CN106854650B - American cockroach wingless full length genes are identified and application - Google Patents

Abstract

The present invention provides American cockroach wingless full length genes cDNA, its coding albumen and its cloning process and applications.The unnamed gene is PaWg, and GenBank database logins number are KJ680328；The cDNA full length sequences are total to Isosorbide-5-Nitrae 56bp, and open reading frame (ORF) includes 1,194 bases, encodes 397 amino acid, nucleotide sequence is as shown in SEQ ID NO.1 in sequence table.The protein amino acid sequence of gene order coding is as shown in SEQ ID NO.2 in sequence table.The theoretical iso-electric point of the albumen is 9.46, molecular weight 4.4kD, is the hydrophilic protein stablized.1st 21 amino acids sequence of the albumen is a segment signal peptide, and there are a restriction enzyme sites between site 21 and 22.The albumen may include 2 N glycosylation sites simultaneously, respectively on the asparagine in 107 and 343 sites.The present invention provides the application of the gene, albumen and its cloning process in terms of cockroach insecticide and bioprobe is prepared, and lay a good foundation for the research of American cockroach wingless gene-correlations with application.

Description

American cockroach wingless full length genes are identified and application

Technical field

The present invention relates to a kind of clone of gene and Function Identification more particularly to American cockroach wingless full length genes gram Grand and Function Identification and application, belong to biotechnology.

Background technology

American cockroach is the most common blattaria in southern area of China, can get in harm, is one of advantage sanitary insect pest. They can be found from anywhere in indoors, and such as dirty mattress, sheet show the furniture of cushion, and carpet, they are in kitchen Frequent activity^[1].At present, chemical prevention is still an important means of cockroach prevention and cure.With a large amount of uses of chemical insecticide, Cockroach produces rapidly drug resistance, and increasingly severe^[2].Simultaneously because the use of chemical insecticide, it can ecological environment generation Serious influence and destruction.Therefore, there is boundless application come anti-cockroach processed using molecular biosciences information technology Prospect^[3].At present, existing various insects gene, which is reported, plays the effect of insecticide certain regulating and controlling effect, such as recombination HaSNPV chitinases are expected to as Bt insecticide synergists^[4], the paravoltage dependent sodium channel gene of insect has resistance to insecticides Certain influencing mechanism^[5], the equal resistance to insecticide of multiple genes in Anopheles sinensis CYP6 gene families plays certain Regulating and controlling effect^[6]Deng.

Wnt genes are in nineteen eighty-two by Nusse and his team^[7]It reports for the first time, is named as int-1 genes at that time, this The improper activation of gene can induce cancer.The gene wingless gene homologous with int-1 is then found that in drosophila (wg), they are " wnt " gene by common definition^[8].The member of Wnt gene families is detected in multiple species, from nothing The nematode of vertebra is found that the gene of 19 wnt families altogether to vertebrate in people^[9], 7 wnt families are found that in drosophila The gene of race is found that the gene of 7 wnt families in bee, the gene of 6 wnt families is found that in mosquito, is sent out in red flour beetle The gene of 9 wnt families is showed^[10][11].The big secretion cysteine-rich protein family of the gene codes one of Wnt families, It plays an important role in animal development as ceS signal molecules.Many wnt albumen are by 350 to 380 amino acid groups Into there is more than 100 a conservative residue be dispersed in entire sequence.The section start of these albumen is the sequence of a hydrophobic signal, The signal peptide that can be identified to followed by one section.Each albumen has one or more N- glycosylation site and up to 24 half Cystine residue forms disulfide bond^[12].By autocrine or paracrine approach, in wnt ligand bindings to various transmembrane receptors, drive Dynamic wnt signal transduction paths, so as to trigger the intercellular regulatory transcription of target gene.

Wnt signal paths are related to embryonic development in adults growth course, cell Proliferation by wnt protein activations With differentiation etc..This process needs regulation and control " from first to last ", to determine the correct differentiation of neural crest, so as to form brain, the heart Dirty, kidney and Sex Differentiation etc.^[13].The destruction of this accurate system can lead to developmental disorder.In drosophila and red flour beetle Wnt family genes all are reported out^[14], these wnt genes in embryo development procedure also have been reported now^[15], The polar functionalities of especially typical wingless/wnt1 genes more to be reported^[13].However, we are at present to wingless Action function of the gene in American cockroach embryonic development period and rear embryonic development period is known little about it.We want to know about Wingless genes are in American cockroach from larvae development to the function during adult.Since there are multiple results of study to confirm Wingless genes are related to the processes such as embryonic development, cell Proliferation and the differentiation of insect, then these work(of wingless genes Can apply in the preparation of insecticide, the insecticide that preparing has the function of to hinder insect reproduction etc. be worth we explore with Research.Either find new gene or study known or carry out gene function research or be make it is specific Gene expression is desirably to obtain the research of the protein of gene code etc., and the full-length cDNA for obtaining target gene is precondition And primary goal.

In addition, gene probe is essential important tool in molecular biology research.Due in phyletic evolution Upper people and mammality genetic distance are nearer, and gene probe has larger versatility, so the people's gene that medical development gets up Probe brings many convenience for mammal research.And the molecular biology research one of invertebrate is to very weak, because This can be used for the gene probe source of insect difficult, and insect molecular biology research is most closed in the selection and use of gene probe Key^[16]。

Bibliography：

[1]de Blay,F.,Sanchez,J.,Hedelin,G.,Perez-Infante,A.,Verot,A., Chapman,M.and Pauli,G.1997.Dust and airborne exposure to allergens derived from cockroach(Blattella germanica)in low-cost public housing in Strasbourg (France).J Allergy Clin Immunol 99:107-112.

[2] Sun Jun, Chu Hongliang, Yang Weifang, Zhang Aijun, Liu Hui .2011. China cockroach drug resistance present situation and detection method Research China hygienic biocide medical instruments, 1:12-17.

[3] the anti-ports processed sanitary control of biological information of Wang Fushan, Xu Bailin .2002. cockroaches, 7 (1):19-21.

[4] Wang Fang, Gu Qiwei, Wu Jiacai, Zhang Chuanxi .2004.HaSNPV chitinase genes are in Escherichia coli and insect Expression and its product in cell is to the synergistic effect Chinese biologicals chemistry of Bt insecticides and molecular biosciences journal, 20 (6): 792-797.

[5] Chen Bin, fresh roc is outstanding, the mutation of Qiao Liang .2015. insects paravoltage dependent sodium channel gene and its with resistance to insecticides relationship Progress insect journals, 58 (10):1116-1125.

[6] identification of Emperor Yao .2014. Anopheles sinensises CYP6 gene families, feature and with the relevant expression analysis of drug resistance Chongqing Normal University

[7]Nusse,R.and Varmus,H.E.1982.Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome.Cell 31:99-109.

[8]Rijsewijk,F.,Schuermann,M.,Wagenaar,E.,Parren,P.,Weigel,D.and Nusse,R.1987.The Drosophila homology of the mouse mammary oncogene int-1is identical to the segment polarity gene wg.Cell 50:649-657.

[9]Garriock,R.J.,Warkman,A.S.,Meadows,S.M.,D'Agostino,S.and Krieg, P.A.2007.Census of vertebrate Wnt genes:isolation and developmental expression of Xenopus Wnt2,Wnt3,Wnt9a,Wnt9b,Wnt10a,and Wnt16.Dev Dyn 236: 1249-1258.

[10]Bolognesi,R.,Beermann,A.,Farzana,L.,Wittkopp,N.,Lutz,R., Balavoine,G.,Brown,S.J.andR.2008a.Tribolium Wnts:evidence for a larger repertoire in insects with overlapping expression patterns that suggest multiple redundant functions in embryogenesis.Dev Genes Evol 218:193- 202.

[11]Murat,S.,Hopfen,C.and McGregor,A.P.2010.The function and evolution of Wnt genes in arthropods.Arthropod Struct Dev 39:446-452.

[12]Cho,S.-J.,Valles,Y.,Giani,V.C.,Seaver,E.C.and Weisblat, D.A.2010.Evolutionary dynamics of the wnt gene family:a lophotrochozoan perspective.Mol Biol Evol 27:1645-1658.

[13]Agholme,F.and Aspenberg,P.2011.Wnt signaling and orthopedics,an overview.Acta Orthop 82:125-130.

[14]Murat,S.,Hopfen,C.and McGregor,A.P.2010.The function and evolution of Wnt genes in arthropods.Arthropod Struct Dev 39:446-452.

[15]Neumann,C.J.and Cohen,S.M.1997.Long-range action of Wg organizes the dorsal-ventral axis of the Drosophila wing.Development 124:871-880.

[16] Wang Ying, Chen Xiao peak .1996. gene probes and its application Chinese biological engineering magazines on entomology, 16 (3):28-32.

Invention content

The purpose of the present invention is to provide American cockroach wingless full length genes cDNA, its coding albumen, described America The cloning process of big Lian wingless full length genes cDNA and application；

The present invention also aims to provide a kind of in situ hybridization probe of American cockroach wingless genes.

To achieve these goals, technical scheme of the present invention is specific as follows：

The present invention provides American cockroach wingless full length gene cDNA, are named as PaWg, which has submitted GenBank databases, accession number KJ680328；The cDNA full length sequences are total to Isosorbide-5-Nitrae 56bp, open reading frame (ORF) Comprising 1,194 base, 397 amino acid are encoded, nucleotide sequence is as shown in SEQ ID NO.1 in sequence table.The gene The protein amino acid sequence of sequential coding is as shown in SEQ ID NO.2 in sequence table.The theoretical iso-electric point of the albumen is 9.46, molecular weight 4.4kD are the hydrophilic proteins stablized.The 1-21 amino acids sequences of the albumen are a segment signals Peptide, there are a restriction enzyme sites between site 21 and 22.The albumen may include 2 N- glycosylation sites simultaneously, respectively 107 On the asparagine in 343 sites.

The present invention provides the cloning process of above-mentioned American cockroach wingless full length genes cDNA, include the following steps：

1) reverse transcription is carried out to the total serum IgE extracted from American cockroach sample and prepares cDNA；

2) using the cDNA obtained in step 1) as template, degenerate primer F1 (as shown in SEQ ID NO.3) and R1 (such as SEQ Shown in ID NO.4) it is sense primer and downstream primer, carry out RT-PCR amplifications；

Preferably, PCR reaction conditions are as follows：94℃3min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 1min, 35cycles；72℃10min；4 DEG C of ∞ are preserved；

3) PCR product of amplification gained is recycled, is connected, converted and is identified and is sequenced in step 2)；

4) using the RNA obtained in step 1) as template, RACE cDNA libraries are built；The product of acquisition is 5'- RACE-Ready cDNA and 3'-RACE-Ready cDNA, the template that can be reacted respectively as 5'-RACE and 3'-RACE；

5) 3'RACE and 5'RACE primers are designed according to the gene order obtained in step 3), respectively with institute in step 4) 5'-RACE-Ready cDNA and the 3'-RACE-Ready cDNA of acquisition are template, and use UPM primers, nucleotide sequence For：5 '-AAGCAGTGGTATCAACGCAGAGT-3 ' carry out 5'-RACE or 3'-RACE nested PCR amplification American cockroaches The full length sequence of wingless genes；

The nucleotide sequence of the 3'-RACE and 5'-RACE primers is respectively：

3’RACE-F1：(as shown in SEQ ID NO.5)；

3’RACE-F2：(as shown in SEQ ID NO.6)；

5’RACE-R1：(as shown in SEQ ID NO.7)；

5’RACE-R2：(as shown in SEQ ID NO.8).

Preferably, first round PCR reaction conditions are：94 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min, 15 cycles；72℃10min；4 DEG C of preservations；Preferably, Second, which takes turns PCR reaction conditions, is：94℃3min；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 2min, 20 cycles；72℃10min；4℃ It preserves.

6) recycle, connect and step of converting 5) in amplification gained first time nest-type PRC 5 ' RACE and 3 ' RACE PCR Product；

7) the wingless gene orders obtained in step 3) are carried out with 5 ' the RACE gene orders obtained in step 6) Splicing designs the 5'RACE primers of second of nest-type PRC according to the gene order spliced, and with obtained in step 4) 5'-RACE-Ready cDNA be template, the full length sequence of second of nested PCR amplification American cockroach wingless gene；It is described The nucleotide sequence of 5'-RACE primers of second of nest-type PRC be respectively：

5’RACE-R3：(as shown in SEQ ID NO.9)；

5’RACE-R4：(as shown in SEQ ID NO.10).

The wheel PCR of first round PCR and second reaction conditions of second of nest-type PRC reaction are as above.

8) recycled in the PCR product to 5 ' RACE of second of nest-type PRC of amplification gained in step 7), connected, Conversion and identification and sequencing；

9) by the 5 ' RACE obtained in the wingless gene orders obtained in step 3), step 6) and 3 ' RACE gene sequences It arranges and is spliced with 5 ' the RACE gene orders obtained in step 8), obtain wingless full length gene sequences, compared through BLAST It is American cockroach wingless (PaWg) full length gene cDNA sequence to verify it.This sequence has been submitted into GenBank databases, Accession number is KJ680328.

We have prepared the in situ hybridization probe of American cockroach wingless genes using transcription technique outside genosome, first First using American cockroach male insect breast tissue cDNA samples as template, the DNA profiling of the promoter containing T7 is prepared；Then to contain T7 The DNA of promoter is template, uses in-vitro transcription kit (Riboprobe in vitro Transcription Systems, Promega) probe of wingless gene hybridization in situ is prepared, meanwhile, using the UTP of digoxigenin labeled to NTP It is modified；Finally label probe is applied in the RNA interference of American cockroach embryo, so as to confirm wingless genes in U.S. Function in the big Lian embryo development procedures in continent.

The present invention provides the gene, albumen and its cloning process in terms of cockroach insecticide and bioprobe is prepared Application.

Technical scheme of the present invention has reached following advantageous effect：

1) present invention obtains American cockroach wingless full length gene cDNA sequences, and the gene and its coding egg are obtained The function of white matter is laid a good foundation for the research of American cockroach wingless gene-correlations with application.

2) present invention builds the SMART RACE cDNA of American cockroach gonadal tissue and breast tissue using SMART technologies Library, the full-length cDNA to screen and cloning American cockroach reproductive development related gene and wing development related gene have established base Plinth.

3) we have prepared the in situ hybridization probe of American cockroach wingless genes using transcription technique outside genosome, By the wide popularization and application of this technology, the wingless gene probes of other various insects can be prepared, so as to apply In the wing development function for enhancing natural enemy insect, increase the flight performance of natural enemy insect, enhance it and prey on the ability of pest.

Description of the drawings

Fig. 1 is the extraction of American cockroach chest total serum IgE.M.DL 2000Marker；1. total serum IgE.

Fig. 2 is the amplification of wingless genetic fragments.M.DL 2000Marker；1-3.PCR products (parallel laboratory test).

Fig. 3 is the amplification of 3 ' RACE of wingless genes.M.DL2000Marker；1.3 ' RACE PCR products.

Fig. 4 is wingless gene 5 ' RACE amplifications.M.DL2000Marker；1.5 ' RACE first time nest-type PRCs Product；2.5 ' second of RACE nested PCR products.

Fig. 5 is the nucleotide sequence and amino acid sequence of American cockroach PaWg genes.In figure, the tailing signal side of derivation Frame represents；Asterisk indicates terminator codon；Signal peptide sequence is represented with single underscore；The N- glycosylation sites of prediction are used lower stroke double Line represents.

Fig. 6 is PaWg albumen physicochemical properties.

Fig. 7 is PaWg albumen hydrophobicity analysis results.

Fig. 8 is the transmembrane region analysis result to PaWg albumen using TMHMM tools.

Fig. 9 is PaWg protein signal peptide analysis.

Figure 10 is the N- glycosylation sites analysis of PaWg albumen.

Figure 11 is the O- glycosylation sites analysis of PaWg albumen.

Figure 12 is PaWg Secondary structure prediction results.

Figure 13 is the DNA profiling of the promoter containing T7.M.DL2000Marker, 1.Wg (T7)-F2 and Wg-R2 are upstream and downstream The PCR product that primer amplification goes out, 2.Wg-F1 and Wg (T7)-R1 is the PCR product that upstream and downstream primer amplification goes out.

Figure 14 is the dsRNA of wingless genes.M.DL2000Marker, 1.dsRNA.

Figure 15 is the expression of RT-PCR analysis wingless genes.(A) wingless genes are 4 growth and development periods MRNA level in-site：1. ovum, 2. early larvaes, 3. late larvals, 4. adults；(B) RNAi knocks out wingless genes：Congtrol. The wild type do not injected, GFP. are injected using the dsRNA of GFP, and RNAi. is noted using the dsRNA of wingless It penetrates.

Figure 16 is the change of American cockroach front and rear wing phenotype before and after RANi interference.In figure, S1. wild type American cockroach larvas The wing that development forms, the fore wing that six instar larvaes of S2. develop into after being disturbed, what six instar larvaes of S3. developed into after being disturbed Hind wing, the fore wing that seven instar larvaes of S4. develop into after being disturbed, the hind wing that seven instar larvaes of S5. develop into after being disturbed, S6. The fore wing that eight instar larvaes develop into after being disturbed, the hind wing that eight instar larvaes of S7. develop into after being disturbed, nine ages of S8. children The fore wing that worm develops into after being disturbed, the hind wing that nine instar larvaes of S9. develop into after being disturbed.

Figure 17 is wingless gene probes.M.DL2000Marker, 1. probes.

Figure 18 is the hybridization of American cockroach embryonic in situ.S10. the head of body early embryo, the first body segment of chest and the second body segment The back side, the back side of the first body segments of chest of S11. late embryos, the second body segment and third body segment, S12. body early embryos, S13. Feeler in late embryo, the labipalp in S14. late embryos, mesopodium and metapedes in S15. late embryos, S16. late period embryos Mesopodium leg in tire, the metapedes in S17. late embryos.

Specific embodiment

In order to clarify the technical solutions and technical objectives of the present invention, below in conjunction with the accompanying drawings and specific embodiment is to the present invention It is described further.

Embodiment 1：

In the present embodiment 1, the wingless full length genes of American cockroach are cloned.It is as follows：

The total serum IgE of 1.1 extraction tissue samples：

The total serum IgE of American cockroach egg pod, early larvae, late larval and male insect breast tissue sample is extracted, it is total The extraction of RNA is according to RNeasy Mini Kit (Qiagen companies) specifications in being operated on Biohazard Safety Equipment；Then, it will extract Total serum IgE be dissolved in the water of no RNA enzyme, detect integrality and nucleic acid through agarose gel electrophoresis and surveyed with quantification of protein detector Purity is determined with after concentration, it is spare to be stored in -70 DEG C of refrigerators.

The results are shown in Figure 1 for its electrophoresis detection：As can be seen that two apparent bands are respectively 28s from electrophoresis picture, 18s illustrates that the RNA of extraction is complete, and no degradation can be used for the amplification of RT-PCR.

1.2 prepare tissue sample cDNA：

Take American cockroach egg pod, early larvae, late larval and the male insect breast tissue sample obtained in step 1.1 The total serum IgE sample of product uses reverse transcription reagent box Super SMART^TMPCR cDNA Synthesis Kit, are said by kit Bright book carries out reverse transcription and prepares cDNA.CDNA samples detect integrality and nucleic acid through agarose gel electrophoresis and are examined with quantification of protein After surveying instrument measure purity, it is spare to be stored in -20 DEG C of refrigerators.

The clone of 1.3 American cockroach wingless gene coding regions Partial Fragments：

1.3.1 design expands the primer of American cockroach wingless genetic fragments using PCR method：

The wingless gene orders of a plurality of species with the more near edge of American cockroach are downloaded from NCBI, by sequence ratio To later, wingless gene conserved regions being chosen, with 5.0 Software for Design degenerate primer Sense primer (F1) of Primer： 5 '-AAGGATCGCTTCGACGGCGCGTC-3 ' (SEQ ID NO.3) and Antisense primer (R1)：5’- CCGCAACACATsAGrTCrCAnCC-3 ' (SEQ ID NO.4) expands wingless bases in American cockroach using PCR method Because of segment.

1.3.2 RT-PCR is expanded：

Using the American cockroach male insect breast tissue cDNA samples obtained in step 1.2 as template, degenerate primer F1 It is respectively sense primer (Forward Primer) and downstream primer (Reverse Primer) with R1, gathers according to r-Taq DNA The method of synthase (TaKaRa) specification carries out RT-PCR amplifications, and the annealing temperature and cycle-index of PCR are adjusted according to primer It is as follows：

The PCR reaction solution that total amount is 25 μ l is prepared, including：1 μ l templates cDNA, 2 μ l dNTP Maxture (2.5 μm), 0.5μl Forward Primer(10μm)、0.5μl Reverse Primer(10μm)、2.5μl 10×Ex Taq Buffer (Mg²⁺Free)、2μl MgCl₂(25mM), 0.2 μ l TaKaRa Ex Taq (5U/ μ l) and 16.3 μ lddH₂O。

PCR reaction conditions are as follows：94℃3min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 1min, 35cycles；72℃ 10min；4 DEG C of ∞ are preserved.

1.3.3 the recycling and connection of target fragment (PCR product)：

Using GenClean pillar Ago-Gel DNA QIAquick Gel Extraction Kit purified pcr products, by the DNA of recycling with PMDl9-T carriers connect, and 16 DEG C of reactions are overnight；After 5 times of dilute samples, it is attached reaction.

1.3.4 conversion：

10 μ l connection products is taken to be added in 100 μ l competent escherichia coli cell DH5 α, gently ice bath after mixing 30min；42 DEG C of heat shocks 45 seconds, place 2min in ice；Then, SOC culture mediums 800 μ l, 37 DEG C, 250 turns of shaking table culture 1h are added in； 100 μ l of the SOC culture solutions after shaking table culture is taken to be spread evenly across Amp⁺LB tablets on；The positive horizontalization in 37 DEG C of constant incubators Plate 30min, is then inverted overnight incubation；Horizontalization plate carries out blue hickie screening in 4 DEG C.

1.3.5 identification and sequencing：

A) clone is chosen：

With 10 μ l pipette tips of sterilizing in super-clean bench picking monoclonal to LB Amp⁺In fluid nutrient medium, 37 DEG C, 250 turns Shaking table culture 4-6 hours.

B) bacterium colony PCR：

The template that 0.5 μ l inoculums is taken to be reacted as PCR using general M13-F and M13-R primers, carries out PCR expansions Increase.Wherein, PCR reaction solution total amount is 15 μ l, including：1.5μl 10×PCR Buffer、1.2μl Mg²⁺、1.5μl dNTP Mix, 0.15 μ l M13-F, 0.15 μ l M13-R, 0.15 μ l r-Taq, 0.5 μ l bacterium solutions and 9.85 μ l aqua sterilisas.Its PCR reacts Program is：94℃3min；94 DEG C of 30sec, 55 DEG C of 30sec, 72 DEG C of 30sec, 30 cycles；72℃8min.After reaction, it uses 1% agarose gel electrophoresis is detected PCR product, is then sequenced, wherein obtaining the sequence of one section of 290bp long (such as Shown in Fig. 2), Blast programs through NCBI (Altschul, S.F., Madden, T.L.,A.A.,Zhang,J., Zhang,Z.,Miller,W.and Lipman,D.J.1997.Gapped BLAST and PSI-BLAST:a new generation of protein database search programs.Nucleic Acids Res 25:3389- 3402) segment is confirmed as wingless gene orders after carrying out sequence analysis analysis, for our required target fragments.

1.4. the structure of RACE cDNA libraries：

Using the RNA obtained in step 1.1 as template, kit SMART is used^TM RACE cDNA Amplification Kit build RACE cDNA libraries, and operating procedure is carried out by the specification of kit.The product of acquisition is 5'-RACE-Ready cDNA and 3'-RACE-Ready cDNA, the template that can be reacted respectively as 5'-RACE and 3'-RACE.

1.5. RACE methods amplification wingless full length genes：

3'RACE and 5'RACE primers are designed according to the wingless gene orders of the 290bp long obtained in step 1.3, Expand the full length sequence of American cockroach wingless genes.The nucleotide sequence of the 3'-RACE and 5'-RACE primers is such as Under：

3’RACE-F1：5’-GAGCCTTCCCCAGGGTTCTGCGAGC-3’；(SEQ ID NO.5)

3’RACE-F2：5’-GACTCGGTATCCAAGGCACGCACGG-3’；(SEQ ID NO.6)

5’RACE-R1：5’-CCCTGGGGAAGGCTCCAAGTAGACC-3’；(SEQ ID NO.7)

5’RACE-R2：5’-TTCTTCTTACCACCGACGCCGCTGC-3’.(SEQ ID NO.8)

With SMARTerTM RACE cDNA Amplification Kit kits (Clontech), respectively with step 1.4 Obtained in 5'-RACE-Ready cDNA or 3'-RACE-Ready cDNA for template, with gene-specific primer and UPM Primer (5 '-AAGCAGTGGTATCAACGCAGAGT-3 ') carries out the reaction of 5'-RACE or 3'-RACE nested PCR amplifications.

Wherein, first round PCR reaction solution system is：5.0μl 10×Advantage 2PCR buffer、1.0μl 50× dNTP Mix(2.5mmol/L)、5.0μl 10×UPM(10μmol/L)、1.0μl 5'RACE-R1/3'RACE-F1(10μmol/ L), 2.5 μ l RACE-Ready cDNA, 1.0 μ l 50 × Advantage 2polymerase Mix and 34.5 μ l PCR- Grade water.Its PCR reaction condition is：94 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C 3min, 5 cycles；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min, 15 cycles；72℃10min；4 DEG C of preservations.

Then, 5 μ l of first round PCR product are added in the water of 245 μ l and diluted, the template as the second wheel PCR reactions.The Two, which take turns PCR reaction solution systems, is：5.0μl 10×Advantage 2PCR buffer、1.0μl 50×dNTP Mix (2.5mmol/L)、1.0μl 10×NUP(10μmol/L)、1.0μl 5'RACE-R2/3'RACE-F2(10μmol/L)、5.0μl RACE-Ready cDNA, 1.0 μ l 50 × Advantage 2polymerase Mix and 36.0 μ l PCR-Grade water. Its PCR reaction condition is：94℃3min；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 2min, 20 cycles；72℃10min；4 DEG C of preservations.

Again, electrophoresis detection PCR is as a result, and cloning the PCR product of acquisition, being sequenced：

By the Seqman program looks aim sequences of the sequence measured DNAStar softwares, then by 5 ' RACE and 3 ' The wingless gene orders obtained in sequence and step 1.3 that RACE is obtained are spliced, due to 5 ' RACE first time nidos The product of PCR is shorter, therefore the sequence obtained according to the 5 ' RACE, devises the primer (5 ' of 5 ' RACE, second of nest-type PRC RACE-R3：5 '-TTCTTGACGCATCTCCGAGGAAACG-3 ' (SEQ ID NO.9) and 5 ' RACE-R4：5’- GGAGAACTTGAAGCCGTAGCCGATG-3 ' (SEQ ID NO.10)), as stated above, carry out second of nested PCR amplification. Its PCR electrophoresis result is as shown in Figure 3 and Figure 4.

Obtain the specific band (see Fig. 3) of a 230bp long by first time nest-type PRC, band through gel extraction, gram Grand sequencing and sequence analysis, it was demonstrated that the segment of the 230bp is 3 ' terminal sequences of wingless genes；

Obtain the specific band (see Fig. 4) of a 280bp long by first time nest-type PRC, band through gel extraction, gram Grand sequencing and sequence analysis, it was demonstrated that the segment of the 280bp is 5 ' terminal sequences of wingless genes.By first time nido 5 ' the terminal sequences that PCR is obtained are spliced with wingless gene intermediate sequences, obtain the sequence of a 450bp long, according to The sequence of this 450bp long, the primer (5 ' RACE-R3 and 5 ' RACE-R4) of 5 ' second of the nest-type PRC in end of design, by second Nest-type PRC obtains the specific band (see Fig. 4) of a 800bp long, and band is through gel extraction, cloning and sequencing and homology ratio It is right, it was demonstrated that the segment of the 800bp is 5 ' terminal sequences of wingless genes.Finally by this twice nest-type PRC obtain sequence into Row splicing, the 5 ' terminal sequences for finally obtaining wingless genes are 1,020bp.

Finally, the wingless gene orders obtained in 5 ' terminal sequences, 3 ' terminal sequences and step 1.3 are subjected to sequence spelling It connects, obtains the wingless full length gene sequences of an a length of Isosorbide-5-Nitrae 56bp, it is American cockroach through BLAST comparisons Wingless (PaWg) full length gene cDNA sequence.This sequence has been submitted into GenBank databases, and accession number is KJ680328。

Embodiment 2：

In the present embodiment 2, to American cockroach wingless (PaWg) full length gene cDNA sequence obtained in embodiment 1 Sequence analysis is carried out.

PaWg full length genes cDNA sequence is subjected to overall length integrity verification with the blast program of NCBI.Use ORF Finder (www.ncbi.nlm.nih.gov/gorf/) to the open reading frame of PaWg cDNA (open reading frame, ORF it) is searched and corresponding amino acid sequence translation.

Gene order overall length Isosorbide-5-Nitrae 56bp predicts that the open reading frame of the sequence includes 1,194 bases, encodes 397 Amino acid, the length of 5 ' UTR is 157bp, and the length of 3 ' UTR is 105bp.The initiation codon of translation be ATG, terminator codon For TGA (be located at 1349-1351), followed by tailing signal AATAAA (Fig. 5).The amino acid sequence of derivation is subjected to Blastx It is found after sequence analysis analysis, the wingless genes of the PaWg genes that this experiment obtains and other species are in amino acid levels Share the homology (table 1) of 68-76%, wherein PaWg genes and Culex quinquefasciatus (Culex quinquefasciatus), in Extra large fruit fly (Ceratitis capitata), European bumblebee (Bombus terrestris), Florida back of a bow ant (Camponotus floridanus), black lode gold Ursula butterfly (Danaus plexippus), silkworm (Bombyx mori) and pea The homology of the wingless genes of aphid (Acyrthosiphon pisum) is up to 76%.

The BLAST homology search results of 1 PaWg genes of table：

(connecting page table 1)

Embodiment 3：

In the present embodiment 3, the fundamental property of PaWg protein is analyzed：

3.1 PaWg protein analysis of physical and chemical property：

Using ProtParam tools (http://us.expasy.org/tools/protparam.html) online tool Carry out PaWg albumen analysis of physical and chemical property (Gasteiger, E., Hoogland, C., Gattiker, A., Wilkins, M.R.,Appel,R.D.and Bairoch,A.2005.Protein identification and analysis tools on the ExPASy server.Methods Mol Biol 112:531-552), using Compute pI/Mw online tools (http://www.expasy.org/tools/pi_tool.html) prediction of molecular weight and isoelectric point is carried out, it gives successively The amino acid number (Number of amino acids) of PaWg albumen, molecular weight (Molecular weight), theoretical isoelectric point (Theoretical pI), amino acid composition (Amino acid composition), positive/negative charged residues sum (Total Number of positively/negatively charged residues), total atom number (Total number of Atoms), atom composition (Atomic composition), molecular formula (Formula), instability index (Instability Index), fat index (Aliphatic index), extinction coefficient (Extinction coefficients), estimation partly decline Phase (Estimated half-life), overall average hydrophily (Grand average of hydropathicity, GRAVY).

ProtParam prediction PaWg albumen physicochemical property results such as Fig. 6.As a result it shows：The theoretical iso-electric point of the albumen It is 9.46, molecular weight 4.4kD.Atom aggregate includes 6,078 atom, molecular formula C₁₈₉₁H₃₀₁₀N₅₉₂O₅₅₁S₃₄；It is forming In 20 kinds of amino acid of PaWg albumen, the ratio highest shared by glycine (Gly) reaches 10.6%, tryptophan (Trp) and junket ammonia Ratio shared by sour (Tyr) is minimum, is 2.0%；Fat index is 65.09；The instability index of PaWg albumen is 39.37, According to GRP (Guruprasad-Reedy-Pandit) method (Guruprasad, K., Reddy, B.B.and Pandit, M.W.1990.Correlation between stability of a protein and its dipeptide composition:a novel approach for predicting in vivo stability of a protein from its primary sequence.Protein Eng 4:155-161), thus it is speculated that PaWg is protein stabilized.

3.2 PaWg protein hydrophobics are analyzed：

Using ProtScale in sequence of threads (http://us.expasy.org/cgi-bin/protscale.pl) it carries out Hydrophobicity analysis (Gasteiger, E., Hoogland, C., Gattiker, A., Wilkins, M.R., Appel, R.D.and Bairoch,A.2005.Protein identification and analysis tools on the ExPASy server.Methods Mol Biol 112:531-552).Analysis obtains value and uses Kyte-Doolittle method (Cambays You are (Campbell A.M.), and Haier (Heyer L.J.) writes, and Sun Zhirong (master translates) .2007. explores genomics, protein group It learns and bioinformatics Beijing:Science Press) judge that the ammonia base acid is hydrophily or hydrophobic amino acid (see Fig. 7).Its In, the high positive value of hydrophobicity of amino acid represents that the hydrophily of amino acid is represented with low negative value.

Fig. 7 show the hydrophobicity analysis result of PaWg albumen.Show that PaWg albumen belongs to hydrophilic protein.Speculate PaWg Amino acid contains water repellent region between the 9-18 of site and at site 86.

3.3 PaWg protein transmembrane regions are analyzed：

Use online TMHMM Server v.2.0 online tool (http://www.cbs.dtu.dk/services/ TMHMM/ the prediction of transmembrane region) is carried out, the results are shown in Figure 8, shows that PaWg albumen does not contain transmembrane region.

3.4 PaWg protein signal peptide analysis：

Letter is carried out using online SignalP 4.1Server tools (www.cbs.dtu.dk/services/SignalP) Number peptide forecast analysis (Bendtsen,J.,Nielsen,H.,von Heijne,G.and Brunak, S.2004.Improved prediction of signal peptides:SignalP 3.0.J Mol Biol 340:783- 795)。

Its analysis result is as shown in Figure 9：The signal peptide prediction of PaWg albumen the result shows that, 1-21 amino acids sequences are One segment signal peptide, there are a restriction enzyme sites between 21 and 22.

3.5 PaWg protein N-glycosylations sites and the analysis of O- glycosylation sites：

Use online software NetNGlyc 1.0Server and online DictyOGlyc 1.1server tools (http:// Www.cbs.dtu.dk/services/DictyOGlyc/) the N- glycosylation sites to the PaWg albumen of American cockroach and O- sugar It is predicted in base site.

N- glycosylation sites prediction result such as Figure 10.From result it will be seen that the albumen may include two N- sugar Base site, respectively on the asparagine in 107 and 343 sites.O- glycosylation sites prediction result such as Figure 11, the results showed that, The albumen does not include O- glycosylation sites.

3.6 PaWg Secondary structures are predicted：

Use PORTER servers (http://distill.ucd.ie/porter/) carry out secondary structure prediction (Pollastri,G.and Mclysaght,A.2005.Porter:a new,accurate server for protein secondary structure prediction.Bioinformatics 21:1719-1720)。

As a result as shown in figure 12, lastrow be PaWg amino acid sequences, next corresponding secondary structure of behavior, wherein C represents that coil (random coil), H represent that helix (α spirals), E represent extended (beta sheet), and prediction result shows In the secondary structure component of PaWg albumen, α spirals (H) account for 33.75%<45%, beta sheet (E) accounts for 10.33%>5%, therefore PaWg is not belonging to full α types albumen.

Embodiment 4：

In the present embodiment 4, (RNAi) is interfered to the American cockroach wingless genes obtained in embodiment 1 using RNA Functional examination is carried out.

The preparation of the DNA profiling of 4.1 promoters containing T7：

It is as follows：

1) using American cockroach male insect breast tissue cDNA samples as template, wg-F1 is used (CGACAACATCGGCTACGGCT) make with wg (T7)-R1 (TAATACGACTCACTATAGGGCCTCTGCACCACGGACACCT) For first pair of upstream and downstream primer, with wg (T7)-F2 (TAATACGACTCACTATAGGGCGACAACATCGGCTACGGCT) and Wg-R2 (CCTCTGCACCACGGACACCT) carries out reverse transcription PCR amplification, prepares single respectively as second pair of upstream and downstream primer The DNA profiling of promoter containing T7 (TAATACGACTCACTATAGG), method detailed in Example 1.2 on chain.

2) recycling and connection of target fragment：Detailed in Example 1.3.3；

3) it converts：Method detailed in Example 1.3.4；

4) identification and sequencing：Embodiment of the method 1.3.5.

As a result as shown in figure 13.The result shows that using American cockroach male insect breast tissue cDNA samples as template, use These two pair primer can amplify the DNA profiling of two 550bp or so the promoter containing T7 of length respectively, but primer dimer It is more.Then PCR product is carried out to cut glue, purifying, clone, single PCR product is obtained, sends to Shanghai Sangon Biotech Company and surveyed Sequence after sequence fragment is compared by Blast, is confirmed as wingless genes.

The preparation of 4.2 American cockroach wingless genes dsRNA：

Respectively using the single stranded DNA of two promoters containing T7 obtained in 4.1 as template, by T7RiboMAX^TM Express The specification of RNAi System kits is operated, and prepares the dsRNA of American cockroach wingless genes.

As a result as shown in figure 14.The result shows that in the clip size and 4.1 of the dsRNA of American cockroach wingless genes The DNA profiling amplified is in the same size, about 550bp.A concentration of 6,354ng/ the μ l, OD of the dsRNA after testing_260/280= 2.05。

The dsRNA of 4.3 injection wingless genes carries out RNA interference：

Taking the cDNA samples of American cockroach egg pod, early larvae, late larval and adult breast tissue first, (method is shown in reality It applies in example 1 1.2), respectively using the quantitative fluorescent PCR of wingless genes and reference gene β-actin reaction special primer (F： TTACCACCACTGCCGAACGA, R：CCTCTGGACAACGGAACCTC), according to real-time quantitative kit (PrimeScript RT Reagent Kit, TaKaRa) specification carry out qRT-PCR, respectively developed in American cockroach to detect wingless genes The expression in stage, concrete operation step method are as follows：

1st, qRT-PCR reaction normals tracing analysis.The cDNA templates of gradient dilution are prepared, are diluted by 10 times of gradient columns.Behaviour Make method to carry out in triplicate by real-time quantitative kit (PrimeScript RT Reagent Kit, TaKaRa), after The specificity of electrophoresis detection PCR product.Then make canonical plotting：Abscissa is the logarithm of template copy numbers, and ordinate is each The Ct values of concentration.

2nd, according to mark song, reference gene is made with β-actin genes, carries out the qRT-PCR reactions of wingless genes, reaction System is consistent with the reaction system of mark song.Response procedures are also consistent with the response procedures of mark song, and reaction is in triplicate.Reaction terminates Afterwards using the method RATE=2 for comparing Ct values^-ΔΔCT(Livak,K.J.and Schmittgen,T.D.2001.Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2^-ΔΔCT Method.Methods 25:402-408) analyze the expression of wingless genes.Ct values take repeats the flat of reaction three times Mean value.For statistical analysis to expression data using SPSS 17.0, wherein P values are less than 0.05 to be considered differential expression apparent.

American cockroach 6-9 instar larvaes each 5 is taken to only reach 10 unfertilized female insects, are injected using U.S. Hamilton Sample introduction needle (matches No. 33 syringe needles), in American cockroach larva and adult first to the position (body side) of wing former base, injects 3 μ l (3 μ g/ μ l) wingless genes dsRNA, after 3 hours, in the body opposite side of American cockroach individual, inject similary agent The dsRNA of amount carries out the RNA interference of wingless genes.Individual after RNA is interfered, similary progress qRT-PCR experiments come Detect the expression of wingless genes.Then American cockroach larva individual is respectively placed in vial and is cultivated, by America Big Lian female individuals are matched one by one with normal male insect, are individually placed in vial and are cultivated, and regularly replace food and water.It treats When American cockroach larvae development is adult, the developmental state of its wing is observed.After American cockroach interfere after female insect with just After normal male insect mating output egg pod, the embryonic development situation after observation is disturbed, while observe by interference egg pod output Larva wing former base developmental state.

In order to exclude the possibility of non-specific influences, in addition we have used Aequorea green fluorescent protein (Green Fluorescent Protein, GFP) one section of length be 720bp sequence (Chesebro, J., Hrycaj, S., Mahfooz, N.and ,A.2009.Diverging functions of Scr between embryonic and post- embryonic development in a hemimetabolous insect,Oncopeltus fasciatus.Dev Biol 329:142-151.), the larva of American cockroach and adult are injected, using pair as wingless gene injections According to group (Hrycaj, S., Chesebro, J.andA.2010.Functional analysis of Scr during embryonic and post-embryonic development in the cockroach,Periplaneta americana.Dev Biol 341:324-334.).The injecting method and injection site and wingless genes of GFP albumen are complete It is complete consistent.

As a result as shown in figure 15, it has been found that reference gene β-actin have equivalent in American cockroach each stage of development Expression, although and wingless genes can detected in American cockroach each stage of development, can by Figure 15 (A) Know, wingless genes have higher expression quantity, and the wingless in adult in egg pod, early larvae and late larval The expression quantity of gene reduces.In GFP protein control groups, the American cockroach paedomorphosis through GFP gene injections be adult after, The phenotype of its wing is consistent with wild type, and the phenotypic alternation of specificity does not occur.Treat the dsRNA and wingless of GFP genes The dsRNA of gene injected American cockroach after 10 days, we extract the RNA of each injection polypide again, and RT- is carried out after reverse transcription PCR verifies the expression of wingless genes, and the product of RT-PCR is through electrophoresis detection, as a result as shown in Figure 15 (B).We send out Wingless gene normal expressions in the wild type American cockroach body do not injected now, after the dsRNA injections of GFP genes American cockroach also can normal expression wingless genes, and the American cockroach after GFP-dsRNA is injected is internal The expression quantity of wingless genes is equal in wild type.However, the America after the dsRNA injections of wingless genes Big Lian, internal wingless genes are without expression.This result explanation, the American cockroach after being injected by wg-dsRNA, Internal wingless genes be disturbed so as to can not normal expression, show injection after American cockroach body in wingless genes By successful knockout.

Each instar larvae after being interfered by wingless genes, after being developed to adult, wing has apparent phenotypic alternation, As a result as shown in figure 16.The wing of wild type American cockroach is in long ellipticity, and finned surface is more smooth, vein is clear, the complete (figure in wing edge 16, S1).And the wing that larva develops after being disturbed, there are missing or bending fold phenomenon.We chosen in each age compared with Representational phenotypic alternation phenomenon performs an analysis.The wing that six instar larvaes develop after being disturbed, defect is the most apparent, before both sides Wing has missing, fracture.The wing tail bending of side fore wing folds, and opposite side fore wing ateliosis, length is significantly less than wild Type wing (Figure 16, S2)；And the character mutation of both sides hind wing becomes apparent, hence it is evident that hind wing ateliosis is broken there are wing tail, is curved Complications are folded, the unsharp phenotypic alternation of vein (Figure 16, S3).The wing that seven instar larvaes develop after being disturbed, both sides fore wing hair It educates more completely, no the phenomenon that lacking, but vein lines is unintelligible, has extra lines to occur, and wing tail has bending fold Phenomenon (Figure 16, S4)；But both sides hind wing is as six instar larvaes, hence it is evident that ateliosis, less than the wing of wild type, simultaneously Also there is the phenotypic alternation of imperfect wing edge, fracture, bending fold, but it is preferably young with six ages the phenomenon that phenotypic alternation Worm (Figure 16, S5).The wing that eight instar larvaes develop after being disturbed, fore wing ateliosis, side develop smaller fore wing, And finned surface out-of-flatness, vein lines is unintelligible, has extra lines to occur, the fracture of wing tail, the phenotypic alternation (figure for having bending fold 16, S6)；Wing development is more complete afterwards, without the smaller phenomenon of apparent wing development, while is compared to six ages and seven ages Larva, eight instar larvae hind wing wing tail phenomenon of ruptures reduce, but vein lines is still unintelligible (Figure 16, S7).Nine ages children Worm is the last instar larvae in our Laboratory cultures, is the age that larvae development is adult most critical.Nine instar larvae quilts The wing developed after interference, the situation of phenotypic alternation are clearly better in the larva of other each ages.Preceding wing development is complete, vein line The phenomenon that road is clear, and finned surface is smooth, and wing edge is more complete, and only wing tail in part is broken (Figure 16, S8)；And hind wing can also be sent out Educate more complete, vein is more clear, and only wing tail has the incomplete phenotypic alternation of portion fractures (Figure 16, S9).

Simultaneously we have found that female adult after being interfered by wg-dsRNA, cannot lay eggs mostly.Even if there is a small amount of egg pod production Go out, but the egg pod length of interference type output is generally shorter than the egg pod length of wild type female adult output, the quantity of ovum is also few in egg pod In the quantity of ovum in wild type egg pod.Meanwhile the egg pod of the female adult output after being disturbed is unable to normal incubation and goes out first-instar young.

Our result of study shows that wingless genes all rise during the wing development of each instar larvae of American cockroach Vital effect.Wingless genes, which are not only decide during American cockroach wing development, aptery formation, simultaneously Finned shape, vein lines, wing multiple wing development functions such as planarization in terms of also play critical effect.Wingless bases Because of the interference effect bigger of the larva small to age.After each instar larvae of Wingless gene pairs is interfered, hind wing Phenotypic alternation all become apparent than the change of fore wing phenotype.Therefore it is presumed that after wingless gene pairs wing development influence Effect is greater than the influence to preceding wing development.The missing of Wingless genes, it will directly result in American cockroach fore wing and hind wing The change of ateliosis and wing phenotype.

In addition, since the ovum of American cockroach female insect after injection wg-dsRNA is interfered, can not with it is wild The sperm of type male, which combines, forms fertilized eggs, therefore it is presumed that wingless genes American cockroach fertilized eggs forming process In also function to certain effect.The low hatchability of American cockroach egg pod after being disturbed simultaneously, also indicates that wingless genes exist The embryonic development early stage of American cockroach works, and leads to the death of body early embryo.

It can be obtained based on conclusions, which can be used for insecticide Preparation, to prevent agricultural pests and urban health insect.By preparing the insecticide containing wingless protein delations, sprinkling During urban health insect cockroach, insecticide penetrates into polypide after being contacted with cockroach epidermis or adnexa, the effect interfered by RNA, Effect is played in cockroach body, inhibits the wing development of cockroach and the development of reproductive function, causes cockroach that can not fly, reduce The ability to act of cockroach；Inhibit the fecundity of female cockroach simultaneously, make female cockroach that can not raise up seed, reduce the numerous of cockroach Grow ability.

4.4 American cockroach wingless gene in-vitro transcriptions：

Using the DNA of the promoter containing T7 of American cockroach wingless genes as template, in-vitro transcription kit is used (Riboprobe in vitro Transcription Systems, Promega) prepares the probe of the gene hybridization in situ, Specific method is shown in the kit operating instruction；Then label probe is applied in RNA interference.Meanwhile use digoxigenin labeled UTP modifies NTP.

Result prepared by American cockroach wingless gene probes is as shown in figure 17.The result shows that the fragment length and DNA Template length is consistent, about 550bp.Probe is quantified by ultraviolet specrophotometer, and concentration and probe concentration is 1 after testing, 229ng/ μ l, OD_260/280=2.06, testing result shows that the quality of the probe is preferable, available for follow-up hybridization in situ experiment.

The in situ hybridization of 4.5 American cockroach embryos：

Collect the American cockroach egg pod of each developmental stage, extract the embryo in egg pod, using methanol, PBST solution, 50 μ g/ml Proteinase K Solutions, formaldehyde, hybridization solution, with rna probe, colour reagent box (Promega) of digoxigenin labeled etc. into The hybridization in situ experiment of row American cockroach embryo finally impregnates embryo, micro- sem observation, -20 DEG C of preservations with 80% glycerine.

It is as follows：

1) the American cockroach egg pod of each developmental stage is collected, the scissors and tweezers of clean sterilizing are used in dressing table is grasped, The careful embryo extracted in egg pod, is placed in Embryo Wash Solution and is cleaned.

2) separately prepare a bottle, add in 3.7% formaldehyde of 5ml and 5ml normal heptanes, formaldehyde and normal heptane are not mutually dissolved And be layered, upper strata is normal heptane；

3) the American cockroach embryo that transfer has shelled enters in bottle, and American cockroach embryo can be located between two layers of liquid phase；

4) 15~20min between or is acutely shaken；

5) lower floor's liquid phase is sucked, but not suck the American cockroach embryo between two layers of liquid phase；

6) isometric methanol is added in, acutely shakes 2min；Rupture egg membrane；

7) 1min is stood, sucks the embryo between upper phase and two layers of liquid phase；

8) plus methanol washes embryo three times, each 5min；

9) preserve or continue following test for -20 DEG C；

Following step must avoid Rnase from polluting：

10) embryo is washed three times with PBST, each 5min；

11) embryo is handled with 50 μ g/ml Proteinase Ks, 8-15min；

12) embryo is washed four times with PBST, each 3min；

13) with 10% formaldehyde/PBST mixed processing embryo 1-2h, concussion；

14) embryo is washed five times with PBST, each 5min；

15) PBST is mixed in equal volume with hybridization solution, it is primary to wash embryo, 10min；

16) primary, the 10min that washes embryo with hybridization solution；

17) prehybridization, 48 DEG C of water-bath 1-2h are carried out with fresh hybridization solution；

18) 200 μ l of fresh hybridisation solution are added in new EP pipes, add the rna probe with digoxigenin labeled, the end of probe is dense It spends for 2ng/ μ l, boiling water bath hybridization solution 5min, ice bath 2min；

19) hybridization solution of prehybridization is sucked, adds in the hybridization solution containing probe, 48 DEG C of at least 24-48h of water-bath；

20) 12-36h is impregnated with 48 DEG C of fresh hybridisation solutions；

21) embryo is washed 3 times with fresh preheating hybridization solution, each 20min；

22) PBST is mixed in equal volume with hybridization solution, it is primary to wash embryo, 10min；

23) embryo is washed four times with PBST, each 10min；

24) step 21, step 22, step 23 carry out in 48 DEG C of water-baths；

25) anti digoxin antibody is diluted in PBST, is incubated more than embryo 2h under antibody at room temperature；

26) embryo is washed four times with PBST, each 10min；

27) embryo is washed three times with AP Buffer, each 3min；

28) it is developed the color with colour reagent box；

29) embryo is washed three times with PBST, each 3min；

30) with 25%, 50%, 75%, 90% ethyl alcohol and absolute ethyl alcohol respectively to wash embryo respectively primary；

31) it is primary with dimethylbenzene and the isometric mixed processing embryo of absolute ethyl alcohol, 1h；

32) it washes embryo several times with absolute ethyl alcohol, washes away dimethylbenzene；

33) embryo, micro- sem observation, -20 DEG C of preservations are impregnated with 80% glycerine.

As a result as shown in figure 18.The result shows that in the early stage of American cockroach embryonic development, wingless genes are in U.S. Clypeus portion, feeler base portion, chest and the leg base portion of the big Lian in continent has expression, and has arrived the late stage of embryonic development, The expression of wingless genes moves after starting, lip tip, in the middle part of feeler, chest, leg section and abdomen have expression, midriff Expression become apparent：

1) wingless genes are in the development of chest：By Figure 18, S10 can be seen that the morning in American cockroach embryonic development In stage phase, wingless genes proceed by expression in the first body segment of chest first, in the second body segment of chest and third body segment In without expression, show expression of the wingless genes in chest since the first body segment is gradually.And in American cockroach embryo Complete stage phase (Figure 18, S11) that fetal hair is educated, the expression of wingless genes extend to the second body segment and third from the first body segment In body segment.

2) wingless genes are in the development on head：To wingless genes, head is not in American cockroach embryo for we It has also been made and compares with developmental stage.We have found that in body early embryo, wingless genes have expression in the base portion of feeler, as a result Such as Figure 18, shown in S12.And late in the development of embryo, it has been found that expression of the wingless genes in feeler is to feeler Middle part migrates, as a result such as Figure 18, shown in S13.

In addition, it has been found that early stage American cockroach embryonic development, wingless genes have table in the base portion of labipalp It reaches, as a result as shown in figure S12；And late period embryonic development, expression of the wingless genes in labipalp is then to lower lip The distal tip migration of palpus, especially at the tip position of labipalp, the expression of wingless genes is particularly strong, as a result as schemed Shown in 18, S14.

3) wingless genes are in the development of leg：We American cockroach embryonic development early stage find, Wingless only has certain expression in the base portion of front foot, and the table of wingless is found no in the base portion of mesopodium and metapedes It reaches, as a result such as Figure 18, shown in S12.In the late stage of American cockroach embryonic development, it has been found that wingless genes are preceding There is expression in foot, mesopodium and metapedes, and particularly strong in each sufficient joint expression, as a result such as Figure 18, S15, S16 and S17 It is shown.S16 shows that wingless increases in the joint expression quantity of mesopodium, and schemes S17 and show wingless in the joint of metapedes There is strong expression at place.

Experimental result is indicated, in American cockroach embryo development procedure, chest, head of the wingless genes in American cockroach There are apparent function in portion and leg.During breast development, wingless genes are mainly acted on outside chest body segment Side causes the progress stage by stage of the wing development of American cockroach, is that fore wing wing former base is developed in body early embryo first, then It is that hind wing wing former base carries out in middle and later periods embryonic development.During head growth, wingless gene pairs American cockroaches touch Angle development, the extension of labipalp and the formation of podarthrum and the extension of podarthrum all play certain regulating and controlling effect. Wingless gene regulations American cockroach entire embryonic development period.

It can be obtained based on conclusions, which can be used for biological spy The preparation of needle：Since the seventies, successfully mass rearing trichogramma, anstatus, Chrysopa, coccinella septempunctata, beautiful aphid are small in China Bee, food aphid cecidomyiia, minute pirate bugs, Phyloseiulus nersimilis, west it is blind walk predations or the parasitic enemy insect such as mite, Microplitis Sp.It is logical Research foundation of the wingless genes in insect cockroach body is crossed, can be to study other predations or parasitic enemy insect Wingless genes establish important basis.So as to be visited by the wingless genes for preparing predation or parasitic enemy insect Needle, in artificial propagation natural enemy insect, using wingless gene probes, the wingless genes for making this kind of natural enemy insect are abundant It plays a role, increases the wing development function of natural enemy insect, enhance their flight performance, so as to more effectively play them Effectiveness of Natural Enemies.

Basic principle, main feature and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this The principle of invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, the present invention Claimed range is delineated by the appended claims, the specification and equivalents thereof from the appended claims.

SEQUENCE LISTING

<110>Yangzhou University

<120>American cockroach wingless full length genes are identified and application

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 1456

<212> DNA

<213> Periplaneta americana

<400> 1

acaaatcggt agctgtcgga tcggttcggc aggtctcgtg ggggcggcat cggtcgccat 60

ctcctccccc gcccccgcta actcgctttc atttttttct ggcgtctgtg cggtgccggc 120

tggtgctcgt aggtgctcct ggtgtctcca tgtgacgatg aagtggtcca gtgcaccttt 180

ggtgctgatg accctgctga tggccctcgt caccctcgcc gaggaggtgg ccagcaagaa 240

caaggccggg cgcggacgcg gcagcaagtg gtgggggatt gcgaaagccg gcgagcccaa 300

caacttgctt ccgcagacgc cgggcgcgct ctacatggac ccggccgtgc acgccattct 360

gcggcggaag cagagacgtc tagttcggga gaacccggga gttcttgtgg cggtagccaa 420

aggtgctaac caggccatcg tagaatgcca gttccagttt cgaaacagga ggtggaactg 480

ctcgacaaga aattttctac gaggcaaaaa tctcttcgga aaaattgttg acagaggttg 540

tcgggagacg gcgttcatat acgcgatcac aagtgcgggc gtgacacacg ccatcgcgcg 600

ggcgtgcagc gagggcagca tcgagtcgtg cacgtgtgat tacagccacc aggcgcgggc 660

gccgcaggtg acgtccgtgc ccggcctgcg cgactgggag tgggcgggct gctccgacaa 720

catcggctac ggcttcaagt tctcccgcga attcgtcgat accggcgagc gggggcgcaa 780

cctccgcgag aagatgaatc tccacaacaa tgaggccggc agagcgcacg tttcctcgga 840

gatgcgtcaa gaatgtaagt gccacggcat gtctggctcc tgcacggtca agacctgctg 900

gatgcggctg cccagcttcc gagtcgtagg cgacaacctc aaggatcgct tcgacggcgc 960

gtccagagtg atggtgagta acgcgggcag cctgcgcggc cagggtggta gcggcggcag 1020

cggcgtcggt ggtaagaaga acagatacaa cttccaactg aaaccctaca acccggacca 1080

caagccgccc ggccccaaag acctggtcta cttggagcct tccccagggt tctgcgagcg 1140

caacccgaga ctcggtatcc aaggcacgca cggacgtcag tgcaacgata cgtcgatagg 1200

cgtggatggt tgcgacctca tgtgttgtgg gcgaggatat agaactcatg aggtgtccgt 1260

ggtgcagagg tgtgcgtgca tgttccactg gtgctgcgaa gtcaagtgca acctctgtcg 1320

gacaaagaaa accattcaca cgtgtctgtg agtggtgaaa aagaaacaat tcacccatac 1380

tagtgagtgc tgcaaataaa acaatccaca cgtgtctgtg agtggtggaa aaaaaaaaaa 1440

aaaaaaaaaa aaaaaa 1456

<210> 2

<211> 397

<212> PRT

<213> Periplaneta americana

<400> 2

Met Lys Trp Ser Ser Ala Pro Leu Val Leu Met Thr Leu Leu Met Ala

1 5 10 15

Leu Val Thr Leu Ala Glu Glu Val Ala Ser Lys Asn Lys Ala Gly Arg

20 25 30

Gly Arg Gly Ser Lys Trp Trp Gly Ile Ala Lys Ala Gly Glu Pro Asn

35 40 45

Asn Leu Leu Pro Gln Thr Pro Gly Ala Leu Tyr Met Asp Pro Ala Val

50 55 60

His Ala Ile Leu Arg Arg Lys Gln Arg Arg Leu Val Arg Glu Asn Pro

65 70 75 80

Gly Val Leu Val Ala Val Ala Lys Gly Ala Asn Gln Ala Ile Val Glu

85 90 95

Cys Gln Phe Gln Phe Arg Asn Arg Arg Trp Asn Cys Ser Thr Arg Asn

100 105 110

Phe Leu Arg Gly Lys Asn Leu Phe Gly Lys Ile Val Asp Arg Gly Cys

115 120 125

Arg Glu Thr Ala Phe Ile Tyr Ala Ile Thr Ser Ala Gly Val Thr His

130 135 140

Ala Ile Ala Arg Ala Cys Ser Glu Gly Ser Ile Glu Ser Cys Thr Cys

145 150 155 160

Asp Tyr Ser His Gln Ala Arg Ala Pro Gln Val Thr Ser Val Pro Gly

165 170 175

Leu Arg Asp Trp Glu Trp Ala Gly Cys Ser Asp Asn Ile Gly Tyr Gly

180 185 190

Phe Lys Phe Ser Arg Glu Phe Val Asp Thr Gly Glu Arg Gly Arg Asn

195 200 205

Leu Arg Glu Lys Met Asn Leu His Asn Asn Glu Ala Gly Arg Ala His

210 215 220

Val Ser Ser Glu Met Arg Gln Glu Cys Lys Cys His Gly Met Ser Gly

225 230 235 240

Ser Cys Thr Val Lys Thr Cys Trp Met Arg Leu Pro Ser Phe Arg Val

245 250 255

Val Gly Asp Asn Leu Lys Asp Arg Phe Asp Gly Ala Ser Arg Val Met

260 265 270

Val Ser Asn Ala Gly Ser Leu Arg Gly Gln Gly Gly Ser Gly Gly Ser

275 280 285

Gly Val Gly Gly Lys Lys Asn Arg Tyr Asn Phe Gln Leu Lys Pro Tyr

290 295 300

Asn Pro Asp His Lys Pro Pro Gly Pro Lys Asp Leu Val Tyr Leu Glu

305 310 315 320

Pro Ser Pro Gly Phe Cys Glu Arg Asn Pro Arg Leu Gly Ile Gln Gly

325 330 335

Thr His Gly Arg Gln Cys Asn Asp Thr Ser Ile Gly Val Asp Gly Cys

340 345 350

Asp Leu Met Cys Cys Gly Arg Gly Tyr Arg Thr His Glu Val Ser Val

355 360 365

Val Gln Arg Cys Ala Cys Met Phe His Trp Cys Cys Glu Val Lys Cys

370 375 380

Asn Leu Cys Arg Thr Lys Lys Thr Ile His Thr Cys Leu

385 390 395

<210> 3

<211> 23

<212> DNA

<213>Artificial primer sequence

<400> 3

aaggatcgct tcgacggcgc gtc 23

<210> 4

<211> 23

<212> DNA

<213>Artificial primer sequence

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<400> 4

ccgcaacaca tsagrtcrca ncc 23

<210> 5

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 5

gagccttccc cagggttctg cgagc 25

<210> 6

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 6

gactcggtat ccaaggcacg cacgg 25

<210> 7

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 7

ccctggggaa ggctccaagt agacc 25

<210> 8

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 8

ttcttcttac caccgacgcc gctgc 25

<210> 9

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 9

ttcttgacgc atctccgagg aaacg 25

<210> 10

<211> 25

<212> DNA

<213>Artificial primer sequence

<400> 10

ggagaacttg aagccgtagc cgatg 25

Claims (7)

1. A kind of 1. American cockroach wingless full length genes cDNA, which is characterized in that gene order GenBank database logins Number be KJ680328；The cDNA full length sequences are total to Isosorbide-5-Nitrae 56bp, and open reading frame includes 1,194 nucleotide, coding 397 amino acid, nucleotide sequence is as shown in SEQ ID NO.1 in sequence table.
2. A kind of 2. protein of gene order coding as described in claim 1, which is characterized in that its amino acid sequence such as sequence In table shown in SEQ ID NO.2.
3. 3. a kind of cloning process of American cockroach wingless full length genes cDNA as described in claim 1, which is characterized in that Include the following steps：

   1) reverse transcription is carried out to the total serum IgE extracted from American cockroach sample and prepares cDNA；

   2) using the cDNA obtained in step 1) as template, primers F 1 and such as SEQ ID NO.4 of the degeneracy as shown in SEQ ID NO.3 Shown R1 is sense primer and downstream primer, carries out PCR amplification；

   3) PCR product of amplification gained is recycled, is connected, converted and is identified and is sequenced in step 2)；

   4) using the RNA obtained in step 1) as template, RACE cDNA libraries are built；The product of acquisition is 5'-RACE- Ready cDNA and 3'-RACE-Ready cDNA, the template that can be reacted respectively as 5'-RACE and 3'-RACE；

   5) 3'RACE and 5'RACE primers are designed according to the gene order obtained in step 3), respectively with obtained in step 4) 5'-RACE-Ready cDNA and 3'-RACE-Ready cDNA for template, and use UPM primers, nucleotides sequence is classified as： 5 '-AAGCAGTGGTATCAACGCAGAGT-3 ' carry out 5'-RACE or 3'-RACE nested PCR amplification American cockroaches wingless The full length sequence of gene；

   The nucleotide sequence of the 3'-RACE and 5'-RACE primers is respectively：

   3’RACE-F1：As shown in SEQ ID NO.5；

   3’RACE-F2：As shown in SEQ ID NO.6；

   5’RACE-R1：As shown in SEQ ID NO.7；

   5’RACE-R2：As shown in SEQ ID NO.8；

   6) recycle, connect and step of converting 5) in amplification gained first time nest-type PRC 5 ' RACE and 3 ' RACE PCR production Object；

   7) the wingless gene orders obtained in step 3) are spliced with 5 ' the RACE gene orders obtained in step 6), The 5'RACE primers of second of nest-type PRC are designed according to the gene order spliced, and with the 5'- obtained in step 4) RACE-Ready cDNA be template, the full length sequence of second of nested PCR amplification American cockroach wingless gene；Described The nucleotide sequence of the 5'-RACE primers of second of nest-type PRC is respectively：

   5’RACE-R3：As shown in SEQ ID NO.9；

   5’RACE-R4：As shown in SEQ ID NO.10.

   8) PCR product of 5 ' RACE of second of nest-type PRC of amplification gained is recycled, is connected, is converted in step 7), And it identifies and is sequenced；

   9) by the wingless gene orders obtained in step 3), the 5 ' RACE that are obtained in step 6) and 3 ' RACE gene orders with 5 ' the RACE gene orders obtained in step 8) are spliced, and wingless full length gene sequences are obtained, through BLAST comparisons It is American cockroach wingless full length gene cDNA sequences.
4. 4. a kind of gram of American cockroach wingless full length genes cDNA as described in claim 1 as claimed in claim 3 Grand method, which is characterized in that in step 2), PCR reaction conditions are as follows：94℃3min；94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C 1min, 35cycles；72℃10min；4 DEG C of preservations.
5. 5. a kind of gram of American cockroach wingless full length genes cDNA as described in claim 1 as claimed in claim 4 Grand method, which is characterized in that in step 5), first round PCR reaction condition is：94 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94℃ 30s, 68 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min, 15 cycles；72℃10min；4℃ It preserves；Preferably, the second wheel PCR reaction conditions are：94℃3min；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 2min, 20 cycles；72 ℃10min；4 DEG C of preservations.
6. 6. a kind of gram of American cockroach wingless full length genes cDNA as described in claim 1 as claimed in claim 3 Grand method, which is characterized in that in step 5), first round PCR reaction condition is：94 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94℃ 30s, 68 DEG C of 30s, 72 DEG C of 3min, 5 cycles；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min, 15 cycles；72℃10min；4℃ It preserves；Preferably, the second wheel PCR reaction conditions are：94℃3min；94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 2min, 20 cycles；72 ℃10min；4 DEG C of preservations.
7. 7. a kind of American cockroach wingless full length genes cDNA as described in claim 1 is preparing cockroach insecticide and life The albumen of application and a kind of gene order coding as described in claim 1 as claimed in claim 2 in terms of physical prospecting needle Application of the matter in terms of bioprobe is prepared.