CN106834522B - Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application - Google Patents
Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application Download PDFInfo
- Publication number
- CN106834522B CN106834522B CN201710197478.1A CN201710197478A CN106834522B CN 106834522 B CN106834522 B CN 106834522B CN 201710197478 A CN201710197478 A CN 201710197478A CN 106834522 B CN106834522 B CN 106834522B
- Authority
- CN
- China
- Prior art keywords
- citrus
- pathogen
- primer pair
- rigidity
- specifically
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer pair for specifically and rapidly detecting citrus rigidity disease pathogens, a kit and application. The primer pair is a specific PCR primer pair designed based on a membrane protein gene sequence of a citrus catalepsy pathogen (spiroplama citri), and the sequence of the primer pair is shown as SEQ ID No: 1 and SEQ ID No: 2, respectively. The method can specifically detect the citrus Spiroplasma (spiroplama citri), does not need to carry out separation culture of the Spiroplasma, and can directly detect pathogen from the total DNA of citrus. The invention has high detection sensitivity, and can detect the content of 10‑5ng/. mu.L of spiroplasma in total DNA of citrus. The method is short in detection time, economical and applicable, the total flow is 3-4 hours, and the cost of detection cost of a single sample is only 5-6 yuan.
Description
Technical Field
The invention relates to a detection technology of alien invasive plant diseases, in particular to a primer pair for specifically and rapidly detecting citrus rigidity disease pathogens, a kit and application.
Background
The spiroplasma is a prokaryotic microorganism which has a diameter of about 100-250 nm and a spiral basic form and does not have a cell wall. In 1973 Spiroplasma (spiroplama) was established, the Spiroplasma which is now found, was divided into 34 serogroups according to serological properties, and 37 Spiroplasma species have been established. The relationship between spiroplasma and host can be divided into 3 types of symbiosis (Mutualism), symbiosis (Commensalism) and pathogenicity (Pathogenic), wherein the pathogenicity spiroplasma can cause the five-month disease and the crawl bee disease of bees, the trembling disease of shrimps and crabs, the Citrus rigidity disease (Citrus stubbborn), the maize dwarf disease and the like, and the relationship has serious influence on the honey bee industry, the aquaculture industry and the agricultural production.
Plant spiroplasma is found primarily in plant sieve ducts and in plant sap-feeding insects, which are the only vectors for the transmission of spiroplasma, most of which are not pathogenic to the mediator insects. Citrus catalepsy is caused by phloem-restricted Spiroplasma (spiroplama citri), which is transmitted by citrus leafhoppers in the field. Pathogens infect most citrus varieties and cultivars, primarily in tropical and arid citrus growing regions, including the california, arizona, north africa, east mediterranean basins and the middle east of the united states. Infested citrus causes severe dysplasia, dense and abnormally upright leaves, chlorosis of the leaves, resembling nutritional deficiency symptoms, with severe yield loss in the later stages.
The spiroplasma has no cell wall and tiny individual, compared with other microorganisms, the methods such as separation, microscopic examination and the like of the spiroplasma are difficult, and the spiroplasma in other species is only limited to the separation identification and the research of biological characteristics except the research of the spiroplasma in the shrimps such as the king Wen in China. In 2004, the royal culture and the like are based on 16S rDNA of bacteria, the pathogeny of the river crab tremble disease is detected by utilizing a PCR technology, and the pathogeny is found to be a new species of the spiroplasma and is named as the Eriocheir sinensis spiroplasma; in 2012, lissajous et al detected a new pathogenic spiroplasma in bees by amplification and sequencing comparison of 16S rDNA universal primers of bacteria. At present, the detection of the spiroplasma is mainly based on a 16S rDNA sequence of bacteria, the spiroplasma needs to be cultured firstly, then DNA of the spiroplasma is extracted, then PCR amplification is carried out by using a universal primer of the bacteria, and finally, a test result needs to be verified by further sequencing comparison. In order to further improve the detection efficiency and sensitivity of the specific spiroplasma, the method also needs to explore and search other genes or nucleic acid segments to be applied to specific detection of the specific spiroplasma, does not need to carry out a complicated spiroplasma culture process, and directly and specifically detects the spiroplasma pathogen from the total DNA of a host.
The citrus spiroplasma pathogen is listed in a foreign invasive species database in China, the citrus rigidity disease is not reported in the field yet at home, the quarantine detection of foreign citrus diseases needs to be enhanced along with the acceleration of the global economy integration process, and a set of good citrus spiroplasma pathogen detection scheme is very important for the detection of pathogens and the prevention and control of diseases.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention mainly aims to provide a primer pair for specifically and rapidly detecting the pathogen of citrus rigidity disease.
The invention also aims to provide a kit for specifically and rapidly detecting the pathogen of citrus rigidity disease.
the invention further aims to provide application of the primer pair or the kit for specifically and rapidly detecting the pathogen of the citrus rigidity disease.
the purpose of the invention is realized by the following technical scheme:
The invention provides a primer pair for specific rapid detection of citrus rigidity disease pathogen, which is a specific PCR primer pair designed based on a membrane protein gene sequence of citrus rigidity disease pathogen (spiroplama citri), and the sequence of the primer pair is as follows:
An upstream primer Scf: 5'-CACCTGCAACTGTAGCAACA-3', respectively; (SEQ ID No: 1)
The downstream primer Scr: 5'-TGCAGCATTCATCCCTTGTG-3' are provided. (SEQ ID No: 2)
The invention also provides a kit for specifically and rapidly detecting the pathogen of the citrus rigidity disease, which comprises the primer pair.
The primer pair for specifically and rapidly detecting the pathogen of the citrus rigidity disease is applied to the detection of the pathogen of the citrus rigidity disease.
The kit for specifically and rapidly detecting the pathogen of the citrus rigidity disease is applied to the detection of the pathogen of the citrus rigidity disease.
A method for specifically and rapidly detecting citrus rigidity disease pathogens comprises the following steps:
(1) Extracting citrus genome DNA;
(2) Taking the citrus genome DNA obtained in the step (1) as a template, and utilizing the nucleotide sequence shown in SEQ ID No: 1 and SEQ ID No: 2, carrying out PCR reaction on the primer pair;
(3) Carrying out agarose gel electrophoresis detection on the PCR reaction product obtained in the step (2); if the target band is amplified, the target band is positive, namely the disease is infected; if any band is not amplified, the result is negative, namely healthy.
the citrus genome DNA is extracted by adopting an improved CTAB method, and the method comprises the following steps:
(1) Taking 200mg of citrus diseased leaves, putting the citrus diseased leaves into a mortar, adding liquid nitrogen, and grinding the citrus diseased leaves into powder;
(2) Adding preheated extraction buffer solution 2 × CTAB (2% CTAB, 1.4mol/L NaCl, 20mmol/L EDTA, 100mmol/L Tris-HCl, pH8.0, adding 0.2% mercaptoethanol before use) 600 μ L at 65 deg.C, slightly grinding and mixing;
(3) The slurry was transferred to a 1.5mL centrifuge tube and subjected to a 65 ℃ water bath for 30min with shaking occasionally.
(4) Add 600. mu.L chloroform/isoamyl alcohol (24:1), shake vigorously for 2 minutes at 12000rpm, centrifuge for 5min, and place the supernatant in a new centrifuge tube.
(5) Adding chloroform/isoamyl alcohol (24:1) with the same volume as the supernatant, gently mixing, centrifuging at 12,000rpm for 5min, and taking the supernatant to place in a new centrifuge tube.
(6) Adding 1/10 volume of 3mol/L NaAc (pH5.2) and 2 times volume of cold anhydrous ethanol, mixing, and standing at-20 deg.C for 20 min.
(7) Centrifuging at 12000rpm at 4 deg.C for 10min, removing supernatant, washing precipitate with 70% ethanol and anhydrous ethanol respectively, air drying at room temperature, dissolving precipitate in 200 μ L TE (100mmol/L EDTA, 10mmol/L Tris-HCl, pH8.0), and storing.
The PCR reaction system comprises the following steps:
The PCR reaction conditions are as follows:
The target strip is a membrane protein gene sequence of amplified citrus catalepsy pathogen (spiroplama citri), and is shown as SEQ ID No: 3, showing: (818bp)
CACCTGCAACTGTAGCAACAGCAAACCCAAAACAAGTTACAAACGCTGAAATTAAAACAGCGTTAGAAGCTAATGTTTTAAAAGCAGTGCAAGGAGTTGTAAAAACAGCAACAGCAGCTGATTTTCAATTTGATGTTTATCAAGACAACGAAGGTACATCATTAACAACAATTAATTTACAAGGAGGTAACGTTGAAGTTTATGTTCAAATTACTCCAGCAAAAGATAAAACTGTTGTTATTGGTAAAACAGGATACATTAAAGTAACTTTACCAAAAATAAAAGTAGATATTTCAAGTGTAGTAATAAATCAACAAATTGTAGAAATTAAAGCAGCAGACCCAAAACAAGTTACAAAAGATGAGTTAAATGCAGTTAATACTTATGCAACTCTTGCAAGTGCTGTTTTAGAGGCTATAAAAAATAAAGCACCAAATGCAGGAGCAAGTGATTTTGAAATTACAAATAATTGTGATGCGGGAAACTATTCAGAACAAAAAGATGTTAAAGTAACAGTTAAAGCAAAAGATGAATCACCAAACATTTCTGGTGAATTTAAAGTTAATGCAAAAGTAAAAGCTATATTAGCACCAGCAAATGCAGGATAAGAATTAACTTTTTCTTATTTAGAACAAAATAAAAAACACTTATTAAAGTGTTTTTTATGTTTTTTAGTTAAAAAAATCTTTACAATCTTAGAATATCAACTAAAATTAATATAAACAAGATAAAACAAGCAAAAGAGAAGGAGAAAAAGCATGCTTAAAAAAATTGGAATTTTAACATCTGGTGGTGATTCACAAGGGATGAATGCTGCA。
Compared with the prior art, the invention has the following advantages and effects:
(1) The method can specifically detect the citrus Spiroplasma (spiroplama citri), does not need to carry out separation culture of the Spiroplasma, and can directly detect pathogen from the total DNA of citrus.
(2) The invention has high detection sensitivity, and can detect the content of 10-5ng/. mu.L of spiroplasma in total DNA of citrus.
(3) the method is short in detection time, economical and applicable, the total flow is 3-4 hours, and the cost of detection cost of a single sample is only 5-6 yuan.
drawings
FIG. 1 shows the results of PCR-specific detection of Cipangopyrum citrinum; wherein, lane M, 2000bp DNA Marker; lane 1, positive control; lane 2, negative control; lane 3, template citrus diseased leaf DNA; lane 4, template citrus healthy leaf DNA.
FIG. 2 shows the results of the sensitivity test for PCR detection of Cipangopaludina chinensis; wherein, lane M, 2000bp DNA Marker; lanes 1, 10-1ng/. mu.L of diseased citrus DNA; lanes 2, 10-2ng/. mu.L of diseased citrus DNA; lanes 3, 10-3ng/. mu.L of diseased citrus DNA; lanes 4, 10-4ng/. mu.L of diseased citrus DNA; lanes 5, 10-5ng/. mu.L of diseased citrus DNA; lanes 6, 10-6ng/. mu.L of diseased citrus DNA; lanes 7, 10-7ng/. mu.L of diseased citrus DNA.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.
Example 1: detection of citrus spiroplasma
1. extraction of Citrus genome DNA
Extracting citrus genome DNA by adopting an improved CTAB method.
(1) Collecting diseased/healthy citrus leaves 200mg, placing in mortar, adding liquid nitrogen, and grinding into powder.
(2) Add rapidly the pre-heated extraction buffer 2 × CTAB (2% CTAB, 1.4mol/L NaCl, 20mmol/L EDTA, 100mmol/L Tris-HCl, pH8.0, before use 0.2% mercaptoethanol) 600 μ L at 65 deg.C, grind slightly and mix well.
(3) the slurry was transferred to a 1.5mL centrifuge tube and subjected to a 65 ℃ water bath for 30min with shaking occasionally.
(4) add 600. mu.L chloroform/isoamyl alcohol (24:1), shake vigorously for 2 minutes at 12000rpm, centrifuge for 5min, and place the supernatant in a new centrifuge tube.
(5) Adding chloroform/isoamyl alcohol (24:1) with the same volume as the supernatant, gently mixing, centrifuging at 12,000rpm for 5min, and taking the supernatant to place in a new centrifuge tube.
(6) Adding 1/10 volume of 3mol/L NaAc (pH5.2) and 2 times volume of cold anhydrous ethanol, mixing, and standing at-20 deg.C for 20 min.
(7) Centrifuging at 12000rpm at 4 deg.C for 10min, removing supernatant, washing precipitate with 70% ethanol and anhydrous ethanol respectively, air drying at room temperature, dissolving precipitate in 200 μ L TE (100mmol/L EDTA, 10mmol/L Tris-HCl, pH8.0), and storing.
2. Configuring a PCR reaction system
And (3) PCR reaction system:
3. Setting PCR reaction conditions
The following reaction conditions were set on the PCR instrument:
4. Gel electrophoresis and visualization
mix 5 μ L of PCR product with 1 μ L of 6 × loading solution, and detect by 1% agarose gel electrophoresis, as shown in FIG. 1: lane 1, positive control; lane 2, negative control; lane 3, template citrus diseased leaf DNA; lane 4, template citrus healthy leaf DNA. Amplifying 818bp target bands by using positive control and infected leaf DNA as templates; negative control and healthy leaf DNA were used as templates, and no band was amplified.
Example 2: PCR detection sensitivity test
1. DNA gradient dilution
Measuring the DNA concentration of a citrus sample using an ultraviolet spectrophotometer, followed by a sterilized ddH2O, diluting the citrus DNA concentration to 10 ng/. mu.L, diluting the 10 ng/. mu.L citrus DNA by a 10-fold gradient, and respectively using the diluted citrus DNA as PCR amplification modelsAnd (3) a plate.
2. PCR amplification
The PCR reaction system and conditions were the same as in example 1.
3. gel electrophoresis and visualization
Mix 5 μ L of PCR product with 1 μ L of 6 × loading solution, and detect by 1% agarose gel electrophoresis, as shown in FIG. 2: lanes 1-7, templates 10 respectively-1ng/μL～10-7ng/. mu.L of susceptible citrus DNA. And (3) displaying a detection result: through 10-5Diluted susceptible citrus DNA (10)-5ng/. mu.L), a brighter band of interest (818bp) was still detectable.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute for plant protection of academy of agricultural sciences of Guangdong province
primer pair for specific rapid detection of citrus rigidity disease pathogen, kit and application
<130> 1
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> upstream primer Scf
<400> 1
cacctgcaac tgtagcaaca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> downstream primer Scr
<400> 2
tgcagcattc atcccttgtg 20
<210> 3
<211> 818
<212> DNA
<213> Artificial Sequence
<220>
<223> Membrane protein Gene sequence of amplified Citrus Reticulolium Retz pathogen (Spiroplama citri)
<400> 3
cacctgcaac tgtagcaaca gcaaacccaa aacaagttac aaacgctgaa attaaaacag 60
cgttagaagc taatgtttta aaagcagtgc aaggagttgt aaaaacagca acagcagctg 120
attttcaatt tgatgtttat caagacaacg aaggtacatc attaacaaca attaatttac 180
aaggaggtaa cgttgaagtt tatgttcaaa ttactccagc aaaagataaa actgttgtta 240
ttggtaaaac aggatacatt aaagtaactt taccaaaaat aaaagtagat atttcaagtg 300
tagtaataaa tcaacaaatt gtagaaatta aagcagcaga cccaaaacaa gttacaaaag 360
atgagttaaa tgcagttaat acttatgcaa ctcttgcaag tgctgtttta gaggctataa 420
aaaataaagc accaaatgca ggagcaagtg attttgaaat tacaaataat tgtgatgcgg 480
gaaactattc agaacaaaaa gatgttaaag taacagttaa agcaaaagat gaatcaccaa 540
acatttctgg tgaatttaaa gttaatgcaa aagtaaaagc tatattagca ccagcaaatg 600
caggataaga attaactttt tcttatttag aacaaaataa aaaacactta ttaaagtgtt 660
ttttatgttt tttagttaaa aaaatcttta caatcttaga atatcaacta aaattaatat 720
aaacaagata aaacaagcaa aagagaagga gaaaaagcat gcttaaaaaa attggaattt 780
taacatctgg tggtgattca caagggatga atgctgca 818
Claims (7)
1. A primer pair for specifically and rapidly detecting citrus rigidity disease pathogens is characterized in that the sequence of the primer pair is as follows:
an upstream primer Scf: 5'-CACCTGCAACTGTAGCAACA-3', respectively;
The downstream primer Scr: 5'-TGCAGCATTCATCCCTTGTG-3' are provided.
2. A kit for specific rapid detection of citrus rigidity pathogeny is characterized in that: comprising the primer pair of claim 1.
3. The application of the primer pair for specifically and rapidly detecting the citrus rigidity disease pathogen in the claim 1 in the detection of the citrus rigidity disease pathogen.
4. The application of the kit for specifically and rapidly detecting the pathogen of citrus rigidity disease in claim 2 in the detection of the pathogen of citrus rigidity disease.
5. A method for specifically and rapidly detecting citrus rigidity disease pathogens is characterized by comprising the following steps:
(1) extracting citrus genome DNA;
(2) carrying out PCR reaction by using the citrus genome DNA obtained in the step (1) as a template and using the primer pair of claim 1;
(3) carrying out agarose gel electrophoresis detection on the PCR reaction product obtained in the step (2); if the target band is amplified, the target band is positive, namely the disease is infected; if any band is not amplified, the result is negative, namely healthy.
6. The method for specifically and rapidly detecting the pathogen of citrus rigidity disease according to claim 5, wherein the method comprises the following steps:
the PCR reaction system comprises the following steps:
7. The method for specifically and rapidly detecting the pathogen of citrus rigidity disease according to claim 5, wherein the method comprises the following steps:
The PCR reaction conditions are as follows:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710197478.1A CN106834522B (en) | 2017-03-29 | 2017-03-29 | Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710197478.1A CN106834522B (en) | 2017-03-29 | 2017-03-29 | Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834522A CN106834522A (en) | 2017-06-13 |
| CN106834522B true CN106834522B (en) | 2019-12-13 |
Family
ID=59141165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710197478.1A Active CN106834522B (en) | 2017-03-29 | 2017-03-29 | Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834522B (en) |
-
2017
- 2017-03-29 CN CN201710197478.1A patent/CN106834522B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Detection of Spiroplasma citri from field samples using conventional PCR;Fallah,F.et al;《Detection of Spiroplasma citri from field samples using conventional PCR》;20160319 * |
| Improved Real-Time PCR Diagnosis of Citrus Stubborn Disease by Targeting Prophage Genes of Spiroplasma citri;Xuefeng Wang et al;《Plant Disease》;20140726;第99卷;第149-154页 * |
| Isolation and Identification of Spiroplasma citri Associated with Citrus Stubborn Disease in Egypt;Wessam H. Abd El-Fatah et al;《International Journal of Advanced Research in Biological Sciences》;20160131;第3卷(第9期);第223-231页 * |
| Novel Diagnosis for Citrus Stubborn Disease by Detection of a Spiroplasma citri-Secreted Protein;Jinxia Shi et al;《PHYTOPATHOLOGY》;20130801;第104卷(第2期);第188-195页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106834522A (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643925B (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| Nunan et al. | Characterization and molecular methods for detection of a novel spiroplasma pathogenic to Penaeus vannamei | |
| CN109554449B (en) | Multiplex PCR method capable of simultaneously detecting 7 virulence genes of aeromonas | |
| CN105420394A (en) | Primer pair, probe and kit for detecting bacterium MCR-1 gene | |
| CN102094080B (en) | Quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof | |
| CN103014152A (en) | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae | |
| CN112176080A (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN110669767B (en) | Pseudomonas syringae pea pathogenic nucleic acid aptamer and application thereof | |
| CN112210619A (en) | Primer pair for detecting Erjiangqi yeast and application thereof | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN106834522B (en) | Primer pair for specific rapid detection of citrus catalepsy pathogen, kit and application | |
| CN111321242A (en) | Rapid molecular detection method and application of rubber tree anthracnose pathogen Siamese anthrax | |
| CN108179207B (en) | PCR primer and method for identifying different subgroup cucurbita bacterial fruit blotch germs | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN103882109B (en) | The molecular detecting method of sugarcane toppers maize ear rot pathogenic bacteria microspecies gx1 | |
| CN109517911B (en) | Dual PCR detection primer and detection method for melon bacterial fruit blotch and leaf blotch | |
| WO2003068988A1 (en) | A method of pcr based detection and identification of rice blast fungus magnaporthe grisea | |
| CN105969907A (en) | Kit for detecting ST251-type virulent aeromonas hydrophila and application | |
| CN112746118B (en) | Dual PCR primer group and kit for detecting red rot of laver | |
| Minaeva et al. | First detection of fungus Fusarium coffeatum in the territory of the Russian Federation | |
| CN108359745A (en) | The dual RT-PCR method of synchronous detection wheat dwarf virus and Wheat Yellow strip virus | |
| CN109943652B (en) | Multiplex PCR kit and method for rapidly detecting pediococcus acidilactici by using same | |
| CN113430292A (en) | Primer group for detecting kiwi soft rot pathogen plasmodiophora viticola and application | |
| CN106222291B (en) | A kind of kit of Molecular Detection strain different with identification sugarcane red streak bacterium | |
| CN102628088B (en) | Polymerase chain reaction (PCR) detection method universal for viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |