CN106834495A - A kind of saline cistanche molecular identity card and rapid identification method - Google Patents
A kind of saline cistanche molecular identity card and rapid identification method Download PDFInfo
- Publication number
- CN106834495A CN106834495A CN201710123715.XA CN201710123715A CN106834495A CN 106834495 A CN106834495 A CN 106834495A CN 201710123715 A CN201710123715 A CN 201710123715A CN 106834495 A CN106834495 A CN 106834495A
- Authority
- CN
- China
- Prior art keywords
- saline cistanche
- molecular identity
- identity card
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the molecular identity card and rapid identification method of a kind of saline cistanche, the nucleotide sequence shown in SEQ ID No.1 is contained in the molecular identity card.Molecular identity card provided by the present invention and method accurately can distinguish the saline cistanche adulterant similar to morphological character, and method applicability provided by the present invention is wider, can detect all any samples of the saline cistanche that can extract DNA.Therefore, it is possible to realize saline cistanche crude drug, powder and quick, the precise Identification of mixed adulterant.
Description
Technical field
The invention belongs to Chinese medicine source cultivar identification technical field, and in particular to demonstrate,proved with a kind of molecular identity of saline cistanche
And rapid identification method.
Background technology
Saline cistanche (Cistanche deserticoLa Y.C.Ma) is the perennial obligate holoparasite of Orobanchaceae Cistanche deserticola
Herbaceous plant.The fleshy stem of its dry zone scale leaf is used as medicine, and is the distinctive rare medicinal herbs of soft science in China.Saline cistanche has kidney tonifying
Sun, benefiting essence-blood, the function of relaxing bowel, for the insufficiency of the kidney yang, blood and essence asthenia, impotence is infertile, and soreness and weakness of waist and knees, muscles and bones is powerless, intestines
Dry constipation.Tonified the kidney and support yang frequency of use highest Chinese medicine in prescription as the successive dynasties, Antisanility cistanche prescription utilization rate is only second to
Ginseng occupies second kidney-replenishing, is referred to as " desert ginseng ".Saline cistanche habitat is special, and breeding is difficult, limits throughput, adds long-term
Excessively excavation, its scarcity of resources has been listed in endangered species.The saline cistanche market price is expensive, therefore often has its sibling species and mix
Adulterant such as Cistanche tubulosa (Cistanche tubulosa), husky desert cistanche (Cistanche sinensis), halophilous herbage
(Cistanche salsa), broomrape (Orobanche coerulescens), cynomorium songaricum (Cynomorium songaricum) etc.
Certified products is taken as to sell.Because saline cistanche is similar to its sibling species, mixed adulterant form, therefore traditional form method is difficult identification.
Existing saline cistanche authentication method difficulty is big, popularization is poor, have specialty requirement higher to assessor.This is accomplished by a kind of fast
Speed, the method for stabilization are identified saline cistanche.
The content of the invention
It is an object of the invention to overcome drawbacks described above present in traditional authentication technique, there is provided a kind of result is accurately clever
It is quick, the simple and rapid saline cistanche authentication method of qualification process.
To achieve the above objectives, the present inventor is in the screening process of substantial amounts of sample, and searching out can be by
The special molecular identity card sequence of the certified products saline cistanche that certified products saline cistanche is accurately distinguished with mixed adulterant, and there is provided to meat desert
Rong differentiates more quick, easy, cheap method.
Technical solution of the present invention is as follows：
A kind of saline cistanche molecular identity card, the nucleotide sequence shown in SEQ ID No.1 is contained in the molecular identity card.
Alternatively, the molecular identity card is the nucleotide sequence shown in SEQ ID No.1.
The present invention also provides a kind of authentication method of saline cistanche, wherein, methods described is included in detection sample gene group DNA
With the presence or absence of molecular identity of the present invention card.
When there is the molecular identity card, saline cistanche is contained in identification testing sample.
Optionally, methods described comprises the following steps：
1) genomic DNA with testing sample demonstrate,proves the fragment of sequence as template containing saline cistanche molecular identity described in amplification；
2) amplified production is sequenced, guiding region is removed after splicing and obtains complete amplified fragments, detect amplified fragments
In with the presence or absence of the molecular identity card.
There is saline cistanche composition in can be determined that sample when there is the fragment shown in SEQ ID No.1 or be meat desert
Rong.If conversely, when both not existed the fragment shown in SEQ ID No.1, judging that sample is adulterant.
The amplification can be expanded with PCR.
The present invention is without particular limitation for amplification (PCR) primer for being used, if the molecular identity can be demonstrate,proved into
Row amplification, in order to obtain optimal identification result, the primer that amplification (PCR) is used is：RC2F 5’-
ATTCACACCAAGTATCGCAT-3 ' (nucleotide sequence shown in SEQ ID No.2), RC3R 5 '-
ATTGTAGTCTGGAGAAGCGTC-3 ' (nucleotide sequence shown in SEQ ID No.3).
Optionally, pcr amplification reaction program of the present invention is：
Above-mentioned " 1.5min+30s " refers to that 30s is added in each circulation.
Optionally, pcr amplification reaction system of the present invention is：PCR Buffer (10 ×) 2.5uL, Mg2+2uL
(25mmol/L), dNTPs mixtures 2uL (2.5mmol/L), each 1uL of primer (2.5umol/L), template DNA 2uL is (about
30ng), Taq archaeal dna polymerases 1.0U, plus sterilizing distilled water is to 25u L, enters performing PCR amplification.
Wherein, the testing sample includes saline cistanche and belongs to sibling species and pseudo- mixed product together.
The present invention also provides the kit for the primer of saline cistanche identification and containing the primer, and the primer is above-mentioned
Nucleotide sequence shown in SEQ ID No.2 and SEQ ID No.3.
Present invention additionally comprises above-mentioned molecular identity card or the above method or above-mentioned primer or mentioned reagent box in identification meat
Application in desert cistanche.
Testing sample form provided by the present invention can be former plant, medicinal material, seed, powder, medicine materical crude slice, Chinese patent drug etc..
Molecular identity provided by the present invention card and method can accurately by adulterant that saline cistanche is similar to morphological character
Distinguish, method applicability provided by the present invention is wider, all any samples of the saline cistanche that can extract DNA can be detected.
Therefore, it is possible to realize saline cistanche crude drug, powder and quick, the precise Identification of mixed adulterant.
Brief description of the drawings
Fig. 1 is align figures in the kind of saline cistanche.
Fig. 2 is the comparison chart of saline cistanche molecular identity card sequence and other species, comprising the nucleosides shown in SEQ ID No.1
The comparison chart of acid sequence.
Fig. 3 is the sequence B LAST result figures of saline cistanche molecular identity card.
Specific embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.It is unreceipted specific in embodiment
Technology or condition person, according to technology or condition described by document in the art, or are carried out according to product description.It is used
Reagent or the unreceipted production firm person of instrument, are the conventional products that can be commercially available by regular distributor.
The authentication method of the saline cistanche medicinal raw material of embodiment 1
1) saline cistanche and its 37 parts of mixed adulterant (being shown in Table 1) are collected from different sources, 25mg medicinal materials is taken respectively in MM400 ball millings
It is ground on instrument (German Retsch), is carried with the plant genome DNA kit of TIANGEN Biotech (Beijing) Co., Ltd.
Take STb gene.
The Cistanche deserticola sample of table 1
2) PCR amplifications
Primer sequence is the-ATTCACACCAAGTATCGCAT-3 ' of RC2F 5 '；T RC3R 5’-
ATTGTAGTCTGGAGAAGCGTC-3 ', is synthesized by Shanghai Major Biological Medical Technology Co., Ltd. (Beijing).
PCR amplification programs are：
Above-mentioned PCR reaction systems are：
PCR Buffer (10 ×) 2.5u L, Mg2+2u L (25mmol/L), dNTPs mixture 2u L (2.5mmol/L),
Each 1u L (2.5umol/L) of primer, template DNA 2u L (about 30ng), Taq archaeal dna polymerase 1.0U, plus sterilizing distilled water is extremely
25u L, enter performing PCR amplification.
3) agarose gel electrophoresis
The pcr amplification product of 3u L is taken respectively, electrophoresis is carried out with 1% Ago-Gel, in gel imaging instrument after electrophoresis
Upper testing result.
4) it is sequenced
PCR primer is directly sent to Shanghai Major Biological Medical Technology Co., Ltd. (Beijing) sequencing.Sequencing primer draws with PCR
Thing.To ensure sequence reliability, square two-way sequencing is carried out.
5) sequence assembly
The present embodiment application software CodonCode Aligner 3.7.1 (CodonCode Co., Germany) carry out sequence
Row splicing and check and correction.First, sequence quality assessment and pretreatment are carried out, that is, removes sequencing result two ends address two parts, and it is right
Remainder carries out quality evaluation.Held to 3 ' from sequence 5 ' respectively with the window of 20bp and held into line slip, if had in window many
20 are less than in 2 Q values of base, then delete a base, window continues to slide, if number of the base Q values less than 20 in window
Mesh is less than or equal to 2, and window stops sliding.By 3, ' end repeats this and operates.Forward and reverse sequence after shearing should be greater than
100bp, forward and reverse sequence low quality base number is less than 1%, and the sequence after shearing is less than original series length 50%, average Q value
More than or equal to 30.Positive and negative sequencing result is spliced, forward and reverse sequence is had more than 50% overlay region.
6) sequence alignment
With the softwares of MEGA 5 to sequencing and spliced each sample compare, as shown in Fig. 2 all saline cistanche samples
ITS2 sequences include GTCCCTTTAGGGTGATACTTAG (SEQ ID NO.1), and other species (Cistanche tubulosas
(Cistanche tubulosa), husky desert cistanche (Cistanche sinensis), halophilous herbage (Cistanche salsa),
Broomrape (Orobanche coerulescens), cynomorium songaricum (Cynomorium songaricum)) do not include this sequence (SEQ ID
NO.1), show that this section of sequence (SEQ ID NO.1) can the specific identification for saline cistanche.Fig. 1 show saline cistanche ITS2
Align results in sequence kind, show saline cistanche without intraspecific variablity.
Demonstrate,proving sequence (SEQ ID NO.1) to molecular identity carries out BLAST, as a result finds that the sequence of similarity 100% is
Saline cistanche (Fig. 3).
The authentication method of the desertliving cistanche sheet of embodiment 2
Using method substantially the same manner as Example 1, except that with desertliving cistanche sheet as sample, extracting DNA, carry out
Identification, as a result same Fig. 2, shows specific can also detect above-mentioned molecular identity card (SEQ ID NO.1).Can realize
Identification to desertliving cistanche sheet.
The identification of the saline cistanche powder of embodiment 3
Using method substantially the same manner as Example 1, except that with saline cistanche powder as sample, extracting DNA, carry out
Identification, as a result same Fig. 2, shows specific can also detect above-mentioned molecular identity card (SEQ ID NO.1).Can realize
Identification to saline cistanche powder.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>China Medical Sciences Academy Medical Plants Institute
<120>A kind of saline cistanche molecular identity card and rapid identification method
<130> KHP171110593.8
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Saline cistanche
<400> 1
gtccctttag ggtgatactt ag 22
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
attcacacca agtatcgcat 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
attgtagtct ggagaagcgt c 21
Claims (10)
1. saline cistanche molecular identity is demonstrate,proved, it is characterised in that contain the nucleotides shown in SEQ ID No.1 in the molecular identity card
Sequence.
2. molecular identity according to claim 1 is demonstrate,proved, it is characterised in that the molecular identity card is SEQ ID No.1 institutes
The nucleotide sequence for showing.
3. a kind of authentication method of saline cistanche, it is characterised in that methods described includes whether there is in detection sample gene group DNA
Molecular identity card described in claim 1 or 2.
4. authentication method according to claim 3, it is characterised in that methods described comprises the following steps：
1) genomic DNA with testing sample demonstrate,proves the fragment of sequence as template containing saline cistanche molecular identity described in PCR amplifications；
2) amplified production is sequenced, guiding region is removed after splicing and obtains complete amplified fragments, be in detection amplified fragments
It is no to there is the molecular identity card.
5. authentication method according to claim 4, it is characterised in that the used primer of amplification is：SEQ ID No.2 and
Nucleotide sequence shown in SEQ ID No.3.
6. the authentication method according to claim 4 or 5, it is characterised in that the pcr amplification reaction program is：
7. authentication method according to claim 6, it is characterised in that the pcr amplification reaction system is：PCR 10×
The Mg of Buffer 2.5uL, 25mmol/L2+Each 1uL of primer of dNTPs the mixtures 2uL, 2.5umol/L of 2uL, 2.5mmol/L,
Template DNA 2uL, Taq archaeal dna polymerase 1.0U, plus sterilizing distilled water is to 25u L, enters performing PCR amplification.
8. the primer of saline cistanche identification is used for, and it is the nucleotide sequence shown in SEQ ID No.2 and SEQ ID No.3.
9. the kit of primer described in claim 8 is contained.
10. the molecular identity card described in claim 1 or 2, or the authentication method described in claim any one of 3-7, or right
It is required that the primer described in 8, or application of the kit described in claim 9 in saline cistanche is identified.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710123715.XA CN106834495A (en) | 2017-03-03 | 2017-03-03 | A kind of saline cistanche molecular identity card and rapid identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710123715.XA CN106834495A (en) | 2017-03-03 | 2017-03-03 | A kind of saline cistanche molecular identity card and rapid identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834495A true CN106834495A (en) | 2017-06-13 |
Family
ID=59138049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710123715.XA Pending CN106834495A (en) | 2017-03-03 | 2017-03-03 | A kind of saline cistanche molecular identity card and rapid identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834495A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330165A (en) * | 2017-09-06 | 2018-07-27 | 中央民族大学 | Detect LAMP primer composition object, kit, method and the purposes of Chinese medicine Herba Cistanches |
| CN109439784A (en) * | 2018-09-27 | 2019-03-08 | 中国医学科学院药用植物研究所 | The identification method of Herba Cistanches host plant |
| CN118497409A (en) * | 2024-07-18 | 2024-08-16 | 成都海关技术中心 | Primer composition, method and kit for identifying rare cistanche deserticola and mixed and fake products thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104830970A (en) * | 2015-03-17 | 2015-08-12 | 中国医学科学院药用植物研究所 | Molecular ID and identification method of cordyceps sinensis |
-
2017
- 2017-03-03 CN CN201710123715.XA patent/CN106834495A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104830970A (en) * | 2015-03-17 | 2015-08-12 | 中国医学科学院药用植物研究所 | Molecular ID and identification method of cordyceps sinensis |
Non-Patent Citations (2)
| Title |
|---|
| ISABELLE MEUSNIER ET AL: "A universal DNA mini-barcode for biodiversity analysis", 《BMC GENOMICS》 * |
| ZHIYING SUN ET AL: ""Molecular identification of Cistanches Herba and its adulterants based on nrITS2 sequence", 《JOURNAL OF MEDICINAL PLANTS RESEARCH》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330165A (en) * | 2017-09-06 | 2018-07-27 | 中央民族大学 | Detect LAMP primer composition object, kit, method and the purposes of Chinese medicine Herba Cistanches |
| CN108330165B (en) * | 2017-09-06 | 2021-10-01 | 中央民族大学 | LAMP primer composition, kit, method and application for detecting traditional Chinese medicine cistanche |
| CN109439784A (en) * | 2018-09-27 | 2019-03-08 | 中国医学科学院药用植物研究所 | The identification method of Herba Cistanches host plant |
| CN118497409A (en) * | 2024-07-18 | 2024-08-16 | 成都海关技术中心 | Primer composition, method and kit for identifying rare cistanche deserticola and mixed and fake products thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106591459A (en) | SNP (Single Nucleotide Polymorphism) marker, kit and method for rapidly identifying panax traditional Chinese medicines including panax stipuleanatus and panax quinquefolius | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN102888456A (en) | Method for quickly identifying pseudo-ginseng | |
| Gallardo et al. | A multi gene-approach genotyping method identifies 24 genetic clusters within the genotype II-European African swine fever viruses circulating from 2007 to 2022 | |
| CN109371141A (en) | Identify the method and specific primer pair of Atlantic salmon and rainbow trout | |
| Lin et al. | Genetic identification of edible birds’ nest based on mitochondrial DNA sequences | |
| Song et al. | Effects of sampling techniques and sites on rumen microbiome and fermentation parameters in Hanwoo steers | |
| CN104830970A (en) | Molecular ID and identification method of cordyceps sinensis | |
| CN104830969B (en) | A kind of pseudo-ginseng molecular identity card and authentication method | |
| Godoy-Vitorino et al. | Differences in crop bacterial community structure between hoatzins from different geographical locations | |
| CN106834495A (en) | A kind of saline cistanche molecular identity card and rapid identification method | |
| Ramos et al. | Phylogeography of msp4 genotypes of Anaplasma marginale in beef cattle from the Brazilian Pantanal | |
| Thum | Using 18S rDNA to resolve diaptomid copepod (Copepoda: Calanoida: Diaptomidae) phylogeny: an example with the North American genera | |
| CN103555847A (en) | Method for paternity identification of tilapia mossambica | |
| CN107365839B (en) | Primer for identifying deer animals and application thereof | |
| CN105567799A (en) | Molecular identification card for radix angelicae sinensis and method for authenticating same | |
| Cook et al. | Polymerase chain reaction-based identity assay for pathogenic turkey Eimeria | |
| CN102649958B (en) | Genetic marker related to growth rate of pig and application of genetic marker | |
| CN106995847A (en) | The authentication method of the husky desert cistanche of doping in a kind of saline cistanche product | |
| Rohwer et al. | Incongruence of morphological determinations and DNA barcode sequences: a case study in Cinnamomum (Lauraceae) | |
| Vilanova-Cuevas et al. | Design and validation of a PCR protocol to specifically detect the clade of Philaster sp. associated with Diadema antillarum scuticociliatosis | |
| CN105969907A (en) | Kit for detecting ST251-type virulent aeromonas hydrophila and application | |
| CN104263821B (en) | Old animal specimen Species estimation test kit and preparation method | |
| CN107619878A (en) | A kind of fruit of Chinese magnoliavine molecular identity card and authentication method | |
| Yanjin et al. | Detection of Salmonidae ingredient using mini-DNA barcoding in conjunction with a rapid visual inspection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170613 |