CN106854646A - A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states - Google Patents
A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states Download PDFInfo
- Publication number
- CN106854646A CN106854646A CN201611190475.7A CN201611190475A CN106854646A CN 106854646 A CN106854646 A CN 106854646A CN 201611190475 A CN201611190475 A CN 201611190475A CN 106854646 A CN106854646 A CN 106854646A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- lin28
- mouse embryo
- embryo stem
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Abstract
The present invention is a kind of preparation method of the mouse embryo stem cell of the low expression Lin28 for maintaining mouse embryo stem cell Naive states.The method is to build in RNAi ReadypSIREN RetroQ interference carriers the Lin28 interference sequences of sequence in sequence table 1, obtains and disturbs recombinant plasmid containing RNA Lin28；And by liposome（Lipofactamine2000）The method of transfection is by RNA Lin28 interference Transfected Recombinant Plasmids to mouse embryo stem cell D3, and by antiradiation drug screening-gene puromycin (puromycin) that contains on recombinant vector by adding medicine to be screened and being set up transgenic cell line, monitored with the various indexs that the transgenic cell carries out mouse embryo stem cell Naive states, it is found that Lin28 expression is reduced and mouse embryo stem cell Naive states are maintained to play facilitation.The method of the present invention interior stabilization interference Lin28 can be expressed in Transgenic Mice Embryo stem cell, significantly improve the ability for maintaining mouse embryo stem cell Naive states.
Description
Technical field
The present invention relates to prepare a kind of mice embryonic of the low expression Lin28 for being able to maintain that mouse embryo stem cell Naive states
The method of stem cell, belongs to biological and new medical technology field.
Background technology
Lin28（Lineage Protein 28）It is a kind of RNA with conserved domain, DBP in embryo
The maintenance of stem cell versatility, tumour occurs, metabolism, and the gene played an important role in growth course.Lin28 makees
For the development impact of versatility gene pairs mouse embryo stem cell can be provided newly for the cultural method of the mankind and mice embryonic from now on
Thinking.
Lin28 is originally found in Caenorhabditis elegans, and development period, Lin28 are regulated and controled by a series of idiotype network
Mutation can cause the development in advance of larva, it is found that having in invertebrate to vertebrate in follow-up research
The presence of Lin28 and in structure and sequence all with height conservative.With going deep into for research, people are to Lin28's
Understand it is more and more, the visual field that Lin28 actually enters people be 2007 it can jointly be induced with Nanog/Oct4/Sox2
Somatic conversion is different from Oct4 and Sox2 into the iPS cells with versatility, and Lin28 is not required in this course
, but it can improve reprogramming efficiency by increasing cell division capacity.Then it is found that Lin28 can promote differentiation,
This is different from other versatility genes, and Lin28 far from versatility genes are so simple.
Embryonic stem cell is a kind of very strong cell colony of heterogeneity, wherein only part cell is in real versatility
（Naive Pluripotency）, and other cells then show differentiation tendency.2008 years it is found that be able to maintain that embryo
Tire stem cell is in the cultivating system of Naive states, i.e., " 2i "（MEK and GSK3 inhibitor）Cultivating system, embryonic stem cell exists
Cell shows the circular clone's shape growth of homogeneous, typical embryonic stem cell after being cultivated under the conditions of such, thus people by this
A kind of embryonic stem cell that Ground states are also referred to as in Naive-like embryonic stem cells, and other cells are in then
Reveal the Primed states for tending to differentiation.The a group cell detachment Naive states of Lin28 expression high are presented mesendoderm differentiation
Tendency.Lin28 is unclear to the Naive states and Primed state influences of the embryonic stem cell of in vitro culture.Cause
This, we are initially set up with Lin28 interference sequence carrier for expression of eukaryon, and realize its stable table in embryonic stem cell
Reach, so can aid in us and set up a kind of Naive state embryonic stem cell culture systems of maturation, especially contribute to
The foundation of the embryonic stem cell Naive state cultivating systems of people, Lin28 develops as versatility gene pairs mouse embryo stem cell
Influence, can provide new thinking for the cultural method of the mankind and mice embryonic from now on.
The content of the invention
The present invention is a kind of embryonic stem cell line of low expression Lin28, and mouse embryo stem cell Naive states are maintained
Important function.
The method that the invention is provided is to import in mammalian cell DNA interference sequences, obtains steady decrease Lin28 eggs
The cell of white expression.
Wherein, the mammalian cell is mouse embryo stem cell.
The gene primer, transgenic cell belong to the protection domain of invention.
The method of the present invention can in mouse embryo stem cell steady decrease Lin28 expression, significantly maintain mouse
Embryonic stem cell Naive states.
Brief description of the drawings
Fig. 1 is RNAi-Ready pSIREN-RetroQ Lin28 carrier structure schematic diagrames, and the plasmid can be dynamic in lactation
Thing cell inner expression RNAi-Lin28 is expressed such that it is able to steady decrease Lin28.
Fig. 2 is the mice embryonic stem cell system for building steady decrease Lin28 expression, and is examined from mRNA and protein level
Lin28 expression in mouse embryo stem cell is surveyed, it is found that compared to control group, the Lin28 expression of experimental group is reduced.
Fig. 3 is the mice embryonic stem cell system and control group of the steady decrease Lin28 expression under the conditions of traditional serum free culture system
The cell picture of mice embryonic stem cell system and they are cultivated in serum and under the conditions of having trophocyte Feeder
Cell picture.
Fig. 4 is the mouse embryo stem cell and Naive state mouse embryo stem cell cytological maps of steady decrease Lin28 expression
Piece is contrasted.
Fig. 5 is the specific gene of Naive states in the mouse embryo stem cell that steady decrease Lin28 is expressed, and these are special
The expression of the gene of the opposite sex is raised in mRNA level in-site.
Fig. 6 is that Naive state specific gene Nanog and Dppa3 exists in reducing the mouse embryo stem cell that Lin28 is expressed
Expression on protein level, as a result shows compared to control group, reduces the mouse embryo stem cell of Lin28 expression these gene tables
Up to rising.
Specific embodiment
Method therefor is conventional method unless otherwise specified in following embodiments, and agents useful for same can be from commercial channels
Obtain.
Primer synthesizes and sequencing is by Invitrogen（Beijing company）Complete.
RNA extracts reagents purchase Invitrogen companies, reverse transcription reagent box and Lipo2000 transfection reagents are purchased from
Invitrogen companies.
Restriction enzyme is purchased from Takara companies, and interference carrier comes from Clontech companies, but by transformation.
Digestion, connection, recovery, conversion, primer annealing equimolecular biological experiment operating procedure are referred to《Molecular cloning（The
Three editions）》.
Embodiment 1, mouse RNAi-Lin28 interference carriers build
Mouse RNAi-Lin28 Ready pSIREN-RetroQ interference carriers and construction step are as follows：
According to BD Knockout RNAi Systems User Manual（No. PT3739-1）Design Lin28 RNAi do
Disturb sequence：5 ' GGAGACAGGTGCTACAACT 3 ' is separately added into restriction enzyme enzyme in the upstream and downstream of interference sequence
Enzyme site EcoRI and BamHI (sense primer：5'-GAT CCG GGA GAC AGG TGC TAC AAC TTT CAA GAG A
AG T TGT AGC ACC TGT CTC CCT TTT TTA AGC TTG-3', anti-sense primer：5'-AAT TCA AGC TTA
AAA AAG GGA GAC AGG TGC TAC AAC TTC TCT TGA AAG TTG TAG CAC CTG TCT CCC G-3')
By the interference sequence primer annealing to mouse Lin28 and interference empty carrier double digestion, interference empty carrier skeleton and annealing
Primer connection, conversion；A series of mistakes such as restructuring interference plasmid is extracted, the identification of restructuring interference plasmid single endonuclease digestion, recombinant vector sequencing
Journey, obtains mouse RNAi-Lin28 interference carriers, and recombinant plasmid is as shown in Figure 1.
Embodiment 2：The Function detection of mouse Lin28
As shown in Fig. 2 the method that RNAi-Lin28 Ready pSIREN-RetroQ interference carriers are passed through into liposome transfection（Step
Suddenly invitrogen specifications are referred to）Cell is transfected into, and using the eucaryon resistant gene on interference carrier, is trained by cell
Add medicine puromycin to screen successfully by carrier restructuring to the mouse embryo stem cell on genome during supporting, and it is expanded
Big culture, obtains the mice embryonic stem cell system of steady decrease Lin28 expression, and real-time PCR/ are finally passed through again
Western blot detection means proves, is transferred to the mouse embryo stem cell of interference carrier, the expression of its Lin28 in RNA and
All substantially reduced on protein level, show that we obtain cell for Lin28 expresses significantly reduced cell line.Lin28 will be reduced
Traditional serum that the mouse embryo stem cell of expression is placed on identical and has trophocyte Feeder with cellular control unit is trained
Support under the conditions of observation of cell form can be seen that as shown in figure 3, steady decrease Lin28 expression mouse embryo stem cell with compare
Group mouse embryo stem cell is distinguished less on colony morphology, and due to the influence of Feeder, two kinds of cells are all presented the source of an allusion
The mouse embryo stem cell Naive states of type；But two kinds of cells are individually placed under the conditions of traditional serum free culture system, compared to
For cellular control unit, the cell for reducing Lin28 expression is morphologically rendered obvious by out typical mouse embryo stem cell clone
Spherical shape, this form shows typical mouse embryo stem cell Naive states.
Embodiment 3：The function that mouse RNAi-Lin28 transgenic cells are maintained to mouse embryo stem cell Naive states is made
With.
As shown in figure 4, mouse embryo stem cell is maintained Naive states and is normally being trained by using 2i+Lif condition of culture
The mouse embryo stem cell that Lin28 expression is reduced under the conditions of supporting is approached compared to both forms, by cellular morphology under the conditions of two kinds
Comparative illustration reduction Lin28 expression mouse embryo stem cell can maintain mouse embryo stem cell Naive states.
By screening in document it has been reported that specific some genes of mouse embryo stem cell Naive states crossed：
Rex1/Esrrb/Nr0b1/Bmp7/Nanog/Tfcp2l1/Prdm14, these genes are in mouse embryo stem cell Naive states
Under, it is presented expression status high in mRNA level in-site；Expressed using the method detection steady decrease Lin28 of real-time PCR
Mouse embryo stem cell and control group mice embryonic stem cell cell these genes in mRNA level in-site expression trend, as a result
As shown in Figure 5, compared to control group mice embryonic stem cell, the mice embryonic that these genes are expressed in steady decrease Lin28
Express higher in stem cell, illustrate that the mouse embryo stem cell for reducing Lin28 expression can maintain mouse embryo stem cell Naive
State.
The mouse embryo stem cell and control group mice expressed using Western blot methods detection steady decrease Lin28
Nanog/Dppa3 protein expressions situation in embryonic stem cell, it is thin in the mouse embryonic stem of steady decrease Lin28 expression shown in Fig. 6
In born of the same parents these genes on protein expression level apparently higher than control group mice embryonic stem cell.
Claims (3)
1. a kind of transgenic cell, is by DNA interference sequences（GATCCGGGAGACAGGTGCTACAACTTTCAAGAGAAGTTGT
AGCACCTGTCTCCCTTTTTTAAGCTTG）Import in mammalian cell, obtain steady decrease mouse Lin28 protein expressions
Cell.
2. transgenic cell according to claim 1, it is characterised in that：The mammalian cell is that mouse embryonic stem is thin
Born of the same parents.
3. it is a kind of to prepare the side that low expression Lin28 embryonic stem cell lines maintain to work to mouse embryo stem cell Naive states
Method, be the transgenic cell described in right 1 or right 2 as research object, Lin28 expressed in embryonic stem cell decline meeting
Cause to maintain the enhancing of embryonic stem cell Naive state capabilities.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611190475.7A CN106854646A (en) | 2016-12-21 | 2016-12-21 | A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611190475.7A CN106854646A (en) | 2016-12-21 | 2016-12-21 | A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106854646A true CN106854646A (en) | 2017-06-16 |
Family
ID=59126349
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611190475.7A Pending CN106854646A (en) | 2016-12-21 | 2016-12-21 | A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106854646A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101617043A (en) * | 2007-10-31 | 2009-12-30 | 国立大学法人京都大学 | Nuclear reprogramming method |
| CN102181445A (en) * | 2011-03-21 | 2011-09-14 | 上海生博生物医药科技有限公司 | Interference small molecule RNA of targeted LIN28 gene and glioma proliferation resistant application thereof |
| CN102732476A (en) * | 2012-07-19 | 2012-10-17 | 中国农业大学 | Embryonic stem cell culture medium and application thereof |
| WO2016072519A1 (en) * | 2014-11-07 | 2016-05-12 | 国立大学法人大阪大学 | Differentiation-induced cell population from which undifferentiated cells have been removed, use of same, and method for producing same |
-
2016
- 2016-12-21 CN CN201611190475.7A patent/CN106854646A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101617043A (en) * | 2007-10-31 | 2009-12-30 | 国立大学法人京都大学 | Nuclear reprogramming method |
| CN102181445A (en) * | 2011-03-21 | 2011-09-14 | 上海生博生物医药科技有限公司 | Interference small molecule RNA of targeted LIN28 gene and glioma proliferation resistant application thereof |
| CN102732476A (en) * | 2012-07-19 | 2012-10-17 | 中国农业大学 | Embryonic stem cell culture medium and application thereof |
| WO2016072519A1 (en) * | 2014-11-07 | 2016-05-12 | 国立大学法人大阪大学 | Differentiation-induced cell population from which undifferentiated cells have been removed, use of same, and method for producing same |
Non-Patent Citations (4)
| Title |
|---|
| ELISA NARVA ET AL: "RNA-Binding Protein L1TD1 Interacts with LIN28 via RNA and is Required for Human Embryonic Stem Cell Self-Renewal and Cancer Cell Proliferation", 《STEM CELLS》 * |
| JIN ZHANG ET AL: "LIN28 Regulates Stem Cell Metabolism and Conversion to Primed Pluripotency", 《CELL STEM CELL》 * |
| SILVIA PARISI ET AL: "Lin28 is induced in primed embryonic stem cells and regulates let-7-independent events", 《THE FASEB JOURNAL》 * |
| 申红红 等: "Lin28的功能研究进展", 《中南大学学报（医学版）》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Comprehensive characterization of distinct states of human naive pluripotency generated by reprogramming | |
| Aoshima et al. | Paternal H3K4 methylation is required for minor zygotic gene activation and early mouse embryonic development | |
| Flemr et al. | A retrotransposon-driven dicer isoform directs endogenous small interfering RNA production in mouse oocytes | |
| Nie et al. | Organoid technologies meet genome engineering | |
| Xiong et al. | Expression of aquaporins in human embryos and potential role of AQP3 and AQP7 in preimplantation mouse embryo development | |
| Zhan et al. | Low shear stress increases recombinant protein production and high shear stress increases apoptosis in human cells | |
| Jeong et al. | Chaetocin improves pig cloning efficiency by enhancing epigenetic reprogramming and autophagic activity | |
| Liu et al. | Development of a toolkit for piggyBac-mediated integrative transfection of the human filarial parasite Brugia malayi | |
| Wang et al. | miR‐31 regulates spermatogonial stem cells meiosis via targeting Stra8 | |
| Guo et al. | Obox4 secures zygotic genome activation upon loss of Dux | |
| Kim et al. | Function of COP9 signalosome in regulation of mouse oocytes meiosis by regulating MPF activity and securing degradation | |
| CN108138165A (en) | The ovum of birds, the production method of birds and birds | |
| CN106854646A (en) | A kind of mouse embryo stem cell of the low expression Lin28 of maintenance mouse embryo stem cell Naive states | |
| JP6469371B2 (en) | A method for expressing a plurality of foreign genes in an embryoid body composed of induced pluripotent stem cells (iPS cells) | |
| Yan et al. | Identification and characterization of four Drosophila suzukii cellularization genes and their promoters | |
| Wang et al. | Dynamic replacement of H3. 3 affects nuclear reprogramming in early bovine SCNT embryos | |
| Ou et al. | A ϕC31 integrase‐mediated integration hotspot in favor of transgene expression exists in the bovine genome | |
| CN106544360B (en) | A method of terminating the transcription of lncRNA diallele | |
| CN105154471A (en) | Preparation method of liver cells with low expression or no expression of PERV | |
| CN109628489A (en) | A kind of method and its application improving Chinese hamster ovary celI recombinant protein expression, expression vector, expression system and preparation method thereof | |
| Zuo et al. | Study on the regulatory mechanism of the lipid metabolism pathways during chicken male germ cell differentiation based on RNA-seq | |
| Ng et al. | Germline stem cell heterogeneity supports homeostasis in Drosophila | |
| CN104232643A (en) | RNAi (ribonucleic acid interference) interference segment, interference vector, and preparation method and application thereof | |
| Zhang et al. | Nanos2 promotes differentiation of chicken (Gallus gallus) embryonic stem cells to male germ cells | |
| CN106939318A (en) | A kind of single cell clone separation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170616 |