respectively.

The invention expresses the gene segment of the antigen, and the nucleotide sequence of the gene segment is shown as SEQ ID NO: 7 to 12.

The invention relates to a recombinant vector, which comprises the gene segment; the recombinant vector is preferably a pET-28a vector.

The invention relates to a recombinant bacterium, which comprises the carrier; the recombinant bacterium is selected from recombinant escherichia coli.

The invention discloses a method for preparing the antigen, which comprises the following steps: and (3) taking the recombinant bacteria, performing induced expression, and purifying.

The invention also provides application of the antigen in preparing a vaccine for preventing porcine infectious pleuropneumonia.

The invention relates to a vaccine which is prepared from the antigen and pharmaceutically acceptable auxiliary materials or carriers.

Wherein, the auxiliary material or the carrier is an immunologic adjuvant and/or a preservative. Wherein the adjuvant is Freund's adjuvant, preferably Freund's complete adjuvant.

The invention also provides application of the vaccine in preparation of a medicament for preventing porcine infectious pleuropneumonia. Wherein, the preventive medicine is an injection preparation.

The 6 in-vivo induced antigens can effectively promote lymphocyte proliferation and stimulate an organism to generate actinobacillus pleuropneumoniae specific antibodies and cytokines such as gamma-interferon, IL-4 and the like, and have the advantages of strong protectiveness, strong stability, good safety and excellent clinical application prospect.

The present invention will be described in further detail with reference to the following examples. It should not be understood that the scope of the above-described subject matter of the present invention is limited to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 prediction of in vivo induction of epitopes using bioinformatics methods.

FIG. 2 SDS-PAGE analysis of non-induced (A) and induced (B) recombinant strains.

FIG. 3 SDS-PAGE and Western blotting of the purified proteins.

SDS-PAGE of 6 purified recombinant proteins. Western blot analysis of B.6 recombinant proteins. Lane M: protein marker. Lane 1-6: RnhB, GalU, GalT, APL _1061, APL _1166, HflX.

FIG. 4 IgG level detection.

Serum was collected two weeks after non-immunization and non-immunization of the immunized group and the control group, and IgG levels were analyzed. IgG levels were detected by indirect ELISA coated with the corresponding recombinant protein. Antibody levels are expressed as absorbance values at 450 nm.

FIG. 5 lymphocyte proliferation assay.

Two weeks after the immunization and control group of second immunization, splenocytes were isolated and cultured with the corresponding recombinant protein and conA stimulation. The proliferation level of lymphocytes was measured by MTT method, and the measurement result was expressed as 595nm absorbance.

FIG. 6 lymphocyte subpopulation analysis.

The levels of subpopulations of mouse splenocytes, CD3+, CD3+ CD4+ and CD3+ CD8+ T-cells were analyzed by flow cytometry.

FIG. 7 shows the measurement of the secretion levels of IFN-. gamma.A, IL-2(B) and IL-4(C) from splenocytes by sandwich ELISA.

FIG. 8 pathological analysis of lung tissue.

The lungs of mice in each experimental group were collected, fixed and histopathological analysis was performed. A: normal control, B: negative control, C-H: RnhB, GalU, GalT, APL _1061, APL _1166and HflX immunization groups, respectively. H & E staining, 400 × magnification. (A) And (4) normal control. (B) Negative control mice showed lung tissue with infiltration of vascular and peribronchial inflammatory cells. (C) rRnhB showed slight inflammatory cell infiltration. (D) The lung tissue of the mice surviving the immunization group had significantly reduced inflammatory cell infiltration.

Figure 9 immunohistochemical analysis a: immunohistochemical analysis of macrophages. B: immunohistochemical analysis of neutrophils. a: normal control, b: negative control, c-h: immunization RnhB, GalU, GalT, APL _1061, APL _1166and hflx groups, i: statistical analysis of inflammatory cells.

FIG. 10 shows the protective rate of APP L20 strain after challenge.

FIG. 11 is a plasmid map of pET-28 a.

Detailed Description

Example 1 preparation of the Induction antigen of the present invention and verification of the Effect thereof

1. Test materials and methods

1.1 strains, plasmids and culture conditions

Coli DH5a, BL21(DE3) were purchased from Peking Tiangen, and APPL20 and other serotype reference strains were maintained in this experiment. Coli were cultured in LB (Luria-Bert) liquid or solid medium, and kanamycin (Amp) was added to a final concentration of 100. mu.g/ml as required, and all the bacteria were cultured at 37 ℃ under static (solid) or shaking (liquid).

TABLE 1 IVI Gene screening results

The pET-28a plasmid map is shown in FIG. 11.

1.2 tool enzymes and reagents

Various restriction enzymes (BamH I, HandIII, Not I, etc.), Primerstar polymerase, T4DNA ligase, etc., and DNA Marker were purchased from Takara Bio Inc. DNA recovery kits were purchased from Tiangen. Tryptic Soy Agar (TSA), Tryptic Soy Broth (TSB) powder was purchased from Difco Spanish. HRP-labeled goat anti-mouse IgG secondary antibody was purchased from southern biotech. Mycoplasma-free newborn bovine serum was purchased from Hangzhou Sijiqing Co., Ltd and inactivated at 56 ℃ for 30min before use. IPTG Isopropanol-. beta. -D-thiogalactoside solution (RT108-01), Ampicillin (Ampicillin, Amp), kanamycin (kanamycin, Kan), protein loading Buffer were purchased from Tiangen corporation. NAD, lysozyme, proteinase K were all purchased from Invitrogen, USA. SDS-PAGE gel preparation kit and western blot chromogenic substrates are purchased from Biyuntian biotechnology company.

1.3 preparation of culture Medium and antibiotics

TSB (tryptic Soy Broth) liquid Medium: 6g of TSB powder was dissolved in 180mL of water and autoclaved at 121 ℃ for 20 min. NAD with a final solubility of 10 mug/mL and 10% calf serum are added at the time of use.

TSA (tryptic Soy agar) solid medium: 8g of TSA powder is dissolved in 180mL of water, sterilized by high-pressure steam at 121 ℃ for 30min, when the temperature is reduced to about 50 ℃, NAD with the final solubility of 10 mug/mL and 10% calf serum are added, a flat plate is paved, and after the culture medium is solidified, the flat plate is stored at 4 ℃ for standby.

LB liquid medium: tryptone 10g, Yeast extract 5g, NaCl1og, dissolved in ddH₂And in O, after completely dissolving, adjusting the pH value to 7.0-7.2 by using 5mol/L NaOH, fixing the volume to 1000mL, sterilizing for 20min by using high-pressure steam at 121 ℃, and storing at room temperature.

LB solid medium: adding 1.5% agar powder into LB liquid culture medium, sterilizing with high pressure steam at 121 deg.C for 20min, cooling to about 50 deg.C, adding corresponding antibiotic, spreading flat plate, solidifying, and storing at 4 deg.C.

Ampicillin (Amp): by sterilizing ddH₂O is prepared to have a storage concentration of 50mg/mL and is reserved at-20 ℃.

Kanamycin (Kan): by sterilizing ddH₂O is prepared to a storage concentration of 25mg/mL and is reserved at-20 ℃.

1.4 Primary buffer

1.4.1 ELISA buffer

Coating liquid: 1.59gNaCO₃，2.93gNaHCO₃Add ddH₂O to 1,000 mL.

Washing liquid: 8.0g NaCl, 0.2g KCI, 2.9g Na₂HPO4·12H₂O，0.2g KH₂PO4, 0.5mL Tween-20, plus ddH₂O to 1,000 mL.

Sealing liquid: 5g of skimmed milk, and the volume of the washing solution is 100 mL.

1.4.2 protein purification buffer (Ni-NTA)

5 × Native Purification Buffer: 7g of sodium dihydrogen phosphate, 29.2g of sodium chloride and ddH2O are added to dissolve the mixture to a constant volume of 200mL, and the pH value is adjusted to 8.0. 3M imidazole: imidazole (20.6 g), Stock solution (8.77 mL), Stock solution B (10X) 1.23mL, sodium chloride (0.5M), ddH2O was added to dissolve to 100mL, and the pH was adjusted to 6.0. Native binding Buffer: 1 × Native Purification Buffer 30mL, 3M imidazole 100 uL. The pH was adjusted to 8.0. Native Washing Buffer: 1 × Native Purification Buffer50mL, 3M imidazole 335uL, adjusted to pH 8.0. Native Elution Buffer: 1 × Native Purification buffer 3.75mL, 3M imidazole 1.25mL, adjusted pH to 8.0.

1.4.3 SDS-PAGE Polyacrylamide gel electrophoresis related solution

5 × Tris-Glycine electrophoresis buffer Tris base 7.55g, glycine (electrophoresis grade, pH8.3)47g, 25mL 10% SDS (electrophoresis grade), ddH₂Dissolving O and fixing the volume to 500 mL.

1.4.4 Western-blot related solutions

Electrotransfer buffer solution: 39mmol/L glycine, 48mmol/L of LTris base, 0.037% SDS (electrophoresis grade), 20%. Methanol. 1000mL of transfer buffer was prepared by weighing 2.9g glycine, 5.8g Tris base, 0.37g SDS, 200mL methanol, and water to a total volume of 1000 mL.

TBS (pH8.0): 10mmol/LTris-HCl, 150 mmol/LNaCl. TBST: TBS containing 0.05% Tween-20.

1.5 construction of recombinant expression plasmids

Gene design primers for amplifying induced antigens in 6 individuals are respectively designed according to the whole genome information of actinobacillus pleuropneumoniae serotype 5L 20 strains published on Genbank, the detailed primer information is shown in Table 2, specific enzyme cutting sites (underlined marks) are designed at the 3 'end and the 5' end according to the optimization of an enzyme cutting reaction buffer solution and whether a gene fragment contains the specific enzyme cutting sites, and the primers are synthesized by Shanghai Producer company shown in Table 2.

TABLE 2 primers for APP IVI Gene amplification and cloning

The corresponding gene was amplified using the genome of APPL20 strain as a template. The amplification conditions were: circulating after 10min at 94 ℃; 30 cycles of 95 ℃ for 30s, 57 ℃ for 45s and 72 ℃ for 2 min; 10min at 72 ℃. And recovering and purifying the amplified gene fragment, connecting the gene fragment into a pET-28a vector, and performing sequencing analysis.

Chemical transformation of plasmids: reference is made to the instructions for the use of DH5 alpha and BL21 competent cells (Tiangen Co., Ltd.) as follows:

(1) 100 μ L of competent cells were placed in an ice bath, 10 μ L of ligation product was added to the competent cells, gently swirled and mixed, and ice-cooled for 30 min. (2) The tube was placed at 42 ℃ for 90s, and then the tube was transferred to an ice bath and allowed to stand for 3 min. (3) The tubes were mixed with 900. mu.L of sterile LB medium and placed on a shaker at 37 ℃ for 45min (150 rpm). (4) The contents of the centrifuge tube were mixed well, 100. mu.L of the transformed kanamycin-resistant LB medium was aspirated, spread well, left at room temperature until complete absorption, and cultured for 12-16h at 37 ℃ in an inverted manner.

Enzyme digestion identification: the plasmid pET-28a and the PCR amplification product are cut by corresponding restriction enzymes, the target fragment and the vector are recovered by a nucleic acid purification kit, ligation reaction is carried out by T4DNA ligase (water bath at 16 ℃ overnight), then DH5 alpha is transformed, then the plasmid is extracted in small quantity, and the corresponding enzymes are used for enzyme cutting identification, and the constructed positive recombinant plasmids are respectively named as pET-0022, pET-0129, pET-0618, pET-0651, pET-0994, pET-1060, pET-1061, pET-1166, pET-1233, pET-1709 and pET-1962.

Wherein, the target gene segment of rRnhB is as follows: (SEQ ID NO.7)595bp

The target gene segments for rGalU are: (SEQ ID NO.8)888bp

The target gene segments for rGalT are: (SEQ ID NO.9)1050bp

The target gene fragment of rApl _1061 is: (SEQ ID NO.10)597bp

The target gene fragment of rApl _1166 is: 756bp (SEQ ID NO.11)

The target gene fragment of rhhflx is: 1224bp (SEQ ID NO.12)

1.6 expression and purification of fusion proteins

The escherichia coli prokaryotic expression operation method refers to a molecular cloning experimental manual, and histidine fusion expression protein purification refers to a product specification of Bio-rad company, and specifically comprises the following steps:

using expression vector pET-28a as control, synchronously transforming expression host bacterium DE3 competent cell with recombinant plasmid, picking colony, inoculating in 2mL LB culture medium (containing kanamycin 50 ug/mL), shaking and culturing at 37 deg.C to OD₆₀₀0.6-1.0 (about 12-16h), 10mL of LB medium (kanamycin-resistant) was inoculated with 0.1mL of the bacterial suspension, and OD6 was cultured at 37 ℃ under shaking at 200rpm₆₀₀When the concentration is 0.6-1.0 (about 12-16h), IPTG is added to the final concentration of 1mmol/L, shaking culture is carried out at 37 ℃ and 220rpm for 3-4h, and the cells are collected by centrifugation at 4 ℃ and 5000rpm for 5 min.

Resuspending the thallus with PBS (1/10 volume) medium, respectively taking appropriate amount of induced expression thallus and its control thallus, adding equal amount of 2 xSDS sample adding buffer solution, boiling at 100 deg.C for 5min, ice-bathing for 5min, repeating for 3 times, centrifuging at 4 deg.C and 5000rpm for 5min, respectively taking 20 μ L of supernatant, adding sample, performing polyacrylamide gel electrophoresis, and observing and analyzing.

1mL of the suspension was taken into an EP tube. Centrifuging the bacteria collected in an EP tube at 5000r/min for 5min, discarding the supernatant, adding 100 μ L sterile deionized water, blowing off, mixing, adding 100 μ L2 xSDS gel sample adding buffer solution, mixing, boiling water bath for 5min, and detecting the expression of the recombinant protein by 12% SDS-PAGE electrophoresis.

Picking a single colony of an escherichia coli expression strain BL21 by using a sterile gun head, inoculating the single colony in 5mL of LB culture medium containing a proper antibiotic, carrying out shaking culture at 37 ℃ and 180r/min for about 12-14h, taking 4mL of culture, inoculating the culture in 400mL of fresh LB liquid culture medium when OD600 reaches 0.6-1.0, carrying out shaking culture at 37 ℃ for about 3-4h, adding IPTG until the final concentration is 1mmol/L when OD600 reaches about 0.6, and continuing to culture for 3-4 h. 12000r/min of bacterial liquid is centrifuged for 10min, 40mL of 1 × binding buffer precooled at 4 ℃ is used for suspending the thalli, after ultrasonic crushing, 12000r/min is centrifuged for 10min, the supernatant is added into a nickel ion affinity chromatographic column which is pre-assembled in advance, standing is carried out for 30-60min, then the column is passed, after the liquid is drained, binding buffer with 2 times of column volume is added for washing for 3 times, then, Elution buffer with 1 time of column volume is added for acting at room temperature for 30min, so that the recombinant protein is eluted from the chromatographic column, and the eluted recombinant protein is taken for electrophoresis detection. And (4) subpackaging and storing the purified protein, and storing at-80 ℃ for later use.

The SDS-PAGE operation method refers to the specification of the Biyuntian kit, and specifically comprises the following steps:

fixing the glass plate filled with polyacrylamide gel, quickly filling about 5mL of prepared 12% SDS-acrylamide separation gel into the gap between the two glass plates, leaving the space required by filling lamination gel, and adding 1 layer of isopropanol on the separation gel. After the separation gel was polymerized, the isopropanol liquid in the covering layer was decanted, the top of the gel was washed with deionized water 2 times, and the freshly prepared 5% lamination gel was poured onto the separation gel and immediately inserted into a comb. And pulling out the comb after the gel is completely polymerized, and fixing the comb in the electrophoresis device. Adding electrophoresis buffer solution, adding 20 mu L of sample into each hole, connecting the electrophoresis device with a power supply, adjusting the voltage to 80V, adjusting the voltage to 120V when the bromophenol blue flows to the separation gel, turning off the power supply when the bromophenol blue reaches the bottom of the separation gel, and taking out the polyacrylamide gel. Placing the polyacrylamide gel in Coomassie brilliant blue staining solution for dyeing for more than 6h, taking out the gel, placing the gel in the decolorizing solution for decolorizing for several times, each time for 60-120min, until the background color becomes weak and the target protein band becomes clear.

Protein concentration was determined using BCA protein concentration assay kit (enhanced) (Beyotime, China).

1.7 immunoblot analysis of fusion proteins

Electric conversion: when the SDS-PAGE electrophoresis is to be completed, the graphite plates are rinsed with distilled water and wiped dry with an unabsorbed paper towel. Put on gloves, cut 6 filter papers and 1 nitrocellulose filter. The filter paper and the membrane are of a size that is substantially equal to or slightly smaller than the gel. A small amount of an electrotransfer buffer was added to the tray, and 6 sheets of filter paper were soaked therein. Wearing gloves installation transfer device, keeping flat bottom electrode (will be the anode), graphite one side up places 3 soaked filter paper on this electrode, and the accurate alignment drives out the bubble, puts the cellulose nitrate filter membrane on filter paper, guarantees to align, does not have the bubble. And taking the gel from the electrophoresis tank, transferring the gel into deionized water for rinsing slightly, then accurately placing the gel on a nitrocellulose filter membrane, aligning the left lower corner of the gel with the filter membrane mark, and wearing gloves to remove bubbles. The last 3 sheets of filter paper were placed over the gel, again to ensure precise alignment without air bubbles. The upper electrode (cathode) was placed on the sandwich with graphite side down, the power was connected, the voltage was adjusted to 25v, and electrical transfer printing was performed for 20 min.

And (3) sealing: placing the cellulose nitrate filter membrane into a plastic bag capable of being sealed by heating, adding a proper amount of confining liquid (TBST containing 1% BSA), sealing the bag mouth after removing air bubbles as much as possible, horizontally placing on a shaking bed, incubating at room temperature for 1h, and discarding the confining liquid.

Binding of the first antibody to the target protein: placing the nitrocellulose filter membrane into a new plastic bag, adding 0.1-15mL/cm2 primary antibody diluted 1: 100 with TBST, sealing the bag after removing air bubbles, and incubating for 1h at room temperature on a shaker. Cutting a plastic bag opening, and washing the cellulose nitrate filter membrane for 3 times by TBST, 5-10 min each time.

Incubation of the antibody with nitrocellulose filter: placing the nitrocellulose filter membrane into a new plastic bag, adding a proper amount of horseradish peroxidase-labeled antibody diluted by TBST at a ratio of 1: 2500, sealing the bag opening after removing bubbles, and horizontally placing on a shaker for incubation at room temperature for 1 h. The plastic bag mouth is cut open, and the nitrocellulose filter membrane is washed with TBST for 5 times, 10min each time.

Adding a substrate for color development: and (3) placing the nitrocellulose filter membrane into 10mL substrate solution, developing for 1-15min, and stopping with deionized water immediately once a protein band appears, so that observation can be carried out.

1.8 animal immunization and counteracting toxic substances

Female BALB/c mice (18-22g) at 6-8 weeks were purchased from Duoduosho laboratory animals, Inc. Measurement of median lethal dose, see literature [10 ]]Randomly dividing the mice into 8 groups of 8 mice, wherein the concentration of the challenge bacteria liquid in each group is 3 × 10 in sequence⁷、1.5×10⁷、7.5×10⁶、3.75×10⁶、1.875×10⁶CFU, 0.1mL of bacterial suspension per mouse, and an equal volume of sterile PBS to the control group. One week of observation, the daily morbidity and mortality were recorded. Half of the lethal dose of APP L20 on mice was calculated by reference to the Reed-Muench method. In order to obtain an accurate challenge dose,LD was determined by the Reed-Muench method₅₀[10]The experimental animals were randomly divided into 7 groups of 15 animals each, the primary immunization was performed with equal volume of Freund's complete adjuvant emulsified with 50. mu.g of rRnhB, rGalU, rGalT, rAPL _1061, rAPL _1166and rHflX, respectively, and 6 groups of mice were immunized by subcutaneous injection, the immunization negative control group was emulsified with PBS and equal volume of Freund's complete adjuvant, two weeks after the primary immunization, mice were boosted once with equal volume of protein emulsified with equal volume of Freund's incomplete adjuvant, two weeks before and after the boosting, tail blood was collected, two weeks after the boosting, 5 × 10 was used⁸App L20 from CFU (10LD50) was used for peritoneal challenge in each experimental group. After challenge, the animals were observed for mortality and the immune protection rate was recorded over a week. Animals were euthanized and lungs were isolated for pathological analysis.

1.9 Indirect ELISA for detection of antibody levels

The reference (Fu et al, 2013), used an indirect ELISA method to detect immune group IgG levels, the method is briefly described below. The protein was diluted to a fixed concentration (w/v; 2.5. mu.g/mL) with carbonate buffer (pH 9.6). 96 microwell plates (COSTAR, USA) were coated with protein dilutions (100. mu.L) and incubated overnight at 4 ℃. Add blocking solution and incubate for 1h at room temperature, wash 3 times with wash solution for 3min each time (BEYOTIME, China). Serum samples were diluted 1: 100 fold with primary antibody diluent (BEYOTIME, China), added to the plates and incubated overnight. The microplate was washed three times. Goat anti-mouse horseradish peroxidase-labeled IgG was diluted 1: 2000 with a secondary antibody diluent (BEYOTIME, China), added to the microplate and incubated at room temperature for 1 h. Washed 3 times, added soluble TMB substrate (100 μ L) and incubated for 30min at room temperature in the dark. The reaction was stopped by adding 2M H2SO4 and the absorbance at 450nm was read (BIO-RAD, USA).

1.10 lymphocyte proliferation assay

Lymphocyte proliferation experimental reference (Fu et al, 2013), with minor modifications. First, the spleen was gently treated with a sterile stainless steel sieve and a rubber stopper of a sterile syringe, and the spleen cells were obtained by aseptic separation. Splenocytes were resuspended in incomplete RPMI medium (THERMO, USA). First, an erythrocyte lysis buffer (SOLARBO, China) was used according to the instructions) The cell suspension is processed. Cells were first washed 3 times with Hank's Balanced Salt Solution (HBSS) (THERMO, USA) and resuspended in RPMI complete medium (THERMO, USA). Isolated splenocytes were counted and 100 μ L of cells were added to 96 well plates (COSTAR, USA). Recombinant protein (5. mu.g/well) and concanavalin A (ConA) (SIGMA-ALDRICH, USA) were added to the plates separately, at 37 ℃, 5% CO₂And culturing for 72 h. Lymphocyte proliferation experiments were performed according to the MTT CellProlification Assay Kit (BEYOTIME, China) protocol. MTT solution was added to the plate and incubation was continued for 4 h. Then 100. mu.L of Formanzan solution was added to the plate and then incubated until the Formanzan was completely dissolved. Finally, the absorbance of the 595nm wavelength plates was read (BIO-RAD, USA).

1.11 cytokine assay

Cytokines (IFN-. gamma., IL-2and IL-4) were detected in lymphocyte culture supernatants by ELISA (NEOBIOSCIENCE, China) to compare the levels of Th1 and Th2 cells before and after the booster immunization.

1.12 flow cytometry analysis

Two weeks after boosting, splenocytes were isolated and analyzed by flow cytometry for subpopulations of bacterial T cells, briefly described below, splenocytes were collected, counted and adjusted to a cell concentration of 1 × 10⁶one/mL. mu.L of the cell suspension was transferred to another centrifuge tube and incubated with rat anti-mouse CD3-FITC SPRD (Southern Biotech, USA), rat anti-mouse CD4-PE (Southern Biotech), and rat anti-mouse CD8a-PerCP (Southern Biotech) at 4 ℃ for 15min protected from light. Stained cells were washed with PBS and resuspended in 450 μ L PBS. Resuspended cells were analyzed for T cell subsets by BD FACS Calibur flowcytometer (BD, USA) analysis and the results recorded.

1.13 histopathology

Lungs from different groups of animals were isolated and fixed with 10% neutral formalin. The fixed tissue was HE stained and paraffin sectioned to a thickness of 5 μm. Pathological changes were observed and recorded under an Olympus DP71 microscope.

1.14 immunohistochemical analysis

Immunohistochemistry methods analyze neutrophil and macrophage infiltration in different tissues. Paraffin sections of different tissues were prepared and incubated with monoclonal antibodies. Rabbit anti-mouse CD68 and Rabbit anti-mouse MPO are monoclonal antibodies to macrophages and neutrophils, respectively (Guge Biotech, Wuhan, China). Referring to previous studies, the slices were subjected to advanced treatment (Oh et al, 2013). IHC sections were visualized at 200 x magnification and stored photographically. IHC pictures were analyzed using Image-ProPlus 6.0 software with optical density values (IOD) as positive indices of the pictures.

1.15 statistical analysis

The relevant data was analyzed using SPSS19.0 software Student's t-test. Statistical differences were noted as P values < 0.05, indicated by "", and P values < 0.001, indicated by "".

2 results

2.1 expression of recombinant proteins

FIG. 1 shows the results of prediction of in vivo induced epitopes using bioinformatics.

Sequencing analysis shows that the recombinant expression vector is successfully constructed. This study successfully transformed the recombinant plasmid into e.colibl21 and successfully expressed His-tag fusion protein. SDS-PAGE analysis showed that the molecular weight of the recombinant protein expressed from BL21 was consistent with the predicted size (FIG. 2). The albumin was purified by nickel column affinity chromatography and the purification was analyzed by SDS-PAGE (FIG. 3A). Comparing SDS-PAGE of each IVI antigen protein, there were exposed bands at the corresponding positions in the western blotting (FIG. 3B), indicating that these proteins were all reactive with the corresponding antisera.

Wherein, the amino acid sequences of the recombinant proteins rRnhB, rGalU, rGalT, rApl _1061, rApl _1166and rHflX are as follows:

actinobacillus pleuropneumoniae RnhB protein (SEQ ID NO.1)

295aa of Actinobacillus pleuropneumoniae GalU protein (SEQ ID NO.2)

Actinobacillus pleuropneumoniae GalT protein (SEQ ID NO.3)349aa

Actinobacillus pleuropneumoniae Apl _1061 protein (SEQ ID NO.4)198aa

Actinobacillus pleuropneumoniae Apl _1166 protein (SEQ ID NO.5)251aa

Actinobacillus pleuropneumoniae HflX protein (SEQ ID NO.6)407aa

2.2 humoral immune response

Two weeks after the second immunization, serum was collected and the serum IgG levels were detected by indirect ELISA. As can be seen from the indirect ELISA results (fig. 4), IgG levels after the second immunization were significantly increased compared to those before the immunization in each immunization group. Compared with a negative control group, the IgG level of the IVI antigen protein group is obviously improved (P is less than 0.001).

2.3 cellular immune response

After the recombinant protein stimulation, the lymphocyte proliferation level of the immune groups except for rRnhB is higher than that of the negative control group (FIG. 5). Similarly, ConA stimulation also stimulated lymphocyte proliferation in these immune groups.

The ratio of CD3+, CD4+ and CD8+ T cells in splenocytes was analyzed using flow cytometry. The proportion of CD3+ and CD4+ T cells in the immunized group was overall higher than in the control group (fig. 6). In the rGalT group, CD3+, CD4+ and CD8+ showed the highest levels and were significantly higher than the control group (P < 0.05).

In addition, the levels of IFN-. gamma., IL-2and IL-4 in the supernatants of the immune cells were significantly higher than those in the control group (P < 0.05) (FIG. 7). After stimulation with the recombinant protein, IL-4 was secreted at a higher level than IFN-. gamma.and IL-2 (FIG. 7). Except the APL _1166 group, the secretion level of IFN-gamma of other immune groups is obviously higher than that of the control group (p < 0.05). Except for the rHflX group, the secretion levels of IL-2and IL-4 in the immunized group were significantly higher than those in the control group (p < 0.05).

2.4 mouse protection Rate experiments

Challenge protection experiments yielded that rGalT, rAPL _1166and rHlfX provided 87.5%, 62.5% and 62.5% protection, respectively (fig. 10). 10LD₅₀After challenge with L20, all negative control animals died. The rRnhB, rGalU and rAPL _1061 immunization groups all provided 25% protection rate (fig. 10).

2.5 histopathological analysis

Histopathological examination revealed neutrophil and macrophage infiltration in lung tissue (fig. 8). The lungs of the control mice showed severe damage, while the alveolar structure showed pathological changes (fig. 8B). While the lung parenchyma showed edema (fig. 8B). Whereas the surviving mice of the immunized group showed no apparent pathological lesions (fig. 8). Tissues from immunized mice showed only mild neutrophil and macrophage infiltration (fig. 8C-H).

2.6 immunohistochemical analysis

Immunohistochemistry results showed that the optical density values (IOD) of the negative control neutrophils were significantly higher than the normal control (p < 0.05) (fig. 9B). The IOD of neutrophils in the other immunization groups was not significantly different from the normal control except GalU. However, the IOD values of the negative control and immune group macrophages were not significantly different from the normal group (fig. 9A).

The present study performed mouse immune protection assays for 6 individuals induced antigens RnhB, GalU, GalT, Ap1_1061, Apl _1166and HflX. The results showed that the immune group had significantly higher levels of IgG than the negative control group (P < 0.001). In the lymphocyte proliferation experiment, lymphocyte proliferation was observed in the immunization groups except the rRnhB group, and particularly, relatively high level of lymphocyte proliferation (P < 0.05) was observed in the rGalU and rGalT groups. In the rGalT immune group, the proportion of CD4+ T cells was significantly higher than that of the negative control group. In addition, the proportion of CD4+ T cells was increased to various degrees in other immunization groups. At the same time, increased levels of Th1 (IFN-. gamma., IL-2) and Th2(IL-4) cytokines were detected. The challenge protection test shows that rGalT, rAPL _1166and rHflX can provide high immune protection rates of 87.5%, 62.5% and 62.5%, and the immune protection rates of the other three proteins are 25%. The histopathological test results show that the lung tissues of the survived animals in the immune group show slight pathological changes. These results demonstrate that IVI antigens as vaccine candidates for APP can improve partial immune protection.

The 6 in vivo induced antigens of the invention are taken and added with common auxiliary materials on the vaccine, such as Freund's complete adjuvant, to prepare the vaccine, wherein, the preparation can be an injection preparation. Among them, rGalT, rAPL _1166and rHflX have high protection rates, and rGalT has the highest protection rate, thereby achieving unexpected effects.

The 6 in-vivo induced antigens can effectively promote lymphocyte proliferation and stimulate an organism to generate actinobacillus pleuropneumoniae specific antibodies and cytokines such as gamma-interferon, IL-4 and the like, and have the advantages of strong protectiveness, strong stability, good safety and excellent clinical application prospect.

SEQUENCE LISTING

<110> Sichuan university of agriculture

<120> in vivo induction antigen of actinobacillus pleuropneumoniae and application thereof

<130>GY151-17P1091

<150>201610825560.X

<151>2016-09-14

<160>24

<170>PatentIn version 3.5

<210>1

<211>197

<212>PRT

<213> Actinobacillus pleuropneumoniae RnhB protein

<400>1

Met Ser Thr Asn Phe Ile Tyr Pro Asn Ala His Leu Ile Ala Gly Val

1 5 10 15

Asp Glu Val Gly Arg Gly Pro Leu Val Gly Ala Val Val Thr Ala Ala

20 25 30

Val Ile Leu Ala Pro Asn Asn Pro Ile Glu Gly Leu Ala Asp Ser Lys

35 40 45

Lys Leu Ser Glu Lys Lys Arg Leu Leu Leu Ala Glu Glu Ile Lys Ala

50 55 60

Lys Ala Leu Cys Trp Ser Leu Gly Arg Ala Glu Pro Glu Glu Ile Asp

65 70 75 80

Arg Leu Asn Ile Leu His Ala Thr Met Leu Ala Met Gln Arg Ala Val

85 90 95

Ala Gly Leu Asn Ile Gln Pro Asp Phe Val Leu Val Asp Gly Asn Arg

100 105 110

Ile Pro Thr Leu Pro Met Pro Ala Gln Ala Val Ile Lys Gly Asp Ser

115 120 125

Leu Val Ala Glu Ile Ser Ala Ala Ser Ile Leu Ala Lys Val Ala Arg

130 135 140

Asp Gln Glu Met Ala Glu Leu Asp Val Gln Tyr Pro Glu Tyr Gly Phe

145 150 155 160

Ala Lys His Lys Gly Tyr Pro Thr Lys Leu His Phe Glu Lys Leu Glu

165 170 175

Gln Phe Gly Ala Thr Pro Phe His Arg Lys Ser Phe Ala Pro Val Lys

180 185 190

Lys Ile Leu Gly Leu

195

<210>2

<211>295

<212>PRT

<213> Actinobacillus pleuropneumoniae GalU protein

<400>2

Met Lys Val Ile Ile Pro Val Ala Gly Leu Gly Thr Arg Met Leu Pro

1 5 10 15

Ala Thr Lys Ala Ile Pro Lys Glu Met Leu Thr Ile Ala Asp Lys Pro

20 25 30

Leu Ile Gln Tyr Ile Val Asn Glu Cys Val Ala Ala Gly Ile Lys Glu

35 40 45

Ile Val Leu Val Thr His Ser Ser Lys Asn Ala Ile Glu Asn His Phe

50 55 60

Asp Thr Ser Phe Glu Leu Glu Thr Met Leu Glu Lys Arg Val Lys Arg

65 70 75 80

Gln Leu Leu Glu Glu Val His Ser Ile Val Pro Lys Asp Val Thr Leu

85 90 95

Met His Val Arg Gln Gly Gln Ala Lys Gly Leu Gly His Ala Val Leu

100 105 110

Cys Gly Arg Ala Val Val Gly Asn Glu Pro Phe Ala Val Val Leu Pro

115 120 125

Asp Val Ile Leu Ala Asp Phe Thr Ala Asn Gln Lys Thr Glu Asn Leu

130 135 140

Ala Ala Met Ile Lys Arg Phe Asn Glu Thr Gln His Ser Gln Ile Met

145 150 155160

Val Ala Pro Val Pro Arg Glu Asp Val Ser Ser Tyr Gly Val Ala Asp

165 170 175

Cys Ala Gly Val Glu Ile Pro Ala Gly Glu Thr Ala Lys Ile Val Lys

180 185 190

Met Val Glu Lys Pro Ser Val Glu Glu Ala Pro Ser Asn Leu Ala Val

195 200 205

Val Gly Arg Tyr Val Phe Ser Ala Gly Ile Trp Asp Leu Leu Glu Lys

210 215 220

Thr Pro Val Gly Val Gly Asp Glu Ile Gln Leu Thr Asp Ala Ile Asp

225 230 235 240

Met Leu Ile Glu Gln Glu Thr Val Glu Ala Phe His Met Thr Gly Arg

245 250 255

Thr Phe Asp Cys Gly Asp Lys Leu Gly Tyr Met Gln Ala Phe Thr Glu

260 265 270

Tyr Ser Leu Arg His Asp Lys Phe Gly Asn Asp Phe Lys Glu Phe Ile

275 280 285

Lys Lys Leu Ala Lys Thr Leu

290 295

<210>3

<211>349

<212>PRT

<213> Actinobacillus pleuropneumoniae GalT protein

<400>3

Met Ser Gln Gln Phe Ile Leu Asn Asp His Pro His Arg Arg Phe Asn

1 5 10 15

Pro Leu Lys Asn Gln Trp Ile Leu Val Ser Pro His Arg Ala Lys Arg

20 25 30

Pro Trp Gln Gly Gln Gln Glu Glu Thr Val Ala Asp Asn Lys Pro Ser

35 40 45

Tyr Asp Pro Thr Cys Tyr Leu Cys Pro Gly Asn Lys Arg Ile Thr Gly

50 55 60

Glu Gln Asn Pro Val Tyr Ser Lys Pro Phe Val Phe Lys Asn Asp Phe

65 70 75 80

Ser Ala Leu Leu Pro Asp Thr Pro Ala Pro Glu Ala Gly Ser Asp Pro

85 90 95

Leu Phe Gln Ile Ser His Thr Gln Gly Glu Ser Arg Val Ile Cys Phe

100 105 110

Ser Pro Asp His Ser Lys Thr Leu Pro Gln Leu Ser Val Ala Glu Ile

115 120 125

Glu Gln Val Val Gln Val Trp Gln Glu Gln Ala Asn Glu Leu Lys Thr

130 135 140

Arg Tyr Gln Trp Val Gln Ile Phe Glu Asn Lys Gly Ser Met Met Gly

145 150155 160

Cys Ser Asn Pro His Pro His Gly Gln Ile Trp Ala Ser Asn Phe Leu

165 170 175

Pro Asn Glu Ile Ala Ile Glu Asp Glu Cys Gln Ala Asn Tyr Phe Ala

180 185 190

Gln Tyr Gly Arg Pro Leu Leu Leu Asp Tyr Ala Glu Arg Glu Leu Thr

195 200 205

Lys Lys Glu Arg Ile Val Val Glu Thr Glu Asp Trp Ile Ala Val Val

210 215 220

Pro Tyr Trp Ala Gly Trp Pro Phe Glu Thr Leu Leu Leu Pro Lys His

225 230 235 240

Lys His Phe Lys Arg Ile Thr Asp Leu Asn Glu Ala Glu Arg Ala Asp

245 250 255

Leu Ala Leu Ala Leu Lys Lys Leu Thr Thr Arg Tyr Asp Asn Leu Phe

260 265 270

Asn Ile Ser Phe Pro Tyr Ser Met Gly Phe His Phe Ala Pro Phe Asn

275 280 285

Glu Ser Asp Asn Pro His Trp Gln Leu His Ala His Phe Tyr Pro Pro

290 295 300

Leu Leu Arg Ser Ala Thr Val Arg Lys Phe Met Val Gly Tyr Glu Met

305 310315 320

Met Ala Glu Ser Gln Arg Asp Leu Thr Pro Glu Gln Ala Ala Glu Arg

325 330 335

Leu Asn Ala Val Ser Asp Ser Val His Tyr Lys Asn Gln

340 345

<210>4

<211>198

<212>PRT

<213> A. pleuropneumoniae Apl _1061 protein

<400>4

Met Lys Lys Phe Met Thr Met Thr Ser Ile Leu Ala Leu Ser Ser Met

1 5 10 15

Ala Leu Thr Ser Phe Ala Asn Ala Glu Glu Thr Thr Ala Gln Ala Gln

20 25 30

Asn Asn Val Gln Thr Glu Met Pro Ala Thr Ala Glu Lys Ala Val Pro

35 40 45

Val Ile Gly Gln Gln Ala Val Glu Phe Thr Arg Lys Ala Ala Asp Gln

50 55 60

Met Met Gln Gly Gln Gly Arg Gly Gln Asn Phe His Ser Phe His His

65 70 75 80

Asn Gly Lys His Pro Tyr Asp Met Met Arg Met Met Ala Tyr His His

85 90 95

Pro His Gln Phe Gly Gly Tyr Lys Pro Gln Gly Phe Ile Asp Gln Asn

100 105 110

Ala Val Ala Lys Asp Ala Lys Ala Ala Leu Glu Ala Lys Asp Arg Ser

115 120 125

Phe Val Gln Leu Glu Gly Ser Ile Ser Lys Gln Val Asn Asp Thr Glu

130 135 140

Tyr Thr Phe Val Asp Ser Thr Gly Gln Ile Lys Ile Glu Val Pro Pro

145 150 155 160

Ser Leu Trp Arg Gly Leu Ser Val Gly Pro Gln Asp Lys Val Arg Ile

165 170 175

Asp Gly Ile Leu Asp Lys Gln Trp Glu Gln Pro Glu Ile Lys Val Lys

180 185 190

Asn Ile Thr Arg Leu Lys

195

<210>5

<211>251

<212>PRT

<213> A. pleuropneumoniae Apl _1166 protein

<400>5

Met Lys Lys Ser Ile Tyr Asp Thr Pro Ile Phe Phe Glu Arg Tyr Gln

1 5 10 15

Gln Leu Arg Glu Asn Pro Ile Ser Met Asn Glu Val Val Glu Lys Pro

20 25 30

Thr Met Phe Ser Leu Leu Pro Asp Leu Thr Asn Lys Lys Val Leu Asp

35 40 45

Leu Gly Cys Gly Thr Gly Val His Leu Ala His Tyr Leu Glu Leu Gly

50 55 60

Ala Ser Lys Val Val Gly Leu Asp Leu Ser Glu Leu Met Leu Lys Gln

65 70 75 80

Ala Glu Ser Asp Leu Ala Lys Asn Trp Gln Lys Ser Thr Ala Phe Ser

85 90 95

Leu His Cys Leu Pro Met Glu Gln Leu Asp Lys Ile Pro Glu Asp Asn

100 105 110

Phe Asp Val Val Thr Ser Ser Phe Ala Phe His Tyr Ile Glu Asp Phe

115 120 125

Ala Asp Leu Leu Ala Lys Ile Ser Ala Lys Met Thr Ala Cys Gly Thr

130 135 140

Leu Ile Phe Ser Gln Glu His Pro Ile Val Thr Cys Tyr Lys Asp Gly

145 150 155 160

Tyr Arg Trp Glu Lys Asn Glu Gln Lys Gln Gln Val Ala Tyr Arg Leu

165 170 175

Asn Phe Tyr Arg Asp Glu Gly Glu Arg Asp Arg Ser Trp Phe Gln Gln

180 185 190

Ala Phe Lys Thr Tyr His Arg Thr Met Ala Thr Ile Cys Asn Gln Leu

195 200 205

Ile Gln Ala Glu Phe Glu Ile Val Gln Val Glu Glu Pro Met Leu Ala

210 215 220

Glu Gln Pro Gln Trp His Asn Glu Phe Lys Asp Leu Gln His Arg Pro

225 230 235 240

Pro Leu Leu Phe Ile Lys Ala Val Lys Lys Asn

245 250

<210>6

<211>407

<212>PRT

<213> Actinobacillus pleuropneumoniae HflX protein

<400>6

Met Glu Phe Gln Thr Leu Ala Glu Ser Ala Gly Val Glu Ile Leu Ala

1 5 10 15

Thr Leu Thr Thr Ser Arg Ser Ala Pro His Ile Lys Tyr Phe Val Gly

20 25 30

Gln Gly Lys Ala Asp Glu Ile Ala Gln Ala Val Lys Asp Leu Glu Ala

35 40 45

Thr Val Val Leu Val Asn His Glu Leu Ser Pro Ser Gln Thr Arg Asn

50 55 60

Leu Gln Ala Leu Cys Glu Cys Arg Val Val Asp Arg Thr Gly Leu Ile

65 70 75 80

Leu Asp Ile Phe Ala Gln Arg Ala Arg Ser His Glu Gly Lys Leu Gln

85 90 95

Val Glu Leu Ala Gln Leu Lys His Leu Ala Thr Arg Leu Val Arg Arg

100 105 110

Leu Gly Asn Gln Asp Gln Gln Lys Gly Gly Ala Val Gly Leu Arg Gly

115 120 125

Pro Gly Glu Thr Gln Leu Glu Thr Asp Arg Arg Leu Ile Lys Val Arg

130 135 140

Ile Gln Gln Leu Gln Asn Arg Leu Glu Lys Val Asn Lys Gln Arg Ser

145 150 155 160

Gln Asn Arg Lys Thr Arg Gln Lys Ala Asp Ile Pro Thr Val Ser Leu

165 170 175

Val Gly Tyr Thr Asn Ala Gly Lys Ser Thr Leu Phe Asn Ala Ile Thr

180 185 190

Asn Ala Gly Val Tyr Ala Ala Asp Gln Leu Phe Ala Thr Leu Asp Pro

195 200 205

Thr Leu Arg Arg Met Gln Ile Gln Asp Val Gly Thr Thr Ile Leu Ala

210 215 220

Asp Thr Val Gly Phe Ile Arg Phe Leu Pro His Asp Leu Val Ser Ala

225 230 235 240

Phe Lys Ser Thr Leu Gln Glu Thr Thr Glu Ala Ser Leu Leu Leu His

245 250 255

Val Ile Asp Ala Ala Asp Asp Arg Lys Asn Glu Asn Ile Asp Ala Val

260 265 270

Asn Gln Val Leu Asp Glu Ile Gly Ala Leu Asp Ile Pro Thr Leu Leu

275 280 285

Val Tyr Asn Lys Val Asp Lys Leu Glu Gly Ile Val Pro His Ile Glu

290 295 300

Arg Asn Asp Asp Gly Lys Pro Val Ala Val Tyr Leu Ser Ala Gln Ala

305 310 315 320

Asn Gln Gly Ile Asp Leu Leu Tyr Glu Ala Ile Arg Glu Cys Leu Arg

325 330 335

Asn Glu Leu Val Cys Glu Lys Val Leu Leu Pro Ala Thr Ala Gly Gln

340 345 350

Ile Tyr Thr Gln Leu His Leu Gln His Cys Ile Lys Asn Glu Ser Phe

355 360 365

Asn Gln Phe Gly Asp Arg Leu Val Glu Val Glu Val Asp Leu Val Gln

370 375 380

Trp Asn Lys Trp Leu Lys Gln Phe Pro Glu Leu Thr Glu Tyr Ile Glu

385 390 395 400

Phe Ala Ser Trp Glu Glu Asn

405

<210>7

<211>595

<212>DNA

<213> target Gene fragment of rRnhB

<400>7

tttataaacc taagattttc ttcaccgggg cgaagctctt tcggtgaaaa ggggttgccc 60

cgaattgttc cagtttttca aaatgtagtt tagtcggata gcctttatgc tttgcaaagc 120

cgtattccgg atattgcaca tctaattcag ccatttcctg atctcgggca actttggcta 180

aaatggaagc tgcgctgatc tcggcaacta aactatctcc ttttatgacc gcttgtgccg 240

gcatcggtaa agttggaata cggttgccgt ccaccaacac gaaatcgggc tgaatattga 300

gtccggcaac cgcccgctgc atagcgagca ttgttgcgtg caagatattc aaccgatcga 360

tttcttccgg ttcggcacgc cctaaagacc aacaaagcgc ttttgcttta atttcctccg 420

ctaaaagcaa acgcttcttc tccgacagtt ttttagagtc ggctaatcct tcaatcggat 480

tattcggagc taaaatcacg gcagcggtga ccaccgcacc gactaacggg cctctaccga 540

cttcgtccac acctgcgatc aagtgggcat taggataaat gaaatttgta ctcat 595

<210>8

<211>888

<212>DNA

<213> rGalU target Gene fragment

<400>8

ttataacgtt ttagctaatt ttttaataaa ttctttaaag tcattgccga acttatcatg 60

acgtaaacta tattcggtaa atgcctgcat ataacctaat ttatcgccgc agtcgaaagt 120

acgacctgtc atatgaaatg cttctaccgt ttcttgctca attaacatat caatagcatc 180

ggttaattgg atctcatcgc ctacaccaac cggtgttttc tctaataaat cccaaatacc 240

tgcggagaat acgtaacgac cgacaaccgc taaattagaa ggtgcttctt ctacactcgg 300

tttttcaacc atcttcacga tttttgcagt ttcgccggca ggaatttcca cgcctgcaca 360

atccgctacg ccatagctac ttacatcttc tctcggtacc ggtgcaacca taatttggct 420

atgttgtgtt tcgttgaaac gtttgatcat cgccgcaagg ttttccgttt tttgattcgc 480

agtaaaatcg gctaaaatta catccggtaa tacgactgca aaaggttcgt taccgactac 540

cgctctaccg cataataccg catgacctaa acctttagct tgaccttgac gtacatgcat 600

taatgtaacg tcttttggca caattgagtg cacttcttct aataattggc gtttaacacg 660

tttttccaac atagtttcaa gttcaaaaga cgtatcaaaa tggttctcga tagcattttt 720

tgaagaatga gtcactaata cgatctcttt aataccagcc gctacacatt cgttcacgat 780

atattgaata agcggtttat ccgcaatcgt cagcatttct tttggaatcg cttttgttgc 840

aggaagcatt cgcgtcccta aacccgctac cggaataatt actttcat 888

<210>9

<211>1050

<212>DNA

<213> rGalT target Gene fragment

<400>9

atgagccaac aatttatcct aaacgatcac cctcatcgtc gttttaatcc gttaaaaaat 60

caatggattt tagtttctcc gcatcgtgcg aaacgtccgt ggcaaggtca gcaggaagaa 120

acggttgcgg ataataaacc gagctatgat ccgacttgtt atctctgtcc gggaaataaa 180

cgcattaccg gcgaacaaaa tcccgtttat agcaaacctt tcgtctttaa aaacgatttc 240

tccgcactac tgccggatac accggcgccg gaagccggtt ccgatccgct tttccaaatt 300

tcacatactc aaggcgaaag ccgtgtaatt tgcttctcgc ctgatcacag taaaacctta 360

ccgcaacttt cggtggctga aattgagcaa gtggtacaag tctggcaaga gcaagcgaat 420

gagttaaaaa cacgttatca gtgggtacaa atttttgaaa acaaaggctc gatgatgggc 480

tgctctaatc cgcacccgca cggtcaaatt tgggcaagca atttcttacc gaacgaaatt 540

gcgattgaag acgaatgtca ggcaaattac tttgctcaat acggtcgtcc attgcttctt 600

gattatgccg agcgtgaatt aactaaaaaa gaacgtatcg tcgtcgaaac cgaagactgg 660

attgcagtgg tgccttactg ggctggctgg ccgtttgaaa ctttactgtt gccgaaacac 720

aagcacttta aacgcattac cgatttaaac gaagcggaac gagcggattt agctctcgca 780

cttaaaaagc taaccactcg ctacgataac ttatttaata tcagtttccc atattcgatg 840

ggcttccatt tcgctccgtt taatgaaagt gataatccgc attggcaact tcacgcccat 900

ttctatccgc cgttgttacg ttcggcaacc gtgcgtaaat ttatggtcgg ctacgagatg 960

atggcggaaa gtcagcgaga tctgacaccg gaacaagcgg cggaaagatt aaatgctgtg 1020

agcgacagcg ttcactataa aaatcaatag 1050

<210>10

<211>597

<212>DNA

<213> target Gene fragment rApl _1061

<400>10

atgaaaaaat ttatgacaat gacttctatt cttgcacttt cttctatggc tttaacttcc 60

ttcgctaatg cggaagaaac gaccgcacaa gcgcaaaata acgtacaaac cgaaatgccg 120

gcaactgcgg aaaaagcggt accggttatc gggcaacaag cggttgaatt tacgcgtaaa 180

gcggcggatc aaatgatgca aggacaaggt cgcggacaga acttccattc gtttcatcac 240

aacggcaaac atccgtacga tatgatgaga atgatggcgt atcatcaccc gcatcagttc 300

ggcggctata aaccgcaagg ttttattgat caaaatgcgg tggcgaaaga tgcgaaagcg 360

gcgttagaag cgaaagatcg ttcgttcgtt caattagaag gttcgatttc aaaacaagta 420

aacgataccg aatacacttt tgtcgatagt accggtcaaa tcaaaattga agtgccgcca 480

agcttatggc gcggtttatc ggtaggtcca caggataaag ttcgtattga cggtatttta 540

gataaacaat gggaacaacc tgaaattaaa gtgaaaaaca tcacgagatt gaaatag 597

<210>11

<211>756

<212>DNA

<213> target Gene fragment rApl _1166

<400>11

ttgaaaaaaa gtatttacga taccccgatt ttctttgaac gttatcaaca attacgtgaa 60

aacccaatca gtatgaatga agtggtggaa aagcctacga tgttttcact tttaccggat 120

cttaccaata agaaagtgtt agatttgggt tgtggtaccg gggtgcattt ggcgcattat 180

ttagaattag gtgcgagtaa agttgtcggg ctggatttat cggagctaat gctaaaacag 240

gcggaaagtg atttagcaaa aaattggcaa aaatcgaccg ctttctcact gcactgcttg 300

ccaatggaac aattagataa aattccggaa gataattttg atgtggtcaccagttcattt 360

gcgtttcact atattgagga ttttgccgat ttacttgcaa aaatttctgc aaaaatgacc 420

gcttgcggca cattgatttt ttcccaagaa catccgattg tcacttgcta taaagacggc 480

tatcgttggg agaaaaatga gcaaaaacaa caagttgctt atcgtttaaa tttctatcga 540

gatgaggggg agcgagatag aagttggttc caacaagcat tcaaaaccta tcatcgcacg 600

atggcaacga tttgcaatca gctgattcaa gccgagtttg aaatcgtgca agtggaagag 660

ccgatgctgg cggaacaacc gcaatggcat aatgagttta aagatctcca acatcgcccg 720

ccacttttat ttattaaggc agttaaaaaa aattaa 756

<210>12

<211>1224

<212>DNA

<213> target Gene fragment of rHfLX

<400>12

atggaattcc aaacgcttgc cgaatcggcc ggtgttgaaa ttcttgccac attaactact 60

tctcgttccg caccgcatat caaatatttt gtcggacaag gcaaagccga tgaaatcgca 120

caagcggtta aagatttaga agctacggtt gttttagtca atcacgagct tagtccgtca 180

caaacccgta atttacaagc gttatgcgaa tgtcgagttg tggacagaac cggtctgatt 240

ttagatattt ttgcccaacg tgccagatcg cacgaaggaa aattacaagt cgagctggct 300

caacttaaac acttggcaac acgtttggta cgtcgtttgg gcaatcagga tcagcaaaag 360

ggcggggcag taggcttacg agggccgggt gaaactcagc ttgaaactga tcgccgtttg 420

attaaagtgc gcattcagca acttcaaaat cgtttggaga aagtgaataa gcagcgcagc 480

caaaatcgca aaactcgtca gaaagcggat attccgaccg tttctttggt cggttatacc 540

aatgcgggga aatcgacttt attcaatgcg attactaatg ccggtgttta tgcggcggat 600

cagttattcg caacgcttga tccgacttta cgccgaatgc agattcaaga tgtcggcact 660

acaatcttag cggatacggt cggttttatt cgttttttac cgcatgattt ggtctccgca 720

tttaaatcga ctttacaaga aaccaccgaa gcaagcttac tgttacacgt gattgatgcg 780

gcggatgatc gtaaaaatga aaatattgac gcggtcaatc aagtcttaga tgaaatcggt 840

gcgttagaca ttccaacgtt attggtctat aacaaggttg ataaacttga aggcatagtg 900

ccgcatatcg agcgtaatga cgatggtaaa ccggtggcgg tttatctctc cgcacaagct 960

aatcaaggta ttgatttgct atatgaggcg attagagaat gtttacgcaa cgagttggtg 1020

tgtgagaaag tattattacc ggcaaccgct gggcaaattt atacgcaact tcacctacag 1080

cattgtatta aaaacgaaag ctttaatcag tttggtgacc gattggttga ggtggaagtg 1140

gatttagtgc agtggaataa atggctaaaa caattccccg aattgacgga atatattgaa 1200

ttcgcaagtt gggaagagaa ctag 1224

<210>13

<211>33

<212>DNA

<213>AP1F

<400>13

cgggatccat gaaagtaatt attccggtag cgg 33

<210>14

<211>32

<212>DNA

<213>AP1R

<400>14

cccaagctta taacgtttta gctaattttt ta 32

<210>15

<211>33

<212>DNA

<213>AP2F

<400>15

cgggatccat gagccaacaa tttatcctaa acg 33

<210>16

<211>34

<212>DNA

<213>AP2R

<400>16

cccaagcttc tattgatttt tatagtgaac gctg 34

<210>17

<211>30

<212>DNA

<213>AP3F

<400>17

cgggatccat ggaattccaa acgcttgccg 30

<210>18

<211>25

<212>DNA

<213>AP3R

<400>18

acgtgtaaca gtaagcttgc ttcgg 25

<210>19

<211>33

<212>DNA

<213>AP4F

<400>19

cgggatcctt gaaaaaaagt atttacgata ccc 33

<210>20

<211>32

<212>DNA

<213>AP4R

<400>20

cccaagctta atttttttta actgccttaa ta 32

<210>21

<211>33

<212>DNA

<213>AP5F

<400>21

cgggatccat gagtacaaat ttcatttatc cta 33

<210>22

<211>32

<212>DNA

<213>AP5R

<400>22

cccaagctta taaacctaag attttcttca cc 32

<210>23

<211>33

<212>DNA

<213>AP6F

<400>23

cgggatccac gaccgcacaa gcgcaaaata acg 33

<210>24

<211>40

<212>DNA

<213>AP6R

<400>24

ataagaatgc ggccgctatt tcaatctcgt gatgtttttc 40

Claims (7)

1. The amino acid sequence is shown as SEQ ID NO: 3 in the preparation of vaccines for preventing porcine infectious pleuropneumonia.

2. A vaccine, characterized by: it comprises an amino acid sequence shown as SEQ ID NO: 3 and a pharmaceutically acceptable adjuvant or carrier.

3. The vaccine of claim 2, wherein: the auxiliary material or the carrier is an immunologic adjuvant and/or a preservative.

4. The vaccine of claim 3, wherein: the adjuvant is Freund's adjuvant.

5. The vaccine of claim 4, wherein: the adjuvant is Freund's complete adjuvant.

6. Use of the vaccine of any one of claims 2 to 5 in the manufacture of a medicament for the prevention of porcine contagious pleuropneumonia.

7. Use according to claim 6, characterized in that: the medicament for preventing the porcine contagious pleuropneumonia is an injection preparation.

Images