CN106834516A - A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample - Google Patents
A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample Download PDFInfo
- Publication number
- CN106834516A CN106834516A CN201710178812.9A CN201710178812A CN106834516A CN 106834516 A CN106834516 A CN 106834516A CN 201710178812 A CN201710178812 A CN 201710178812A CN 106834516 A CN106834516 A CN 106834516A
- Authority
- CN
- China
- Prior art keywords
- pasteurella multocida
- sample
- primer
- kit
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer and probe combinations for detecting pasteurella multocida in environmental aerosols sample, it is characterised in that including forward primer, reverse primer and probe；As shown in SEQ ID NO.1, as shown in SEQ ID NO.2, probe sequence is as shown in SEQ ID NO.3 for reverse primer sequences for its forward primer sequence.The invention also discloses the kit for detecting aerosol sample pasteurella multocida.The present invention detects the content and its distribution situation of pasteurella multocida in aerosol sample using TaqMan real-time fluorescence quantitative PCRs, the forecast pathogenetic risk of Pasteurella, for the determination of the selection, access times and emphasis sterilising zone of place disinfecting reagent provides reference.
Description
Technical field
The present invention relates to technical field of microbial detection, and in particular to killing property bars in one kind detection environmental aerosols sample more
The kit and purposes of family name bacillus.
Background technology
Pasteurella multocida (Pasteurella mutocida, Pm) is to cause the leather of various livestock and poultry pasteurellosises blue
Family name negative pathogenic bacterium, typically parasitizes the upper respiratory tract of animal, with opportunistic, under the stimulation of some stressed conditions, and can
Cause animal carrier that bovine pasteurellosis or respiratory disease occur.With ox, pig, rabbit, more, the mountain of sheep morbidity in domestic animal
Sheep, deer, camel, horse, donkey, dog, cat and mink etc. also can infection morbidities.It is most susceptible with chicken, turkey and duck in birds, goose, dove time
It.Can be 5 serotypes (A, B, D, E, F) by Pm points according to the specificity of capsular antigen.In China, cause fowl and pig Pasteur
The main pathogen of bacillosis is pod membrane serum A type Pm, causes predominantly capsular serotype A type and the Type B Pm of ox, and capsular serotype A type is mainly showed
It is ox cellulosic apostematosa pneumonia, pod membrane Type B is mainly shown as ox hueppe's disease.Because Pm can be in of the same race or difference
Mutual phase transmission between animal is planted, it is serious to aquaculture harm.
Pasteurella multocida disease mainly by respiratory tract and transmission, ill domestic animal, sick fowl in plant's environment
Excreta, secretion and animal carrier arrange to environment pasteurella multocida, and bacterium floats in atmosphere, forms cause of disease gas molten
Glue, healthy animal can infection after respiratory tract suction pasteurella multocida aerosol.Due to Pasteurella cause of disease serotype
Complexity, it is various between there is no intersecting protective, this sick difficulty of vaccine prevention and control is larger, by periodic monitoring, with reference to disinfecting and
Bio-safety etc. can effectively prevent the generation of this disease.
The etiological diagnosis method of pasteurella multocida disease it is main it is germy be separately cultured, biochemical identification, animal return
Return experiment etc., but these methods are time-consuming, cumbersome, accuracy rate is low, the need for being not suitable for clinical quick diagnosis and monitoring, it is difficult to
Accomplish early warning and the examination of subclinical infection ox.
With environmental aerosols sample as monitoring object, can be with using sensitive, special and quick Real-Time PCR methods
Population surveillance is effectively carried out, and cattle farm disinfecting and bio-safety effect are estimated.But due to killing property Pasteur's bars more
The content of bacterium is very low in bacterium aerosol, and the sensitivity requirement to detection method is very high, in addition the collection phase of aerosol sample
To more difficult, therefore, there is not the correlation detected using TaqMan technologies for pasteurella multocida aerosol also at present
Report.
The content of the invention
For above-mentioned prior art, it is an object of the invention to provide killing property Pasteur in one kind detection environmental aerosols sample more
The kit and purposes of bacillus.
To achieve the above object, the present invention is adopted the following technical scheme that：
In a first aspect, the present invention provide a kind of primer for detecting pasteurella multocida in environmental aerosols sample and
Probe combinations, including forward primer, reverse primer and probe；Its forward primer sequence as shown in SEQ ID NO.1, reverse primer
As shown in SEQ ID NO.2, probe sequence is as shown in SEQ ID NO.3 for sequence.
Particular sequence is as follows：
Forward primer：5′-TTGGTGTGTTGAGCCAATCTG-3′；(SEQ ID NO.1)
Reverse primer：5′-GACAAGGAAATATAAACCGGCAAA-3′；(SEQ ID NO.2)
Probe：5′-(Cy5)TCCTTGACAACGGCGCAACTGATTG(BHQ-2)-3′(SEQ ID NO.3).
Second aspect, the present invention provides a kind of reagent for detecting pasteurella multocida in environmental aerosols sample
Box, includes above-mentioned primer and probe combinations in the kit.
Further, also include in the kit：Positive criteria plasmid, negative control and real-time fluorescence quantitative PCR
(qPCR) reagent.
The positive criteria plasmid is made up of the nucleotide fragments containing as shown in SEQIDNo.4 (241 bases)
PEASY-T3 recombinant plasmids are constituted；It is specific as follows：
5'-TTGGTGTGTTGAGCCAATCTGCTTCCTTGACAACGGCGCAACTGATTGGACGTTATTTATTACTCA
GCTTATTGTTATTTGCCGGTTTATATTTCCTTGTCAGTCTGATTTATCAATATTTCCATGTTGAGTTACGTTTCTTA
TGGCCATTATTGAAGCCATTAACGACAGAGCGGTTTAATTTATTTATCGTGTATTGGTTACCTATTTTGGTCTTTTC
TTCGTGTTCCAACGGTTTAAT-3'；(SEQ ID NO.4)
The negative control is pEASY-Y3 empty plasmid standard items.
Real-time fluorescence quantitative PCR (qPCR) reagent is existing conventional reagent in the prior art.
The third aspect, the present invention provides pasteurella multocida in a kind of detection environmental aerosols sample of non-diagnostic purpose
Method, step is as follows：
(1) environmental aerosols sample is gathered；
(2) genome DNA of aerosol sample is extracted；
(3) it is template with the genome DNA extracted, is expanded using above-mentioned kit, according to amplification system
Amplification curve to whether judging containing pasteurella multocida in environmental aerosols sample, amplification curve Ct value≤37.0
When, amplification curve then shows to contain the acid of pasteurella multocida disease protokaryon in aerosol sample into S type curves, and testing result is
It is positive；As amplification curve Ct value ＞ 37.0, amplification curve is straight line, then show not containing killing property in aerosol sample more
Pasteurella etiology nucleic acid, testing result is feminine gender.
In step (1), the method for gathering environmental aerosols sample is：The full glass precursor solution impact type adopted international standards is adopted
Sample device (all-glass-impinger, abbreviation AGI), with PBSs (pH7.0) of the 30mL containing 0.01% (V/V) bovine serum albumin(BSA)
It is sampling media, 30min is gathered according to the sampling flow of 12.5L/min, collects the aerosol sample in plant's environment.
In step (2), the method for extracting the genome DNA of aerosol sample is：The aerosol sample that will be collected exists
It is centrifuged at room temperature, abandons supernatant, using bacterial genomes DNA kits (commercially produced product, conventional reagent of the prior art
Box) extract STb gene.
In step (3), amplification reaction system is 20 μ L, including the μ L of 2 × Probe qPCR Mix 10, template 1 μ L, 10 μ
Each 0.8 μ L of forward primer and reverse primer of mol/L, μ L, the RNase Free ddH of probe 0.62O 6.8μL。
In step (3), the condition of amplified reaction is：95 DEG C of 30s of predegeneration, then 95 DEG C of denaturation 5s, 61 DEG C of annealing extend
30s carries out 45 circulations, and each circulation gathers fluorescence signal after terminating, and last 40 DEG C of 30s reactions terminate.
Beneficial effects of the present invention：
(1) for Prevention status in the prior art to pasteurella multocida and the analysis of harm, present invention selection is more
Sequences Design synthetic primer common to killing property Pasteurella Kmt1 genes, sets up TaqMan real-time fluorescence quantitative PCRs, can rest
Pasteurella multocida makes a distinction with other cause of diseases in growing an aerosol sample, and carries out killing property bars in plant's environment more
The epidemiology survey of family name's bacillosis, to varying environment region in plant, including animal feeding house, sports ground, milking parlour and
Delivery room etc. gathers aerosol sample, detects the content of pasteurella multocida using TaqMan real-time fluorescence quantitative PCRs and its divides
Cloth situation, forecasts the pathogenetic risk of Pasteurella, is selection, access times and the emphasis sterile zones of place disinfecting reagent
The determination in domain provides reference.
(2) kit of the invention can detect pasteurella multocida in plant's environmental aerosols, with simple and direct fast
Fast, sensitive special, cheap accurate and practical the advantages of.Can be in plant's environmental aerosols using the method for the present invention
The popular and subclinical infection of pasteurella multocida carry out population surveillance, be that the prevention and control of plant's pasteurella multocida disease are carried
It is the science of pasteurella multocida disease for technical support, it is also possible to carry out the epidemiology survey of pasteurella multocida disease
Prevention and control provide theory support.
(3) killing property Pasteur's bars in the TaqMan real-time fluorescence quantitative PCRs detection environmental aerosols sample that the present invention sets up more
Bacterium method, sensitivity technique is carried out by doubling dilution plasmid standard, and least concentration is 5.0 copy/reactions.With killing property more
Pasteurella, Mycoplasma bovis, haemolysis Mannheimia, Arcanobacterium pyogenes, sleep Histophilus, Klebsiella Pneumoniae, pneumonia chain
Genomic DNAs such as coccus, Mycoplasma mycoide subsp. Mycoides SC etc. are template, are expanded under the detection method set up, and are tied
Fruit shows that only pasteurella multocida has positive amplification, and the amplification of other bacterial strains is feminine gender, shows with other bacterial strains without intersecting
Reaction, with very strong specificity.
In 3 positive criteria products of various concentrations having been carried out batch detection and batch between detect, calculate variation within batch coefficient
And interassay coefficient of variation, in its batch error and batch between error be respectively less than 10%.Repeat to test the statistics of Ct values in batch and between criticizing
Analysis shows：Not notable (the P of difference between identical dilution factor standard plasmid Ct values>0.05).
The kit and purposes of pasteurella multocida, can both apply in detection environmental aerosols sample of the present invention
The detection of pasteurella multocida and identification in plant's environmental aerosols, it can also be used to clinical blood, serum, milk sample, nose
Swab, the detection of tissue equal samples and identification.The method of the present invention can be used for the direct detection of clinical sample in plant's environment,
Can also be used for the diagnosis of the non-diseases such as scientific research.
Brief description of the drawings
The Figure of description for constituting the part of the application is used for providing further understanding of the present application, and the application's shows
Meaning property embodiment and its illustrated for explaining the application, does not constitute the improper restriction to the application.
Fig. 1：TaqMan real-time fluorescence quantitative PCRs detect pasteurella multocida standard items amplification curve (quantitative fluorescent PCR
Instrument is automatically generated), utilizeThe Abs of Gene Scanning Software Version 1.5 in 480 II
Quant/2nd Derivative Max analytical models set up amplification kinetic curve, and curve 1-9 represents 5.0 × 10 in figure8-
5.0×100The amplification curve of the standard items of copy number/reaction, curve 10 is negative control, and each concentration sets 3 repetitions.
Fig. 2：TaqMan real-time fluorescence quantitative PCRs detect pasteurella multocida standard curve, utilize
The Abs Quant/2nd Derivative Max analysis moulds of Gene Scanning Software Version 1.5 in 480 II
Formula is analyzed, and sets up standard curve, as a result each point substantially point-blank, in figure, the standard concentration of each point from left to right according to
Secondary is 5.0 × 101-5.0×108Copy number/reaction.
Fig. 3：The agarose gel electrophoresis detection of Standard PCR detection pasteurella multocida sensitivity amplification, in figure, 1-9
Number swimming lane is respectively that template is 5.0 × 108-5.0×100The standard items of copy number/reaction, No. 10 swimming lanes are negative control.
Fig. 4：TaqMan real-time fluorescence quantitative PCRs detect pasteurella multocida specific amplification curve, wherein, curve 1
Template with 2 is respectively, A types pasteurella multocida and Type B pasteurella multocida DNA, is S type curves；Curve 3-9 points
It is not：Mycoplasma bovis, haemolysis Mannheimia, Arcanobacterium pyogenes, sleep Histophilus, Klebsiella Pneumoniae, streptococcus pneumonia,
Mycoplasma mycoide subsp. Mycoides SC is straight line, and amplified reaction is feminine gender；Curve 10 is negative control.
Specific embodiment
It is noted that described further below is all exemplary, it is intended to provide further instruction to the application.Unless another
Indicate, all technologies used herein and scientific terminology are with usual with the application person of an ordinary skill in the technical field
The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singulative
Be also intended to include plural form, additionally, it should be understood that, when in this manual use term "comprising" and/or " bag
Include " when, it indicates existing characteristics, step, operation, device, component and/or combinations thereof.
As background technology is introduced, also TaqMan is not used for pasteurella multocida aerosol in the prior art
The relevant report that technology is detected.Based on this, the present invention proposes killing property Pasteur in a kind of detection environmental aerosols sample more
The kit and purposes of bacillus.
In a kind of embodiment of the application, there is provided one kind is used to detect killing property Pasteur in environmental aerosols sample more
The primer and probe combinations of bacillus, including forward primer, reverse primer and probe；Its forward primer sequence such as SEQ ID NO.1
Shown, as shown in SEQ ID NO.2, probe sequence is as shown in SEQ ID NO.3 for reverse primer sequences.
Particular sequence is as follows：
Forward primer：5′-TTGGTGTGTTGAGCCAATCTG-3′；(SEQ ID NO.1)
Reverse primer：5′-GACAAGGAAATATAAACCGGCAAA-3′；(SEQ ID NO.2)
Probe：5′-(Cy5)TCCTTGACAACGGCGCAACTGATTG(BHQ-2)-3′(SEQ ID NO.3).
The difficult point of pasteurella multocida is mainly in detection environmental aerosols sample：
On the one hand, aerosol (aerosol) refers to that the solid that is suspended in gas and/or liquid particle are total to carrier gas
With the heterogeneous system of composition.Composition according to particulate can be divided into bioaerosol and chemical aerosols.In the body of aerosol
In system, having lived particulate and active particle and be discharged into by the body for having vital activity each in air
Plant plasmid and be referred to as bioaerosol, be also called microbial aerosol, be broadly divided into bacterial aerosol, Virus Aerosol and fungi
Aerosol etc., it is healthy closely related with the mankind and animal.Microfluidic aerosol is biological in by monitoring plant's environment, can be effective
The outbreak of epidemic of ground early warning and alert infectious disease.
But because the collection of aerosol sample is relatively difficult, and in aerosol bacterium content it is relatively low, if effectively inspection
Target bacteria in aerosol, the sensitivity requirement to detection method is very high.Therefore, it is many for pasteurella multocida at present
Detected using nose swab sample, be directed to single individuality, it is difficult to realize population surveillance.
On the other hand, pod membrane is one of the key component on pasteurella multocida surface, is also its important virulence factor
One of, highly important effect is played during pasteurella multocida is antiphagocytic.It is responsible in pasteurella multocida
The gene of pod membrane synthesis cluster in its genome is present, in all related genes formed with pasteurella multocida pod membrane
In, the gene such as hyaD, bcbD, dcbF, ecbJ, fcbD shows (2001) such as corresponding pod membrane type specificity, Townsend
Using the primers of these gene different locis, the parting for identifying pasteurella multocida capsular serotypes.
Lipopolysaccharides is another important composition composition on pasteurella multocida surface, be also its Major Virulence Factors it
One.Have been reported that the outer core in the type bacterial strain of pasteurella multocida Heddleston1,2,3,4,5,8,10,11,12,13,14 and 15
There is a highly conserved gene hptE in coding cluster, the gene is adjacent with fpg, the heptose based transferase coded by it
(HptE) it is required for the interconnection between pasteurella multocida LPS kernels polysaccharide and outer core polysaccharide.Due to killing more
Property Pasteurella LPS outer core coding cluster be located between two conservative gene priA and fpg, and difference Heddleston blood
Clear type bacterial strain outer core encodes the different in size of cluster, therefore can be based respectively on priA and HptE as starting and termination site design
Primer, realizes the diagnosis to Heddleston serotype pasteurella multocida.
Therefore, for pasteurella multocida, can have various as the species of the conservative gene of target sequence, but
It is different with the primer that different conservative gene regions is designed, it is different to the diagnosis of pasteurella multocida and the effect of detection.This
Apply being optimized screening to the target sequence of the pasteurella multocida for designing primer, as a result find, with Kmt1 bases
Because designing primer as target sequence, pasteurella multocida capsular serotype A, 5 serotypes of B, D, E and F can be simultaneously diagnosed, and
The specificity of detection and analysis can be improved.
The application devises multigroup different primer and probe in process of the test, and is respectively combined, it is reacted after
Its specificity and amplification efficiency are detected respectively, and optimal the primer of clinical detection and probe combinations are can be used for screen.Result is sent out
Existing, the specificity and sensitivity detected to pasteurella multocida with above-mentioned primer and probe combinations are optimal, and other
Primer and probe combinations can not then meet the sensitivity requirement of pasteurella multocida detection in aerosol.
In the another embodiment of the application, there is provided one kind is used to detect killing property bars in environmental aerosols sample more
The kit of family name bacillus, includes above-mentioned primer and probe combinations in the kit；Also include：Positive criteria plasmid, feminine gender are right
According to real-time fluorescence quantitative PCR (qPCR) reagent (commercially produced product, conventional kit of the prior art).
The application detects the content and its distribution situation of pasteurella multocida using TaqMan real-time fluorescence quantitative PCRs,
Forecast the pathogenetic risk of Pasteurella, be selection, access times and the emphasis sterilising zone of place disinfecting reagent really
It is fixed that reference is provided.
In order that obtaining those skilled in the art can clearly understand the technical scheme of the application, below with reference to tool
The embodiment of body describes the technical scheme of the application in detail.
480 II quantitative real time PCR Instruments (Roche Holding Ag), grads PCR instrument (TaKaRa companies), MS-I types
Multifunctional microbial sampler (Qingdao Zhongrui Intelligent Instrument Co., Ltd.).Bacterial genomes DNA extraction kit (catalog number (Cat.No.)：
DP302), Ago-Gel QIAquick Gel Extraction Kit (catalog number (Cat.No.)：) and high-purity plasmid is small carries middle amount kit (catalog number (Cat.No.) DP209：
DP107) purchased from day with biochemical technology (Beijing) Co., Ltd；PEASY-T3 support agents box is purchased from the full formula gold biotechnology in Beijing
Co., Ltd.Probe qPCR Mix kits (Code No.：RR391)、LA Taq(Code No.：RR02MA) it is purchased from treasured
Bioengineering (Dalian) Co., Ltd.Other biochemical reagents are import packing or domestic analysis is pure, unless otherwise specified,
Obtain from commercial channels.
Pasteurella multocida A types type strain (CVCC390), pasteurella multocida Type B type strain (CVCC391), silk
PG1 plants of shape mycoplasma thread subspecies SC types (MmmSC) are purchased from China Veterinery Drug Inspection Office, Mycoplasma bovis, haemolysis Mannheimia,
The common microbiological nucleic acid samples such as Arcanobacterium pyogenes, sleep Histophilus, Klebsiella Pneumoniae, streptococcus pneumonia are by this experiment
Room preserves；The positive aerosol DNA sample of pasteurella multocida is clinically diagnosed as by Shandong Normal University's ruminant disease
Sick research center preserves.
The test material that is not specifically described used is the conventional test material in this area in the embodiment of the present invention,
Can be commercially available by commercial channel.
Embodiment 1：The design of primer and probe
With reference to the specific Kmt1 genes of pasteurella multocida in GeneBank (GengBank No.AF016259), profit
With the Software for Design two of Primer Express 3.0 to specific primer and probe, particular sequence is shown in Table 1.It is first during design primer
First BLAST conservatives of design of primers region Kmt1 genes in Genebank data, and Pasteurella Multocida Strains
100% matching.Again to design upstream and downstream primer and probe carry out BLAST contrasts, as a result find not with other gene orders
Match, it is ensured that the specificity of primer sequence.By preliminary experiment screened a pair optimal primers (such as SEQ ID NO.1 and
Shown in SEQ ID NO.2) and probe (as shown in SEQ ID NO.3), by Hua Da gene chemical synthesis, it is contemplated that DNA amplification product
101bp。
The specific primer pair of the pasteurella multocida of table 1 and probe sequence
Embodiment 2：Detection environmental aerosols sample in pasteurella multocida method foundation and detection method it is sensitive
Property, specificity investigate
1st, the amplification of pasteurella multocida Kmt1 Gene Partials fragment
Using pasteurella multocida positive pathological material of disease DNA as template, using sense primer Pm-F：5'-
Shown in TTGGTGTGTTGAGCCAATCTG-3'(SEQ ID NO.1) and anti-sense primer Mb-241-R：5'-
ATTAAACCGTTGGAACACGAAGA-3' is expanded.Reaction system is 50 μ L：10×LA PCR Buffer II(Mg2+
Plus) 5 μ L, the μ L of 2.5mM dNTP Mixture 8, the μ L of LA Taq 0.5 (5U/ μ L), the μ L of template 2,10 μm of upstream and downstream of ol/L
Primer is respectively 1 μ L, sterilizing ultra-pure water 32.5 μ L.Response procedures are 94 DEG C of predegeneration 3min, subsequently into 94 DEG C of 30s, 58 DEG C
30s, 72 DEG C of 30s, carry out 32 circulations altogether；72 DEG C of extension 10min, finally stop at 4 DEG C.Agar gel is carried out to PCR primer
Electroresis appraisal, then carries out cutting glue purification according to the explanation of Ago-Gel QIAquick Gel Extraction Kit.
2nd, the preparation of plasmid standard
The purpose segment of recovery is cloned into pEAST-T3 carriers, recombinant plasmid send Hua Da gene sequencing, by sequencing result
Compare with the sequence in sequence table shown in SEQ ID NO.4, correct recombinant plasmid is named as pEAST-T3-Kmt1.With
Used as positive criteria product, it is 102ng/ μ L to determine its concentration with ultraviolet specrophotometer to the plasmid, is calculated according to the following equation
Per the DNA copy number in μ L plasmids, as a result copy number is 5.0 × 109Copy/μ L.
Plasmid copy Particle density (copies/ μ L)=plasmid concentration × (6.02 × 1023)/DNA base number × 2 × 324.5
(mean molecule quantity of base)
3rd, the foundation of the amplification condition of TaqMan real-time fluorescence quantitative PCRs
It is 0.1-1.0mol/L to set up upstream and downstream primer and probe final concentration gradient, to determine optimal primer and the spy of reaction
Pin concentration；Thermograde is set up for 59-62 DEG C, according to PCR amplifications, optimum annealing temperature is chosen.With Ct minimum values, fluorescence
Peak is standard, optimizes (following step 4 to annealing temperature, primer concentration, concentration and probe concentration, cycling condition respectively
In parameters be optimum results).
4th, the foundation of standard curve
Plasmid pEAST-T3-Kmt1 is carried out into doubling dilution to 5.0 × 10 by 10 times8-5.0×100Copy number/μ L, with every
One standard items (each concentration is parallel to do the repetition of 3 pipes) and sample to be tested are for template carries out TaqMan real-time fluorescence quantitative PCR expansions
Increase.Amplification reaction system is 20 μ L：2 × Probe qPCR Mix 10 μ L, plasmid pEAST-T3-Kmt1：1 μ L, concentration is 10 μ
Sense primer and anti-sense primer (as shown in SEQ ID NO.1,2) each 0.8 μ L of mol/L, concentration is 10 μm of Probe of ol/L
(as shown in SEQ ID NO.3) 0.6 μ L, RNase Free ddH2O 6.8μL.Negative control is set simultaneously, is expanded, select
The Cy5 passages for selecting 618-660nm wavelength absorb fluorescence signal, and response procedures are as follows：
Predegeneration：95 DEG C of 30s (4.4 DEG C/s of heating rate), 1cycle.
PCR：Analytical model：Quantitative analysis, 95 DEG C of 5s (4.4 DEG C/s of heating rate), 61 DEG C of 30s (2.2 DEG C of heating rate/
S, Acquisition Mode:Single), 45cycles.
Cooling：40 DEG C of 30s (2.2 DEG C/s of heating rate), 1cycle.
As shown in Figure 1, 2, according to the copy number of genes of interest in testing sample, detected plant's ring can just be derived
Concentration (the Copies/m of pasteurella multocida in the aerosol sample of border3air)。
5th, sensitivity detection
The TaqMan real time fluorescence quantifying PCR methods set up according to above-mentioned steps 4 carry out sensitivity experiment, as shown in figure 1,
Each amplification curve template is 5.0 × 108-5.0×100The standard items of copy number/reaction, curve 10 is negative control, minimum inspection
Survey is limited to 5.0 copies.The electrophoresis detection result of Standard PCR (primer is with quantitatively primer) is as shown in figure 3, minimum be observed that
5.0×101The electrophoretic band of the template amount of copy number/reaction, shows spirit of the TaqMan real-time fluorescence quantitative PCRs than regular-PCR
Quick property is high 10 times.
6th, specific detection
The TaqMan real time fluorescence quantifying PCR methods set up according to above-mentioned steps 4 carry out specific test, as a result such as Fig. 4
Shown, 1 and No. 2 curve is respectively that the amplification with A types pasteurella multocida and Type B pasteurella multocida DNA as template is bent
Line, 3-10 is respectively Mycoplasma bovis, haemolysis Mannheimia, Arcanobacterium pyogenes, sleep Histophilus, Klebsiella Pneumoniae, lung
Scorching streptococcus, Mycoplasma mycoide subsp. Mycoides SC and negative plasmid standard are template, do not have specificity fluorescent curve.Card
Primer amplification pasteurella multocida specificity designed by reality is good, with other bacterial strain no cross reactions.Therefore, step 4 Pm-
The TaqMan real-time fluorescence quantitative PCR detection methods that F, Pm-R and Pm-Probe set up can be used to identify whether unknown sample has many
The presence of killing property Pasteurella nucleic acid.
It should be noted that why pasteurella multocida detection method of the invention has sensitivity (test limit high
Up to 5 copies/reaction), the advantage such as high specificity, be, based on special target (Kmt1 genes) design primer, and primer to be carried out
Optimal screening and realize.The pasteurella multocida for pasteurella multocida classification diagnosis reported at present it is conservative
Gene order has multiple, but how selection target carries out the difficulty that design of primers is conceptual design from numerous conserved genetic sequences
Where point.
The application, using different conservative genes as targeting regions, devises multigroup primer in experimentation, but in inspection
Occurred during survey and be not so good as using Kmt1 genes as drone design with the cross reaction between other bacteriums, the specificity of detection
Primer.
The application multigroup primer and different probe sequence (such as in table 1 also using Kmt1 genes as drone design
Kmt1-R2), by the combination of different primer and probe, the sensitivity of detection is investigated, is as a result found, different primers and probe
Combination, the sensitivity difference of its detection is larger, with the detection of the primer shown in SEQ ID NO.1,2 and 3 and probe combinations spirit
Sensitivity is optimal, can be applied to the requirement of the trace detection for aerosol sample.
Embodiment 3：For the kit of pasteurella multocida detection
The composition of kit：Embodiment 1 design primer and probe combinations, positive criteria plasmid, negative control and in real time
Quantitative fluorescent PCR (qPCR) reagent (commercially produced product, conventional kit of the prior art)；
Positive criteria plasmid is made up of the nucleotide fragments containing as shown in SEQ ID No.4 (241 bases)
PEASY-T3 recombinant plasmids are constituted；It is specific as follows：
5'-TTGGTGTGTTGAGCCAATCTGCTTCCTTGACAACGGCGCAACTGATTGGACGTTA
TTTATTACTCAGCTTATTGTTATTTGCCGGTTTATATTTCCTTGTCAGTCTGATTTATCAATATTTCCATGTTGAGT
TACGTTTCTTATGGCCATTATTGAAGCCATTAACGACAGAGCGGTTTAATTTATTTATCGTGTATTGGTTACCTATT
TTGGTCTTTTCTTCGTGTTCCAACGGTTTAAT-3'；(SEQ ID NO.4)
The negative control is pEASY-Y3 empty plasmid standard items
Embodiment 4：The application of pasteurella multocida kit in detection aerosol sample
1st, the preparation of pasteurella multocida aerosol sample
In the varying environment of cattle farm (cow house, sports ground, milking parlour, delivery room etc.), using the micro- lifes of type air of MS- I
Thing sampling box, by the AGI samplers sample pasteurella multocida aerosol samples of international standard.Sampler placing height is
Away from ground 1.5m, PBSs (pH7.0) of the 30mL containing 0.01% (V/V) bovine serum albumin(BSA) is then injected into Proton samplers, together
When be added dropwise one drip olive oil.One end of Porton impact type flow straighteners is connected on main frame air intake, the other end is connected with rubber tube
It is connected on the gas outlet of Proton samplers.Sampling flow is 12.5L/min, and the sampling time is 30min.Sampling will be adopted after terminating
Collection liquid in sample device is collected into Cord blood after 50mL centrifuge tubes.
2nd, prepared by aerosol template DNA
Aerosol collection liquid 12000r/min is centrifuged 10min, supernatant is abandoned, using bacterial genomes DNA extraction kit
Prepare DNA profiling.With 30 μ L ddH2O dissolves template, and -20 DEG C of storages are standby.
3rd, TaqMan real-time fluorescence quantitative PCRs detection
Detected to picking up from the 10 of the dairy cow farm parts of aerosol sample DNA samples in Shandong Province 10, reaction system with
Reaction condition carries soft completion with the step 4 in embodiment 1, the collection of data and the generation of amplification curve by quantitative PCR instruments.
As shown in table 2, while above-mentioned sample is carried out into Standard PCR detection, (primer is Pm-236-F to result：5'-
TGGGCTTGTCGGTAGTCT-3', Pm-236-R：5'-CTGTCGTTAATGGCTTCA-3').
The pasteurella multocida testing result of the different samples of table 2
The above results illustrate that this method can delicately detect that the pasteurella multocida in the environmental aerosols of cattle farm is dense
Degree.
The preferred embodiment of the application is the foregoing is only, the application is not limited to, for the skill of this area
For art personnel, the application can have various modifications and variations.It is all within spirit herein and principle, made any repair
Change, equivalent, improvement etc., should be included within the protection domain of the application.
SEQUENCE LISTING
<110>Shandong Normal University
<120>A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample
<130> 2017
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
ttggtgtgtt gagccaatct g 21
<210> 2
<211> 24
<212> DNA
<213>Artificial sequence
<400> 2
gacaaggaaa tataaaccgg caaa 24
<210> 3
<211> 25
<212> DNA
<213>Artificial sequence
<400> 3
tccttgacaa cggcgcaact gattg 25
<210> 4
<211> 241
<212> DNA
<213>Artificial sequence
<400> 4
ttggtgtgtt gagccaatct gcttccttga caacggcgca actgattgga cgttatttat 60
tactcagctt attgttattt gccggtttat atttccttgt cagtctgatt tatcaatatt 120
tccatgttga gttacgtttc ttatggccat tattgaagcc attaacgaca gagcggttta 180
atttatttat cgtgtattgg ttacctattt tggtcttttc ttcgtgttcc aacggtttaa 240
t 241
Claims (10)
1. a kind of primer and probe combinations for detecting pasteurella multocida in environmental aerosols sample, it is characterised in that
Including forward primer, reverse primer and probe；Its forward primer sequence as shown in SEQ ID NO.1, reverse primer sequences such as SEQ
Shown in ID NO.2, probe sequence is as shown in SEQ ID NO.3.
2. the pasteurella multocida detection in environmental aerosols sample is prepared of the primer and probe combinations described in claim 1
Purposes in kit, chip and/or amplification reaction reagent.
3. it is a kind of detect environmental aerosols sample in pasteurella multocida kit, it is characterised in that the kit is included
Primer and probe combinations described in claim 1.
4. kit as claimed in claim 3, it is characterised in that also include in the kit：Positive criteria plasmid, feminine gender
Control and real-time fluorescence quantitative PCR (qPCR) reagent.
5. kit as claimed in claim 4, it is characterised in that the positive criteria plasmid is by containing such as SEQ ID No.4
The pEASY-T3 recombinant plasmids composition that shown nucleotide fragments are constituted.
6. kit as claimed in claim 3, it is characterised in that the negative control is pEASY-Y3 empty plasmid standards
Product.
7. in a kind of detection environmental aerosols sample of non-diagnostic purpose pasteurella multocida method, step is as follows：
(1) environmental aerosols sample is gathered；
(2) genome DNA of aerosol sample is extracted；
(3) it is template with the genome DNA extracted, is expanded using above-mentioned kit, according to the amplification of amplification system
Whether curve during amplification curve Ct value≤37.0, expands judging containing pasteurella multocida in environmental aerosols sample
Increase curve into S type curves, then show to contain the acid of pasteurella multocida disease protokaryon in aerosol sample, testing result is the positive；
As amplification curve Ct value ＞ 37.0, amplification curve is straight line, then show not containing killing property Pasteur in aerosol sample more
Coli pathogenic nucleic acid, testing result is feminine gender.
8. method as claimed in claim 7, it is characterised in that in step (1), the method for gathering environmental aerosols sample is：
The full glass precursor solution impact-actuated sampler adopted international standards, with PBSs of the 30mL containing 0.01% bovine serum albumin(BSA)
(pH7.0) it is sampling media, 30min is gathered according to the sampling flow of 12.5L/min, the gas collected in plant's environment is molten
Glue sample.
9. method as claimed in claim 7, it is characterised in that：In step (3), amplification reaction system is 20 μ L, including 2 ×
The μ L of Probe qPCR Mix 10, each μ L of 0.8 μ L, Probe 0.6 of forward primer and reverse primer of template 1 μ L, 10 μm of ol/L,
RNase Free ddH2O 6.8μL。
10. method as claimed in claim 7, it is characterised in that：In step (3), the condition of amplified reaction is：95 DEG C of predegeneration
30s, then 95 DEG C denaturation 5s, 61 DEG C annealing extend 30s carry out 45 circulation, each circulation terminate after gather fluorescence signal, most
40 DEG C of 30s reactions afterwards terminate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710178812.9A CN106834516A (en) | 2017-03-23 | 2017-03-23 | A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710178812.9A CN106834516A (en) | 2017-03-23 | 2017-03-23 | A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834516A true CN106834516A (en) | 2017-06-13 |
Family
ID=59130221
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710178812.9A Pending CN106834516A (en) | 2017-03-23 | 2017-03-23 | A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834516A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312733A (en) * | 2017-08-17 | 2017-11-03 | 天康生物股份有限公司 | Viable count detection method in serum A types, serum D type pasteurella multocida mixed culturing methods and gained mixed bacteria liquid |
| CN110885892A (en) * | 2019-11-01 | 2020-03-17 | 拱北海关技术中心 | Method for detecting pasteurella multocida, primers and probe thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981261A (en) * | 2014-05-06 | 2014-08-13 | 山东省农业科学院奶牛研究中心 | Method for detection and differential diagnosis of Brucella in aerosol |
| CN104774967A (en) * | 2015-05-07 | 2015-07-15 | 新疆天康畜牧生物技术股份有限公司 | Primers and detection method for pasteurella multocida real-time fluorescence quantification PCR method |
| CN106434935A (en) * | 2016-10-13 | 2017-02-22 | 中国动物疫病预防控制中心 | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis |
-
2017
- 2017-03-23 CN CN201710178812.9A patent/CN106834516A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981261A (en) * | 2014-05-06 | 2014-08-13 | 山东省农业科学院奶牛研究中心 | Method for detection and differential diagnosis of Brucella in aerosol |
| CN104774967A (en) * | 2015-05-07 | 2015-07-15 | 新疆天康畜牧生物技术股份有限公司 | Primers and detection method for pasteurella multocida real-time fluorescence quantification PCR method |
| CN106434935A (en) * | 2016-10-13 | 2017-02-22 | 中国动物疫病预防控制中心 | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis |
Non-Patent Citations (3)
| Title |
|---|
| KIRSTY M. TOWNSEND等: "Genetic Organization of Pasteurella multocida cap Loci and Development of a Multiplex Capsular PCR Typing System", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 林星宇等: "猪源荚膜血清F型多杀性巴氏杆菌的分离鉴定", 《中国兽医科学》 * |
| 赵静等: "青藏高原耗牛多杀性巴氏杆菌荧光定量RQ-PCR检测方法的建立", 《中国兽医杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312733A (en) * | 2017-08-17 | 2017-11-03 | 天康生物股份有限公司 | Viable count detection method in serum A types, serum D type pasteurella multocida mixed culturing methods and gained mixed bacteria liquid |
| CN110885892A (en) * | 2019-11-01 | 2020-03-17 | 拱北海关技术中心 | Method for detecting pasteurella multocida, primers and probe thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018489B (en) | Differentiate brucella street strain and vaccine strain A19 and S2 kit | |
| CN103981261B (en) | One detects and brucellar method in differential diagnosis aerosol | |
| Jung et al. | Comparison of pathogenic and non-pathogenic Enterococcus cecorum strains from different animal species | |
| CN106811541A (en) | Primer, probe and kit for field quick detection pasteurella multocida | |
| Reichel et al. | Description of a Coxiella burnetii abortion outbreak in a dairy goat herd, and associated serology, PCR and genotyping results | |
| CN106636012B (en) | One boar lid his virus stain, vaccine combination and its preparation method and application | |
| CN105002173A (en) | Kit for identifying Brucella S2 vaccine strain and wild strain | |
| Kock et al. | Detection and genetic characterization of lineage IV peste des petits ruminant virus in Kazakhstan | |
| CN105018628B (en) | Differentiate the kit of brucella A19 vaccine strains and street strain | |
| CN101168780A (en) | Zoonosis tuberculosis fluorescence PCR rapid diagnosis kit | |
| Eriksson et al. | Erysipelothrix rhusiopathiae contamination in the poultry house environment during erysipelas outbreaks in organic laying hen flocks | |
| Feberwee et al. | Identification and characterization of Dutch Avibacterium paragallinarum isolates and the implications for diagnostics | |
| CN106834516A (en) | A kind of kit and purposes for detecting pasteurella multocida in environmental aerosols sample | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| CN106929485A (en) | Pseudorabies virus genetic engineering gB recombinates attenuated vaccine strain and application | |
| CN113943714A (en) | Cat calicivirus strain and application thereof | |
| CN111394483B (en) | Kit and detection method for simultaneously detecting three fish-source streptococci | |
| CN103981260B (en) | A kind of method detecting Mycobacterium bovis and mycobacterium tuberculosis in aerosol | |
| Qoraa et al. | Phenotypic and Molecular Detection of Mycoplasma gallisepticum in Broiler and Layer Chickens in Some Egyptian Governorates | |
| CN102010896B (en) | Method for detecting pathogenic bacteria columnar flavobacterium of alepidote fish and detection kit | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN101575649A (en) | Quick detection technology for H9 type avian influenza virus | |
| CN100554436C (en) | A kind of multiple PCR reaction kit and detection method thereof | |
| WO2019238561A1 (en) | Method for early detection of a necrotic enteritis outbreak in an avian population | |
| CN106435015B (en) | A kind of LAMP kit of quick colour-developing one-step method detection pig parvoviral |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170613 |
|
| RJ01 | Rejection of invention patent application after publication |