CN106834487A - The external detection method of the mutation of rapid screening P53 gene extrons 58 and application - Google Patents
The external detection method of the mutation of rapid screening P53 gene extrons 58 and application Download PDFInfo
- Publication number
- CN106834487A CN106834487A CN201710116035.5A CN201710116035A CN106834487A CN 106834487 A CN106834487 A CN 106834487A CN 201710116035 A CN201710116035 A CN 201710116035A CN 106834487 A CN106834487 A CN 106834487A
- Authority
- CN
- China
- Prior art keywords
- seq
- extrons
- gene
- detection method
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of external detection method of the mutation of rapid screening P53 gene extrons 58, comprises the following steps：(1) peripheral blood sample genomic DNA is extracted；(2) design synthesis is used to expand the specific primer totally 4 pairs of P53 gene extrons 58；(3) carry out high-resolution melting curve analysis using above-mentioned primer pair sample gene group DNA and combine to bottom out PCR；(4) sample of positive findings is obtained in tracing analysis, that is, P53 gene mutations occurs.Detection method of the invention is not limited to by mutating alkali yl site with type, and without sequence-specific probes, directly operation high-resolution melts after PCR terminates, you can the analysis of complete paired samples mutation.Easy to operate quick, use cost is low, as a result accurately, can realize real stopped pipe operation.Be directed to crowd's rapid screening simultaneously, with high flux, speed it is fast, can kit, the low feature of testing cost.
Description
Technical field
The present invention relates to gene tester.More particularly, to a kind of body of rapid screening P53 gene extrons 5-8 mutation
Outer detection method and its application.
Background technology
In recent years, the incidence and case fatality rate of China's malignant tumour are in obvious ascendant trend, have leapt to China's death
The first place of the cause of disease.However, early detection, early diagnosis and preventing and treating for malignant tumour, there is no breakthrough Journal of Sex Research, part is suffered from
Person has been in middle and advanced stage when medical, and curative effect is poor.Therefore, the early diagnosis level of malignant tumour is improved, is to improve malignant tumour
Effective outlet of diagnosis and treatment curative effect.At present clinically, more using swollen in the method monitoring serum of Serologic detection or other body fluid
Tumor markers, presence, generation development and prognosis dynamically to tumour are judged.However, any Scientific Indicators are not
It is absolute.The organ specificity and tumour-specific of tumor markers are poor, have both been present in tumour and have existed in normal person
In group and non-tumor patient blood and body fluid, everyone has respective foundation level for tumor markers, can not be only according to super
Cross term of reference and diagnosed.Sometimes could be improved by related auxiliary examination, after being carefully analyzed to testing result
The practical value of presence, development and prognosis to tumour.Meanwhile, the several factors that tumor markers concentration can be metabolized in vivo
Influence, so accuracy can also be affected.By taking tumor marker alpha-fetoprotein (AFP) as an example, except most hepatocarcinoma patients
Serum be positive outer, also 31%~52% oxyhepatitis, 15%~58% chronic hepatitis and 11%~47%
The AFP of patient with liver cirrhosis also has and is substantially increased, therefore need not be once seeing " positive " " discoloration ".Certainly, at the same time, first tire
The patient that protein negative feels uneasy can not adopt a casual attitude, will also be by doctor's joint multiple inspection until cytology, pathology
Inspection etc. is done and further check and verify and differentiate.
Gene is the DNA fragmentation with hereditary effect, supports essential structure and the performance of life.Although gene is very steady
It is fixed, oneself can be accurately replicated in cell division, but this stability is relative.Gene can also under certain conditions
It is exactly on a site, one to be occurred in that suddenly from original existence form suddenly change into another new existence form
New gene, instead of original gene, and this gene is called mutator.Either base substitution mutation or frameshift mutation, all
The amino acid in polypeptide chain can be made to constitute or sequentially change, and then influence the biological function of protein or enzyme, make body
Phenotype occurs abnormal.Therefore, the mutation to gene is detected, can be detected in the pathogenetic early stage of disease, favorably
In the early discovery for realizing disease, early diagnosis, early treatment.
HRM (high-resolution melting curve analysis) is that the one kind risen abroad in recent years is used to be mutated scanning and gene
The newest genetic analysis method of parting.It is a kind of round pcr of Efficient robust, not by mutating alkali yl site and type office
Limit, without sequence-specific probes, directly operation high-resolution melts after PCR terminates, you can the analysis of complete paired samples mutation.
Easy to operate quick, use cost is low, as a result accurately, can realize real stopped pipe operation.Compared with having for common technology
More preferable sensitivity and specificity.The detection of the mutation for carrying out in this way does not rely on position of the mutation where in fragment
Put.When the size of fragment is in 400bp or more hour, sensitivity highest.Come for current most of mutation analysis method
Say, be all difficult to identify homozygote series jump.In some different types of small amplified fragments, high-resolution melting curve
The ability of identification homozygote series jump is then shown, this method can identify most homozygous mutation.Blemish in an otherwise perfect thing
Be carry out unknown mutation examination, scanning when, be only able to detect and whether there is mutation, it is impossible to it is determined that be mutated in DNA fragmentation position.
It is a kind of special technique to bottom out PCR (Touch down (TD) PCR), it is only necessary to do once formal experiment, it is possible to ensure this time
Even if amplification experiment be not also most preferably to be carried out under conditions of more satisfactory, can be managed in most cases
The expanding effect thought.
The content of the invention
Technical purpose of the invention is to provide a kind of external detection method of rapid screening P53 gene extrons 5-8 mutation,
It is not limited to by mutating alkali yl site with type, and without sequence-specific probes, directly operation high-resolution melts after PCR terminates
Solution, you can the analysis of complete paired samples mutation.Easy to operate quick, use cost is low, as a result accurately, can realize real closing
Pipe is operated.Be directed to crowd's rapid screening simultaneously, with high flux, speed it is fast, can kit, the low feature of testing cost.
A kind of external detection method of rapid screening P53 gene extrons 5-8 mutation, comprises the following steps：
(1) peripheral blood sample genomic DNA is extracted；
(2) design synthesis is used to expand the specific primer totally 4 pairs of P53 gene extrons 5-8；
(3) carry out high-resolution melting curve analysis using above-mentioned primer pair sample gene group DNA and combine to bottom out PCR, 95
DEG C predegeneration 10min, 60 DEG C of 15s, 72 DEG C of 15s, 95 DEG C of 10s, 50 circulations；95 DEG C of 1min, 40 DEG C of 1min, since 65 DEG C,
Melting curve is gathered with 0.02 DEG C of slope per second, to 95 DEG C, 40 DEG C of 10s terminate afterwards, with analysis software to the song after collection
Line is analyzed；
(4) HRM tracing analysis：Single peak such as is occurred in that relative to negative control, is then positive findings, show occur
P53 gene mutations.For example in accompanying drawing 1, Fig. 2, Fig. 3 shown in arrow, there is a single peak relative to negative control, be positive
As a result, may indicate that there is P53 gene mutations.
Specific primer in the step (2), is directed to the P53 gene extrons specially designed primers of 5-8, by anti-
Multiple experiment sieving and checking, final screening are obtained, and have the advantages that high specificity, amplification efficiency are high, preferred nucleotide sequence
It is respectively：
The reaction system of PCR is preferably in the step (3)：Cumulative volume is that the reaction system of 15 μ L is included：master
mix 10μL；MgCl22.4μL；GC enhancer 0.5μL；The μ L of forward primer 1；The μ L of reverse primer 1, remaining is RNase
free H2O。
During reaction, carry out bottoming out PCR to sample gene group DNA, negative control, blank is added in the reaction system
Reaction, wherein negative control is P53 wild-type sequences, and blank is without DNA profiling.
Detection method of the invention, also one obvious technical characteristic is that peripheral blood sample is used in the step (1)
Dried blood spot is collected.Only need to the peripheral blood of 0.5mL, for person to be checked, with can transport for long-distance, the holding time is long,
The advantages of taking a blood sample simple, is a great improvement in technique of gene detection.Sample gene group DNA is carried in step (1) simultaneously
Taking can be extracted using commercial kit.Operation is simple, is also convenient for being used when high flux is detected.
Detection method of the invention can be used for rapid screening P53 gene extrons 5-8 mutation.Combined using HRM and bottom out PCR
Method, can realize under same experiment condition, it is many to P53 genes in the DNA that the crowd to be checked for obtaining is extracted in dried blood spot
The mutation of individual extron is detected.Experiment display, is carried out by P53 gene 5-8 extrons in 200 Subject Population's blood
Detection, in can successfully be detected 3 person under inspection's blood DNAs there is mutation in P53 genes, afterwards with generation PCR sequencing PCR to PCR
Product is detected and is confirmed after comparing with human genomic sequence that this 3 samples are implicitly present in changing on DNA sequence dna
Become.Demonstrate the correctness of the inventive method.
Detection method of the invention can be applied in any one rapid screening P53 gene mutation detection kits.It is excellent
Choosing includes the specific primer totally 4 pairs for expanding P53 gene extrons 5-8, and its nucleotide sequence difference is as shown above.
Detection kit also contains PCR reagent, negative control, blank, and wherein negative control is P53 wild type sequences
Row, blank is without DNA profiling.
Kit of the invention has the following advantages that：(1) PCR that whole primers can be stablized at the same temperature is anti-
Should, obtain specific P53 genetic fragments；(2) detection sensitivity is high, high specificity；(3) small reaction system (15 μ L), sample
It is few with reagent dosage；(4) it is peripheral blood dried blood spot to use detection sample, and collection is easy, and the holding time is long, and transport is easy；(5) it is anti-
Should be simple, convenient and rapid, experimental result can be obtained within 2 hours, it is easy to large sample high flux to process；(6) reagent is cheap, low cost.
Brief description of the drawings
Fig. 1 is No. 68 HRM solubility curve figure of sample in embodiment 2；
Fig. 2 is No. 105 HRM solubility curve figure of sample in embodiment 2；
Fig. 3 is No. 160 HRM solubility curve figure of sample in embodiment 2；
Fig. 4 is No. 68 sequencing result figure of sample in embodiment 2；
Fig. 5 is No. 105 sequencing result figure of sample in embodiment 2；
Fig. 6 is No. 160 sequencing result figure of sample in embodiment 2；
Fig. 7 is the HRM solubility curve figures of negative sample in embodiment 2.
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as limiting the invention.Without departing substantially from
In the case of spirit of the invention and essence, the modification or replacement made to the inventive method, step or condition belong to the present invention
Scope.
If not specializing, the conventional meanses that technological means used is well known to those skilled in the art in embodiment.
Embodiment 1
A kind of external detection method of rapid screening P53 gene extrons 5-8 mutation, comprises the following steps：
(1) extraction of dried blood spot DNA
Genome DNA extraction is carried out according to dry blood cake genome DNA extracting reagent kit (Tiangeng) specification of paramagnetic particle method, as follows：
1st, one piece of 96 new hole depth orifice plate is taken, then three dried blood spot samples of 3*3mm is added in every hole.In 96 deep-well plates
The buffer solution GA of 200 μ L of middle addition.
2nd, 20 μ L Proteinase K Solutions are added, after the concussion that is vortexed is mixed for 10 seconds, the constant temperature oscillator for being preheated to 56 degree is put into
In, 900rpm isothermal vibrations are cracked 30 minutes.
3rd, during previous step sample dissociation, to being added in 96 new hole depth orifice plates, 10 μ L bead suspensions G, 200 μ L are slow
Fliud flushing GB and 200 μ L absolute ethyl alcohols, lash mixing or concussion is mixed 10 seconds.
4th, after sample dissociation, by the step 3 of short duration centrifugation of medium-length hole plate, refrigerator lysate is completely moved to the deep hole in step 4
Plate, then puts it into constant temperature oscillator, and room temperature 900rpm shakes 3 minutes.
5th, deep-well plates are positioned on magnetic frame and stand 1 minute, carefully liquid is removed when magnetic bead is adsorbed completely.
6th, deep-well plates are positioned on magnetic frame and stand 1 minute, carefully liquid is removed when magnetic bead is adsorbed completely.
7th, deep-well plates are removed from magnetic frame, adds 500 μ L buffer solution GD, lashed mixing or concussion is mixed.
8th, deep-well plates are positioned on magnetic frame and stand 1 minute, carefully liquid is removed when magnetic bead is adsorbed completely.
9th, deep-well plates are removed from magnetic frame, adds 500 μ L rinsing liquid PW, lashed mixing or vibration is mixed 3 minutes.
10th, deep-well plates are positioned on magnetic frame and stand 1 minute, band magnetic bead carefully removes liquid when adsorbing completely, makes magnetic
Pearl continues adsorbed.
11st, 750 μ L rinsing liquid PWIII are slowly added to, try not to have rushed magnetic bead, carefully gone with pipettor after standing 20 seconds
Except liquid, deep-well plates are removed.
12nd, 50-100 μ L elution buffers TB or deionized water are added, mixing is lashed or vibration is mixed, be placed in 56 degree, incubated
Educate 5-10 minutes.
13rd, deep-well plates are positioned on magnetic frame and stand 2 minutes, carefully shift DNA solution when magnetic bead is adsorbed completely
To collecting board, and preserved in felicity condition.
(2) high-resolution melting curve analysis are combined and bottom out PCR
The specific primer of the P53 gene extrons 5-8 of high-resolution melting curve analysis amounts to 4 pairs, sequence such as following table
It is shown：
| The forward primer of P53 extrons 5 | TTACTCTTCAAGCTGTCCTC | As shown in SEQ ID No.1 |
| The reverse primer of P53 extrons 5 | CTTATGGTCATTATTACTTT | As shown in SEQ ID No.2 |
| P53 exon 6 forward primers | TACTGGAAGTTATTCGATCT | As shown in SEQ ID No.3 |
| P53 exon 6 reverse primers | TGTTTACCACTAGATCTCTG | As shown in SEQ ID No.4 |
| P53 exon 7 forward primers | GTACTAATTCCTAGGTGGGC | As shown in SEQ ID No.5 |
| P53 exon 7 reverse primers | CTTGTCGATCCTGACCTGTA | As shown in SEQ ID No.6 |
| The forward primer of P53 extrons 8 | TGTATCCTGAGTATTGGTCT | As shown in SEQ ID No.7 |
| The reverse primer of P53 extrons 8 | ATCTGCTTGCGGCTCTCGCT | As shown in SEQ ID No.8 |
Prepare the PCR reaction systems that cumulative volume is 15 μ L；
System is included：master mix 10μL；MgCl22.4μL；GC enhancer 0.5μL；The μ L of primers F 1；Primer
The μ L of R 1, remaining is RNase free H2O。
The reaction system that will be prepared is added in 96 orifice plates, afterwards according to Loading sequence, takes 5 μ L samples, negative control, blank
Control is sequentially added in respective aperture, and in 96 orifice plate upper sealing films, vibration is mixed, of short duration centrifugation afterwards.
High-resolution melting curve analysis are combined and bottom out PCR reaction conditions：95 DEG C of predegenerations 10min, 60 DEG C of 15s, 72 DEG C
15s, 95 DEG C of 10s, 50 circulations；95 DEG C of 1min, 40 DEG C of 1min, since 65 DEG C, are gathered with 0.02 DEG C of slope per second and melted
Curve, to 95 DEG C, 40 DEG C of 10s terminate afterwards, with LightCycler 480 the curve after collection is divided with analysis software
Analysis.Single peak such as is occurred in that relative to negative control, is then positive findings, show P53 gene mutations.
(3) direct sequencing is verified (this is optional step)
Combined with high-resolution melting curve analysis and bottom out the method for PCR and obtain the sample of positive findings, that is, P53 bases occur
Because of mutation.The DNA of the sample residual undergone mutation is carried out into gene sequencing, verifies that it has non-false positive.
Embodiment 2：Clinical sample is detected
P53 gene 5-8 extrons in 200 Check-up crowd blood are detected using the method for embodiment 1, Neng Goucheng
During work(detects 3 person under inspection's blood DNAs there is mutation in P53 genes, and PCR primer is detected with generation PCR sequencing PCR afterwards
And confirmed after comparing with human genomic sequence, this 3 samples are implicitly present in the change on DNA sequence dna.
200 Check-up crowd blood samples, wherein having 3 (No. 68, No. 105, No. 160) mutation occur (occurs in that list
Only peak), No. 68 sample P53 gene extron 7 is doubtful to there is nucleotide sequence change (Fig. 1)；No. 105 sample P53 gene
Exon 6 is doubtful to there is nucleotide sequence change (Fig. 2)；No. 160 sample P53 gene extron 5 is doubtful to there is variable nucleic acid sequence
Change (Fig. 3).It is sequenced through a generation and is detected, as a result shows that the synonymous changes of GGC/GGT (figure occurs in No. 68 sample P53 genes coden244
4)；There is C/G variations (Fig. 5) in No. 105 sample P53 gene 12759, and this variation is on P53 protein functions without influence；160th
There is TAC/TGC (tyrosine/cysteine) variations (Fig. 6) in number sample P53 genes coden163.During another Fig. 7 is detection sample
Negative sample HRM solubility curve figures, relative to negative control, there is not obvious difference in the detection curve of negative sample.
Result shows, the detection method that the present invention is provided can quick detection P53 gene 5-8 extrons various mutations, fit
For clinical infantile tumour patient examination.High with detection sensitivity, high specificity reacts simple, convenient and rapid, can obtain within 2 hours
Experimental result, the features such as be easy to large sample high flux to process, the positive findings that examination goes out determines by gene sequencing method again, can be with
It is greatly reduced the degree of difficulty and testing cost of infantile tumour examination.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, on the premise of the technology of the present invention principle is not departed from, some improvements and modifications can also be made, these improvements and modifications
Also should be regarded as protection scope of the present invention.
Sequence table
<110>Beijing Qing Hang Gene Tech. Company Limited
<120>The external detection method of rapid screening P53 gene extrons 5-8 mutation and application
<130> P1610248
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
ttactcttca agctgtcctc 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
cttatggtca ttattacttt 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
tactggaagt tattcgatct 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
tgtttaccac tagatctctg 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
gtactaattc ctaggtgggc 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400> 6
cttgtcgatc ctgacctgta 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<400> 7
tgtatcctga gtattggtct 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
atctgcttgc ggctctcgct 20
Claims (10)
1. the external detection method that a kind of rapid screening P53 gene extrons 5-8 is mutated, it is characterised in that：Comprise the following steps：
(1) peripheral blood sample genomic DNA is extracted；
(2) design synthesis is used to expand the specific primer totally 4 pairs of P53 gene extrons 5-8；
(3) carry out high-resolution melting curve analysis using above-mentioned primer pair sample gene group DNA and combine to bottom out PCR, 95 DEG C pre-
Denaturation 10min, 60 DEG C of 15s, 72 DEG C of 15s, 95 DEG C of 10s, 50 circulations；95 DEG C of 1min, 40 DEG C of 1min, since 65 DEG C, with
0.02 DEG C of slope collection melting curve per second, to 95 DEG C, 40 DEG C of 10s terminate afterwards, with analysis software to the curve after collection
It is analyzed；
(4) HRM tracing analysis：Single peak such as is occurred in that relative to negative control, is then positive findings, show P53 bases
Because of mutation.
2. detection method according to claim 1, it is characterised in that：Specific primer in the step (2), its nucleosides
Acid sequence is respectively：
The forward primer of P53 extrons 5：As shown in SEQ ID No.1；
The reverse primer of P53 extrons 5：As shown in SEQ ID No.2；
P53 exon 6 forward primers：As shown in SEQ ID No.3；
P53 exon 6 reverse primers：As shown in SEQ ID No.4；
P53 exon 7 forward primers：As shown in SEQ ID No.5；
P53 exon 7 reverse primers：As shown in SEQ ID No.6；
The forward primer of P53 extrons 8：As shown in SEQ ID No.7；
The reverse primer of P53 extrons 8：As shown in SEQ ID No.8.
3. detection method according to claim 1, it is characterised in that：The reaction system of PCR is in the step (3)：
Cumulative volume is that the reaction system of 15 μ L is included：master mix 10μL；MgCl22.4μL；GC enhancer 0.5μL；
The μ L of forward primer 1；The μ L of reverse primer 1, remaining is RNase free H2O。
4. detection method according to claim 3, it is characterised in that：Add in the reaction system in the step (3)
Entering sample gene group DNA, negative control, blank carries out bottoming out PCR reactions.
5. detection method according to claim 1, it is characterised in that：Peripheral blood sample uses dry blood in the step (1)
Piece is collected.
6. detection method according to claim 1, it is characterised in that：The extraction of sample gene group DNA in the step (1)
Extracted using kit.
7. the detection method described in any one of claim 1-6 is mutated for rapid screening P53 gene extrons 5-8.
8. application of the detection method described in any one of claim 1-6 in rapid screening P53 gene mutation detection kits.
9. the detection kit that a kind of rapid screening P53 gene extrons 5-8 is mutated, it is characterised in that：Comprising for expanding P53
The specific primer of gene extron 5-8 totally 4 pairs, its nucleotide sequence is respectively：
The forward primer of P53 extrons 5：As shown in SEQ ID No.1；
The reverse primer of P53 extrons 5：As shown in SEQ ID No.2；
P53 exon 6 forward primers：As shown in SEQ ID No.3；
P53 exon 6 reverse primers：As shown in SEQ ID No.4；
P53 exon 7 forward primers：As shown in SEQ ID No.5；
P53 exon 7 reverse primers：As shown in SEQ ID No.6；
The forward primer of P53 extrons 8：As shown in SEQ ID No.7；
The reverse primer of P53 extrons 8：As shown in SEQ ID No.8.
10. detection kit according to claim 9, it is characterised in that：Also contain PCR reagent, negative control, blank pair
According to.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710116035.5A CN106834487A (en) | 2017-03-01 | 2017-03-01 | The external detection method of the mutation of rapid screening P53 gene extrons 58 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710116035.5A CN106834487A (en) | 2017-03-01 | 2017-03-01 | The external detection method of the mutation of rapid screening P53 gene extrons 58 and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834487A true CN106834487A (en) | 2017-06-13 |
Family
ID=59138957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710116035.5A Pending CN106834487A (en) | 2017-03-01 | 2017-03-01 | The external detection method of the mutation of rapid screening P53 gene extrons 58 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834487A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419032A (en) * | 2017-09-25 | 2017-12-01 | 北京青航基因科技有限公司 | The specific primer being mutated for rapid screening EGFR gene exons 18 21 and application |
| CN111334582A (en) * | 2020-04-30 | 2020-06-26 | 北京和合医学诊断技术股份有限公司 | Method for synchronously detecting 4 exon gene mutations of P53 gene |
-
2017
- 2017-03-01 CN CN201710116035.5A patent/CN106834487A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107419032A (en) * | 2017-09-25 | 2017-12-01 | 北京青航基因科技有限公司 | The specific primer being mutated for rapid screening EGFR gene exons 18 21 and application |
| CN111334582A (en) * | 2020-04-30 | 2020-06-26 | 北京和合医学诊断技术股份有限公司 | Method for synchronously detecting 4 exon gene mutations of P53 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107475375B (en) | A kind of DNA probe library, detection method and kit hybridized for microsatellite locus related to microsatellite instability | |
| Hlady et al. | Genome-wide discovery and validation of diagnostic DNA methylation-based biomarkers for hepatocellular cancer detection in circulating cell free DNA | |
| AU2018212272B2 (en) | Diagnostic applications using nucleic acid fragments | |
| Toro et al. | Comparison of cell stabilizing blood collection tubes for circulating plasma tumor DNA | |
| Lin et al. | Emerging utility of urinary cell-free nucleic acid biomarkers for prostate, bladder, and renal cancers | |
| Jain et al. | Urine-based liquid biopsy for nonurological cancers | |
| Paradis et al. | Molecular profiling of hepatocellular carcinomas (HCC) using a large-scale real-time RT-PCR approach: determination of a molecular diagnostic index | |
| CN108753967A (en) | A kind of gene set and its panel detection design methods for liver cancer detection | |
| van Dessel et al. | High‐throughput isolation of circulating tumor DNA: a comparison of automated platforms | |
| TW202011416A (en) | Method and system for determining cancer status | |
| McConnell et al. | A novel next generation sequencing approach to improve sarcoma diagnosis | |
| WO2021238086A1 (en) | Method for constructing mathematical model for detecting lung cancer in vitro and application | |
| Banini et al. | The use of cell free DNA in the diagnosis of HCC | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| JP6309636B2 (en) | Circulating cancer biomarkers and uses thereof | |
| Raymond et al. | UltraPrep is a scalable, cost-effective, bead-based method for purifying cell-free DNA | |
| CN106834487A (en) | The external detection method of the mutation of rapid screening P53 gene extrons 58 and application | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| Wilmott et al. | Tumour procurement, DNA extraction, coverage analysis and optimisation of mutation-detection algorithms for human melanoma genomes | |
| CN107841558A (en) | Specific primer and application for the mutation of rapid screening BRCA1/2 gene extrons | |
| CN107419032A (en) | The specific primer being mutated for rapid screening EGFR gene exons 18 21 and application | |
| WO2015100736A1 (en) | Minimally-invasive method for postoperative monitoring of cancer patients | |
| WO2023056884A1 (en) | Sequencing of viral dna for predicting disease relapse | |
| JP7232438B2 (en) | Methods for purifying, isolating or concentrating methyl-containing group-modified nucleic acids | |
| US20200141941A1 (en) | Method for detecting the quantity of biomarker and identifying disease status |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170613 |
|
| RJ01 | Rejection of invention patent application after publication |