CN106834453B - Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population - Google Patents
Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population Download PDFInfo
- Publication number
- CN106834453B CN106834453B CN201710033791.1A CN201710033791A CN106834453B CN 106834453 B CN106834453 B CN 106834453B CN 201710033791 A CN201710033791 A CN 201710033791A CN 106834453 B CN106834453 B CN 106834453B
- Authority
- CN
- China
- Prior art keywords
- chronic hepatitis
- liver cancer
- hbv
- primer
- reaction solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit and a method for detecting whether chronic hepatitis B or HBV carriers are susceptible to liver cancer, which relate to the field of biological detection and comprise an amplification reaction solution of a specific primer for amplifying DNA (deoxyribonucleic acid) containing SNP (Single nucleotide polymorphism) sites in a sample; a purification reaction solution comprising an SAP enzyme for purifying the DNA; and (3) the extension reaction solution of the single base extension primer is used for obtaining the base detection result of the rs2304204 site in the IRF3 promoter, and when the detection result of the rs2304204 site in the IRF3 promoter shows the GG genotype, the chronic hepatitis B or HBV carrier is judged to be a liver cancer susceptible population. The specific primer and the extended primer provided by the invention have high sensitivity and good specificity, and the method provided by the invention can be used for predicting whether chronic hepatitis B or HBV carriers are liver cancer susceptible people, is simple to operate and is beneficial to monitoring of a prognosis target.
Description
Technical Field
The invention relates to the field of medical treatment and health, in particular to a kit and a method for detecting whether chronic hepatitis B or HBV carriers are liver cancer susceptible people.
Background
Currently, Hepatitis B Virus (HBV) infection is a worldwide public health problem. According to the statistics of the world health organization, 4 hundred million HBV infected people exist in the world, and Chinese HBV carriers account for 1/3 in the world. Among them, 10% of adults and about 80% -90% of children develop chronic hepatitis B after infection, while patients with chronic hepatitis B die of cirrhosis complicated by chronic hepatitis B and a large part of primary hepatocellular carcinoma, which is determined by the interaction of multiple factors and various factors, and the factors influencing the outcome of HBV infection include viral factors (such as viral genotype, viral load and viral variation); the immune status of the host (e.g., age at infection, presence or absence of other viral co-infection) and the genetic factors of the host. In particular, polymorphisms in host antiviral immunity-related genes largely determine the clinical outcome after HBV infection.
The IRF3 (interference regulation factor 3) gene is located on chromosome 19 and encodes a 50KD protein product. IRF3 is a member of the IRF family and plays an important role in regulating interferon expression. IRF3 is an important signal molecule in MyD88 independent signal transduction pathway, IRF3 is universally expressed by cells, and when a virus infects cells, IRF3 recognizes double-stranded RNA molecules and is activated. Activation of IRF3 can regulate the expression levels of downstream IFN- β, an important cytokine in the antiviral response in vivo. It has been shown that viral entry into cells and activation of the antiviral response is mediated by IRF3, which plays an important role in the response of the body's innate immunity to viral infection. Many studies have shown that IRF3 is associated with disease. The A/T polymorphism of intron 5 of IRF3 affects the expression of IFN-. beta.1. It was found that patients with chronic HBV infection could not activate IRF3 and produce enough IFN- β to clear hepatitis B virus, resulting in a persistent infection with hepatitis B virus. However, the current research does not provide any research and suggestion of using a certain position on IRF3 promoter sequence to judge the clinical outcome of HBV infected Chinese Han population.
Disclosure of Invention
In order to find the chronic hepatitis B or HBV carrier in advance in the initial stage of infection, assist in treating patients and avoid the accelerated conversion of the progress of the liver disease into severe liver disease or even liver cancer, the invention provides a kit and a method for detecting whether the chronic hepatitis B or HBV carrier is a liver cancer susceptible population, wherein the method mainly relies on the rs2304204 locus in the IRF3 promoter as the locus of a liver cancer susceptible gene for detecting whether the chronic hepatitis B or HBV carrier is the liver cancer susceptible population. The method is simple to operate and is beneficial to monitoring the prognosis target.
In order to achieve the object of the present invention, in a first aspect, the present invention provides a kit for detecting whether a chronic hepatitis b or HBV carrier is a liver cancer susceptible population, comprising:
an amplification reaction solution comprising a specific primer for amplifying a DNA containing an SNP site in a sample;
a purification reaction solution comprising an SAP enzyme for purifying the DNA;
and (3) an extension reaction solution of the single-base extension primer for obtaining a base detection result of the rs2304204 site in the IRF3 promoter.
Wherein, when the detection result of the rs2304204 locus in the IRF3 promoter shows GG genotype, the chronic hepatitis B or HBV carrier is judged to be a liver cancer susceptible population.
In particular, the detection of the rs2304204 locus in the IRF3 promoter comprises:
amplifying a section of DNA containing SNP sites on a sample by using a specific primer and PCR amplification reaction liquid, and removing residual deoxyribonucleoside triphosphate and the primer in a PCR system by using SAP enzyme to obtain a sample DNA fragment;
adding a single-base extension primer, and carrying out single-base extension termination reaction on the sample DNA by adopting a single-base extension termination reaction solution to obtain a target gene for SNP analysis;
detecting the molecular weight difference between the extension product and the non-extension primer by matrix-assisted laser desorption ionization time-of-flight mass spectrometry, and determining the base of the rs2304204 site in the IRF3 promoter;
and obtaining a judgment result of whether the chronic hepatitis B or HBV carrier is a liver cancer susceptible population according to the base result of the rs2304204 locus in the IRF3 promoter.
Wherein, when the base result of the rs2304204 site in the IRF3 promoter is GG genotype, the chronic hepatitis B or HBV carrier is judged to be liver cancer susceptible population.
Wherein the liver cancer is hepatocellular carcinoma.
In particular, the specific primers comprise:
a forward primer: 5'-ACGTTGGATGTCGGCTTTTGGGTCTGTTAC-3', respectively;
reverse primer: 5'-ACGTTGGATGTCAGCTGAGCTCTAGAGCG-3' are provided.
In particular, the single base extension primer is: 5'-CGCTGGGGCTTTCTTTT-3' are provided.
In particular, the reaction conditions for performing amplification using the amplification reaction solution are: pre-denaturation at 95 ℃ for 15 min; denaturation at 94 ℃ for 20s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 60s, 45 cycles, extension at 72 ℃ for 3min, and storage at 10 ℃.
Wherein, the PCR amplification reaction system further comprises: 10 buffer 0.625ul, Mg2+0.325ul, dNTP0.25ul, Forward Primer 1ul, Reverse Primer 1ul, DNA 1ul (10ng-20ng), and Hotstar taq enzyme 0.2 ul.
In particular, the reaction conditions using the purified reaction solution are: storing at 37 deg.C for 40min, 85 deg.C for 5min, and 10 deg.C.
Wherein the SAP enzyme comprises: 1.53ul of triple distilled water, 0.17ul of Buffer and 0.3ul of SAP.
In particular, the reaction conditions using the single-base extension termination reaction solution are: 94 ℃ 30s, 94 ℃ 5s,52 ℃ 5s, 80 ℃ 5s, 4 internal cycles (52 ℃ 5s, 80 ℃ 5s), 39 external cycles (94 ℃ 5s,52 ℃ 5s, 80 ℃ 5s), 72 ℃ 3min, 10 ℃ storage.
Wherein the single-base extension termination reaction solution comprises: triple distilled water 1.36, 10 × iplex buffer 0.2ul, Terminator mix 0.1ul, Primer 0.02, Thermo sequence 0.02 ul.
In order to achieve the technical purpose of the present invention, in a further aspect, the present invention provides a method for detecting whether a chronic hepatitis b or HBV carrier disease is a liver cancer susceptible population, wherein rs2304204 locus in an IRF3 promoter is judged, and when rs2304204 locus in an IRF3 promoter shows a GG genotype, the chronic hepatitis b or HBV carrier is indicated as a liver cancer susceptible population.
Wherein the judging of the rs2304204 locus in the IRF3 promoter comprises the following steps:
amplifying a section of DNA containing SNP sites on a sample by using a specific primer and PCR amplification reaction liquid, and removing residual deoxyribonucleoside triphosphate and the primer in a PCR system by using SAP enzyme to obtain a sample DNA fragment;
adding a single-base extension primer, and carrying out single-base extension termination reaction on the sample DNA by adopting a single-base extension termination reaction solution to obtain a target gene for SNP analysis;
detecting the molecular weight difference between the extension product and the non-extension primer by matrix-assisted laser desorption ionization time-of-flight mass spectrometry, and determining the base of the rs2304204 site in the IRF3 promoter;
and obtaining a judgment result of whether the chronic hepatitis B or HBV carrier is a liver cancer susceptible population according to the base result of the rs2304204 locus in the IRF3 promoter.
Wherein, when the base result of the rs2304204 site in the IRF3 promoter is GG genotype, the chronic hepatitis B or HBV carrier is judged to be liver cancer susceptible population. Wherein, the specific primer comprises:
a forward primer: 5'-ACGTTGGATGTCGGCTTTTGGGTCTGTTAC-3', respectively;
reverse primer: 5'-ACGTTGGATGTCAGCTGAGCTCTAGAGCG-3' are provided.
In particular, the single base extension primer is: 5'-CGCTGGGGCTTTCTTTT-3'
The invention has the beneficial effects that:
1. the specific primer and the extension primer provided by the invention can be used for accurately amplifying and extending a target gene, and have high sensitivity and good specificity.
2. The kit provided by the invention can accurately detect the genotype of the rs2304204 locus in the IRF3 promoter, thereby providing an accurate basis for judging whether the diseases of chronic hepatitis B or HBV carriers are susceptible to liver cancer.
3. In order to find the chronic hepatitis B or HBV carrier in advance at the initial stage of infection, assist in treating patients and avoid delayed treatment opportunity of the chronic hepatitis B or HBV carrier, the method provided by the invention can help to predict the progress trend of the disease of the chronic hepatitis B or HBV carrier, so as to judge whether the disease of the chronic hepatitis B or HBV carrier is a liver cancer susceptible population or not, and the method mainly depends on the rs2304204 site in the IRF3 promoter as a prompt standard, is simple to operate and is beneficial to monitoring of a prognosis target.
Detailed Description
In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be described in further detail below with reference to specific embodiments.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments disclosed below.
The main experimental instruments used in this example:
high speed centrifuges, Beckman Coulter ltd, usa;
SEQUENOM MASSARRAY matrix-assisted laser desorption ionization time-of-flight (MALDITOF) mass spectrometry platform matrix-assisted laser desorption ionization time-of-flight mass spectrometry (manufactured by Sequenom, USA);
-20 ℃ and-80 ℃ low temperature refrigerator; an electronic scale; an ultra-clean bench; a horizontal centrifuge; an electrophoresis apparatus, an electrophoresis tank; an electric heating constant temperature water bath box.
EXAMPLE 1 kit
1. Amplification reaction solution
A method for amplifying DNA containing SNP sites in a sample, comprising: 10 buffer 0.625ul, Mg2+0.325ul, dNTP0.25ul, Forward Primer 1ul, Reverse Primer 1ul, DNA 1ul (10ng-20ng), and Hotstar taq enzyme 0.2 ul.
Wherein the Forward Primer (i.e., Forward Primer) is:
5’-ACGTTGGATGTCGGCTTTTGGGTCTGTTAC-3’；
wherein, the Reverse Primer (namely Reverse Primer) is:
5’-ACGTTGGATGTCAGCTGAGCTCTAGAGCG-3’。
further, the reaction conditions using the amplification reaction solution were: 15min at 95 ℃; at 94 deg.C for 20s, at 56 deg.C for 30s, at 72 deg.C for 60s for 45 cycles, at 72 deg.C for 3min, and at 10 deg.C.
2. Purifying the reaction solution
The DNA fragment used for purifying the amplified DNA fragment mainly comprises SAP enzyme, and specifically comprises the following components: 1.53ul of triple distilled water, 0.17ul of Buffer and 0.3ul of SAP.
Further, the reaction conditions using the purified reaction solution were: storing at 37 deg.C for 40min, 85 deg.C for 5min, and 10 deg.C.
3. Extension reaction solution
The method is used for obtaining the base detection result of the rs2304204 locus in the IRF3 promoter, and specifically comprises the following steps: triple distilled water 1.36, 10 × iplex buffer 0.2ul, Terminator mix 0.1ul, Primer 0.02, Thermo sequence 0.02 ul.
Wherein the Primer (i.e. single base extension Primer) is: 5'-CGCTGGGGCTTTCTTTT-3' are provided.
Further, the reaction conditions for carrying out the single base extension reaction using the extension reaction solution are: 94 ℃ 30s, 94 ℃ 5s,52 ℃ 5s, 80 ℃ 5s, 4 internal cycles (52 ℃ 5s, 80 ℃ 5s), 39 external cycles (94 ℃ 5s,52 ℃ 5s, 80 ℃ 5s), 72 ℃ 3min, 10 ℃ storage.
Example 2 method for determining whether chronic hepatitis B or HBV carrier is susceptible to liver cancer
1. Specimen Collection and DNA extraction
A Blood clot (200. mu.l of the Blood clot dissolved in TES solution) was collected from the subject, and the whole genomic DNA was extracted using QIAGEN QIAampDNA Blood Mini Kit according to the protocol.
The specific operation steps are as follows:
1) first, 200. mu.l of AL buffer was added to a 1.5ml centrifuge tube. The patient's specimen was then gently pipetted and mixed, and 200. mu.l of the specimen was pipetted into a centrifuge tube containing lysis buffer (AL buffer).
2) Adding 20 mu l of QIAGEN protease or proteinase K into the centrifuge tube in the step 1), shaking and uniformly mixing for 15 seconds, centrifuging at 8000rpm/min for 10 seconds, and then putting into an electrothermal thermostatic waterbath box at 56 ℃ for water bath for 10 minutes.
3) And (4) centrifuging at a low speed to enable the liquid in the centrifuge tube cover to enter the centrifuge tube.
4) Adding 200 mul of absolute ethyl alcohol into the centrifuge tube, fully and uniformly mixing, shaking and uniformly mixing for 15 seconds, and then centrifuging again at 8000rpm/min for 10 seconds.
5) Transferring the material (i.e., the liquid including flocculent material) in the centrifuge tube of step 4) to a QIAamp spin column and placing it in a 2ml manifold tube with minimal adherence to the tube wall. The tube cover is tightly covered, and the tube is centrifuged at 8000rpm for 1 minute. The spin column is placed in another manifold and the used manifold can be discarded.
6) Open the column and add 500. mu.l of wash buffer (AW1 buffer) to the other manifold described in step 5) without wetting the walls of the tubes. The cover is closed, the mixture is centrifuged at 8000rpm for 1 minute, and the manifold is discarded. The spin column was placed in another clean manifold.
7) Open the column and add 500. mu.l of wash buffer (AW2 buffer) to another clean manifold as described in step 6). The cover is covered, and high-speed centrifugation is carried out for 3 minutes at 14000 r/min (if the maximum rotation speed of the centrifuge is only 13000, the high-speed centrifugation at 13000 r can be carried out for 5 minutes).
8) And (4) pouring the waste liquid in the collecting pipe in the step 7), continuously placing the centrifugal column on another collecting pipe, and emptying for 13000 revolutions or 14000 revolutions for 1 minute. The residual AW2 buffer was removed as much as possible.
9) The column was placed in an additional clean 1.5ml centrifuge tube and the manifold discarded. Carefully open the tube cap and carefully add 50-100. mu.l of a DNA-lysing solution (AE buffer). The mixture was left at room temperature for 10 minutes and then centrifuged at 8000rpm for 1 minute.
10) After DNA extraction, the sequence numbers are marked and stored in a refrigerator at-20 ℃ or-4 ℃ for later use.
2. Detection of site Gene polymorphism
Amplifying a section of DNA (about 50bp before and after the SNP locus) containing the SNP locus, removing residual deoxyribonucleoside triphosphate (dNTP) and a primer in a PCR system by SAP enzyme, adding a single-base extension primer, wherein the 3' terminal base of the primer is close to the SNP locus, and replacing the dNTP by four ddNTPs, so that the probe only extends one base at the SNP locus, and the connected ddNTPs correspond to alleles of the SNP locus. Detecting the molecular weight difference between the extension product and the non-extension primer by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS) to determine the basic group at the point, and the specific steps are as follows:
2.1 PCR amplification
Carrying out PCR amplification reaction by using the specific primers and the obtained DNA sample, wherein the total reaction system is (namely an amplification reaction solution):
wherein the Forward Primer (i.e., Forward Primer) is:
5’-ACGTTGGATGTCGGCTTTTGGGTCTGTTAC-3’；
reverse Primer (i.e., Reverse Primer) is:
5’-ACGTTGGATGTCAGCTGAGCTCTAGAGCG-3’。
the amplification reaction system was set up according to the following procedure:
95℃15min；
94℃20s，
56℃30s，
60s 45 cycles at 72 ℃ for the reaction,
72℃3min，
storing at 10 deg.C.
Obtaining the target gene product after PCR amplification.
2.2 purification reaction
The SAP enzyme is used for removing the residual deoxyribonucleoside triphosphate (dNTP) and the primer in the PCR system, and the specific operation method is as follows:
placing the target gene product obtained in the step 3.1 after PCR amplification into a centrifuge for 3min at 3000 r/min, and preparing SAP enzyme Mix (namely a purification reaction solution) in a 1.5ml Tube according to the following sequence:
mix was evenly distributed over 12 well interconnected pipes. The rubber cover was gently uncovered, 2ul of Mix was added to each well with a 12-line gun and pumped back and forth to ensure mixing, the rubber cover was tightly covered and pressed tightly with round objects. Centrifuging at 3000 rpm for 3min, and covering with round object. SAP enzymatic digestion was performed in a PCR instrument according to the following procedure: storing at 37 deg.C for 40min, 85 deg.C for 5min, and 10 deg.C.
Obtaining the purified target gene.
2.3 Single base extension termination reactions
Putting the purified target gene into a centrifuge for 3min at 3000 r/m; a single-base extension reaction Mix (i.e., extension reaction solution) was prepared in a 1.5ml tube in the following order:
wherein, Primer (i.e. extension Primer) is: 5'-CGCTGGGGCTTTCTTTT-3' are provided.
Evenly distributing Mix in the 12-hole row pipes, and slightly uncovering the rubber cover; 2ul of Mix is taken by a 12-row gun and added into each hole, and is pumped back and forth to ensure uniform mixing, a rubber cover is tightly covered, and a round object is tightly pressed; centrifuging for 3min at 3000 rpm in a centrifuge, and covering the rubber cover tightly with round object; the single base extension reaction was performed in a PCR instrument according to the following procedure:
3 resin purification
Diluting the reaction product (9 ul in total) obtained in the step 3.3 by 3 times, and desalting by using resin; and (3) putting the sample subjected to desalination treatment on a sample target, naturally crystallizing, and performing mass spectrum detection on a computer and collecting data.
4 data analysis
When the mass spectrum detection result of the chronic hepatitis B or HBV carrier shows that the rs2304204 locus of the IRF3 gene is GG genotype, the patient is judged to be a liver cancer susceptible population.
Application examples
In this embodiment, 686 samples are detected and analyzed by using the kit provided in embodiment 1 and the method provided in embodiment 2, so as to determine whether a chronic hepatitis b or HBV carrier is a liver cancer-susceptible population, specifically as follows:
1 study object
All cases in this study met the diagnostic criteria of 2009 chronic hepatitis b guidelines, with the inclusion and exclusion criteria as follows:
1.1 Normal control group
The selection standard is Han nationality, and the age is more than or equal to 40 years old; HBsAg, anti-HBs, HBeAg and anti-HBe are all negative, and hepatitis B vaccine is not inoculated. No other hepatitis viruses; there is no systemic disease (such as kidney disease, heart disease, autoimmune disease, etc. have influence on the result judgment).
1.2 HBV natural healing group
The selection standard is Han nationality, and the age is more than or equal to 40 years old; anti-HBs, anti-HBc positive or anti-HBs positive but not inoculated with hepatitis B vaccine; HBV DNA, anti-HAV, anti-HCV or anti-HDV, anti-HEV negative; without systemic diseases (such as kidney disease, heart disease, autoimmune disease, etc. having influence on the result judgment)
1.3 HBV carriers
The selection standard is Han nationality, and the age is more than or equal to 40 years old; HBsAg is positive for at least half a year, and anti-HAV, anti-HCV or anti-HDV, anti-HEV are negative; ALT and AST detected normal ranges.
1.4 Chronic hepatitis B group
The selection standard is Han nationality, and the age is more than or equal to 40 years old; HBsAg is positive for at least half a year, and anti-HAV, anti-HCV or anti-HDV, anti-HEV are negative; ALT or AST is more than or equal to 60IU/L or 2 times of the upper limit of normal value or hepatosplenomegaly; or patients with chronic hepatitis confirmed by liver histopathology; clinically, the liver cirrhosis does not appear (such as portal hypertension, hyperfunction of spleen and the like); there is no systemic disease (such as kidney disease, heart disease, autoimmune disease, etc. have influence on the result judgment).
Since hepatitis B cirrhosis and hepatocellular carcinoma occur mostly after age 40, we selected the normal control group, the HBV natural recovery group, HBV carrier and chronic hepatitis B group all with age > 40 years.
1.5 group of liver cirrhosis
The selection standard is Han nationality, the age is not limited, and HBsAg is positive; anti-HAV, anti-HCV or anti-HDV, anti-HEV negative; clinically, the liver cirrhosis is manifested by the symptoms of cirrhosis (such as imaging diagnosis, varicose veins or bleeding of the esophagus and the stomach, ascites, edema of two lower limbs, hepatic encephalopathy, etc.); there is no systemic disease (such as kidney disease, heart disease, autoimmune disease, etc. which has influence on the result judgment).
1.6 hepatocellular carcinoma group
The selection standard is Han nationality, and the age is not limited; HBsAg positive; anti-HAV, anti-HCV or anti-HDV, anti-HEV negative; hepatocellular carcinoma was confirmed by liver histopathological examination or AFP and ultrasound, CT, or MRI; there is no systemic disease (such as kidney disease, heart disease, autoimmune disease, etc. which has influence on the result judgment).
The samples were subjected to HBV DNA quantification and HBsAg, Anti-HBs, HBeAg, Anti-HBe, Anti-HAV, Anti-HCV, Anti-HDV and Anti-HEV detection to exclude other types of hepatitis and to clarify the infection status of the patients, and the demographic and clinical characteristics as shown in Table 1 were obtained:
TABLE 1 demographic and clinical profiles
As can be seen from the table, the age of the normal control, the natural recovery group, the HBV carrier, the chronic hepatitis b group, the cirrhosis group, and the liver cancer group were 49.87 years old, 50.11 years old, 49.28 years old, 48.37 years old, 48.96 years old, and 49.31 years old, respectively (P ═ 0.425). The chronic hepatitis B group, the cirrhosis group and the hepatocellular carcinoma group had significantly more men than the healthy control group (72.4%, 76.8%, 82.7% vs 48.8%, P0.000). 67 cases of HBeAg positive patients and 64 cases of Anti-HBe positive patients in the chronic hepatitis B group; 45 cases of HBeAg positive patients and 48 cases of Anti-HBe positive patients in the liver cirrhosis group; 32 HBeAg positive patients and 66 Anti-HBe positive patients in the hepatocellular carcinoma group; 28 Anti-HBe positive patients in a natural healing group; HBeAg positive rates of the chronic hepatitis B group, the liver cirrhosis group and the liver cancer group are 46.2%, 40.5% and 29.4% respectively; the Anti-HBe positive rates in the natural recovery group, the carrier, the chronic hepatitis B group, the liver cirrhosis group and the hepatocellular carcinoma group were 19.3%, 69.8%, 44.1%, 43.2% and 60.6%, respectively. 94 cases of HBV DNA positive of chronic hepatitis B, 57 cases of HBV DNA positive of cirrhosis group and 80 cases of HBV DNA positive of hepatocellular carcinoma group have positive rates of 72.3%, 65.5% and 76.2% respectively.
2. 686 samples were detected and analyzed using the kit of example 1 and the method provided in example 2
2.1 relationship between Single site polymorphism and different outcomes after HBV infection
Comparing the chronic hepatitis B + HBV carrier with natural cure (HBV chronic infection and natural cure), chronic hepatitis B + cirrhosis + liver cancer and natural cure (HBV infection and natural cure), chronic hepatitis B and cirrhosis + liver cancer, chronic hepatitis B and cirrhosis, chronic hepatitis B and liver cancer, HBV carrier with cirrhosis, chronic hepatitis B and cirrhosis, HBV carrier with chronic hepatitis B and liver cancer (HBV infection disease progress), genotype and distribution of allele, analyzing relationship among different junctions of genotype, allele and hepatitis B virus infection, and respectively testing the dominant model, the recessive model, the additive model and the multiplicative model. (not complying with Hardy-Weinberg equilibrium this analysis was not performed)
The analysis result shows that the rs2304204 GG genotype in the population is obviously more in the group of liver cirrhosis and liver cancer than in the group of chronic hepatitis B. (8.7% vs 2.8%, p ═ 0.024, OR ═ 3.318, 95% CI 1.105-9.965) rs2304204 GG genotype significantly more abundant in the hepatoma group than in the chronic hepatitis b group (11.1% vs 2.8%, p ═ 0.008, OR ═ 4.344, 95% CI 1.360-13.871). The rs2304204 GG genotype is significantly more than HBV carrier + chronic hepatitis B in the liver cancer group (11.1% vs 3.1%, p ═ 0.005, OR ═ 3.938, 95% CI 1.434-10.814).
The rs2304204 GG genotype has an increasing trend in the proportion of chronic hepatitis B, liver cirrhosis and hepatocellular carcinoma, and the differences have statistical significance (2.8%, 6.4% and 11.1%, respectively, with the trend of chi-square ═ 7.066 and p ═ 0.008). See table 2.
TABLE 2 genotype and allele distribution at individual sites in the population
Note:aindicate chronic hepatitis B and cirrhosis + liver cancer GG versus AA + AG;bindicate a comparison of chronic hepatitis B and liver cancer GG with AA + AG;cindicates that HBV carriers + chronic hepatitis B and liver cancer GG are compared with AA + AG;dGG and AA + AG are compared to indicate chronic hepatitis B-to-cirrhosis;eindicates HBV carriers compared with chronic hepatitis B GG and AA + AG;findicate HBV carriers + chronic hepatitis b and cirrhosis GG compared to AA + AG;gshows that HBV carriers, chronic hepatitis B, liver cirrhosis and liver cancer are compared with GG and AA + AG in a natural recovery group.
Therefore, it is shown that the rs2304204 GG genotype is closely related to the development of HBV chronic infection to liver cirrhosis and liver cancer.
2.2 different sexes HBV infection outcome and TLRs pathway single site polymorphism relationship
In men, the rs2304204 GG genotype was significantly higher in the hepatoma group than in the chronic hepatitis b group (11.2% vs 2.9%, p 0.022, OR 4.219, 95% CI 1.123-15.851). The rs2304204 GG genotype is obviously more than that of HBV carrier and chronic hepatitis B group in liver cancer group (11.2% vs 3.1%, p 0.017%, OR 3.924, 95% CI 1.190-12.942). The rs2304204 GG genotype has an increasing trend in chronic hepatitis B, liver cirrhosis and hepatocellular carcinoma, and the differences have statistical significance (2.9%, 4.8% and 11.2%, respectively, with the trend of 5.570, p 0.018). See table 3.
TABLE 3 Single site genotype and allelic distribution in Male patients
Note:ashows that the slow hepatitis B is compared with the cirrhosis + liver cancer GG and the AA + AG,bshows that the slow hepatitis B and the liver cancer GG are compared with AA + AG,cshows that HBV carriers + chronic hepatitis B and liver cancer GG are compared with AA + AGdShows that the chronic hepatitis B is compared with the cirrhosis GG and the AA + AG,eshows that HBV carriers are compared with chronic hepatitis GG and AA + AG,fshows that HBV carrier + chronic hepatitis B and cirrhosis GG are compared with AA + AG, and g shows that HBV carrier + chronic hepatitis B + cirrhosis + liver cancer is compared with natural healing group GG and AA + AG. h represents the comparison of chronic hepatitis B and liver cirrhosis + liver cancer CT + TT with CC, i represents the comparison of chronic hepatitis B and liver cancer CT + TT with CC, j represents the comparison of HBV carrier + chronic hepatitis B and liver cancer CT + TT with CC, k represents the comparison of chronic hepatitis B to liver cirrhosis CT + TT with CC, l represents the comparison of HBV carrier and chronic hepatitis B CT + TT with CC, m represents the comparison of HBV carrier + chronic hepatitis B and liver cirrhosis CT + TT with CC, n represents the comparison of HBV carrier + chronic hepatitis B + liver cirrhosis + liver cancer with natural healing group CT + TT with CC, and o represents the comparison of chronic hepatitis B + HBV carrier and natural healing group CT + TT with CC.
Therefore, the rs2304204 GG genotype is closely related to the HBV chronic infection and the development of liver cirrhosis and liver cancer in men.
2.3 analysis of risk factors of different fates of genotype at single locus and HBV
And respectively carrying out single-factor Logistic regression analysis and multi-factor Logistic regression analysis on different clinical outcomes after HBV infection. The results are shown in table 4, and it can be seen,
rs2304204 GG genotype is an independent risk factor for the development of chronic hepatitis B into liver cancer, χ25.253, p 0.022, OR 3.983, 95% CI 1.222-12.984. After adjusting sex and age, rs2304204 GG genotype is still the independent risk factor for the development of chronic hepatitis B into liver cancer2＝5.175，p＝0.023，OR＝3.974,95％CI 1.210-13.045。
TABLE 4 Logistic regression analysis of different genotypes and clinical outcome risk factors of rs2304204
rs2304204 GG genotype is an independent risk factor for HBV carrier and chronic hepatitis B to develop liver cancer, χ26.432, p 0.011, OR 3.793, 95% CI 1.354-10.628. After adjusting sex and age, rs2304204 GG genotype is an independent risk factor for HBV carrier and chronic hepatitis B to develop liver cancer, chi26.432, p 0.013, OR 3.776, 95% CI 1.324-10.771. Female sex is a protective factor for HBV carrier and chronic hepatitis B to develop into liver cancer, chi2＝8.935，p＝0.003，OR＝0.410，95％CI 0.229-0.736。
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> first Hospital of Beijing university
<120> kit and method for detecting whether chronic hepatitis B or HBV carrier is susceptible to liver cancer
<160> 1
<170>PatentIn version 3.5
<210> 1
<211> 31
<212> DNA
<213> Artificial sequence
ACGTTGGATGTCGGCTTTTGGGTCTGTTAC 31
<210> 2
<211> 29
<212> DNA
<213> Artificial sequence
ACGTTGGATGTCAGCTGAGCTCTAGAGCG 29
<210> 3
<211> 17
<212> DNA
<213> Artificial sequence
CGCTGGGGCTTTCTTTT 17
Claims (1)
1. The application of the reagent for detecting the rs2304204 locus in the IRF3 promoter in preparing the kit for detecting whether chronic hepatitis B or HBV carriers are susceptible to liver cancer or not is characterized in that the kit comprises:
an amplification reaction solution comprising a specific primer for amplifying DNA containing the rs2304204 locus in a sample;
a purification reaction solution comprising an SAP enzyme for purifying the DNA;
an extension reaction solution of a single-base extension primer used for the base detection result of the rs2304204 site in the IRF3 promoter;
wherein, the specific primer comprises:
a forward primer: 5'-ACGTTGGATGTCGGCTTTTGGGTCTGTTAC-3', respectively;
reverse primer: 5'-ACGTTGGATGTCAGCTGAGCTCTAGAGCG-3', respectively;
wherein the single base extension primer is: 5'-CGCTGGGGCTTTCTTTT-3' are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710033791.1A CN106834453B (en) | 2017-01-17 | 2017-01-17 | Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710033791.1A CN106834453B (en) | 2017-01-17 | 2017-01-17 | Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834453A CN106834453A (en) | 2017-06-13 |
| CN106834453B true CN106834453B (en) | 2020-12-25 |
Family
ID=59124612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710033791.1A Active CN106834453B (en) | 2017-01-17 | 2017-01-17 | Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834453B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006003654A3 (en) * | 2004-07-01 | 2007-12-06 | Medical Res Fund Of Tel Aviv S | Methods and kits for predicting liver fibrosis progression rate in chronic hepatitis c patients |
-
2017
- 2017-01-17 CN CN201710033791.1A patent/CN106834453B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006003654A3 (en) * | 2004-07-01 | 2007-12-06 | Medical Res Fund Of Tel Aviv S | Methods and kits for predicting liver fibrosis progression rate in chronic hepatitis c patients |
Non-Patent Citations (3)
| Title |
|---|
| "全基因组关联研究发现8p21.3 区域的INTS10基因是一种新的抑制HBV 感染的抗性基因";李元丰等;《遗传》;20160731;第38卷(第7期);第675页5-9行 * |
| "干扰素调节因子3 rs2304204野生型及突变型重组质粒的构建及活性分析";白晓燕等;《国际病毒学杂志》;20140630;第21卷(第3期);第103页第3-4段 * |
| 白晓燕等."干扰素调节因子3 rs2304204野生型及突变型重组质粒的构建及活性分析".《国际病毒学杂志》.2014,第21卷(第3期),第100-104页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106834453A (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jafari et al. | The NRAMP1, VDR, TNF-α, ICAM1, TLR2 and TLR4 gene polymorphisms in Iranian patients with pulmonary tuberculosis: A case–control study | |
| Zhao et al. | Evaluate the relationship between polymorphisms of OAS1 gene and susceptibility to chronic hepatitis C with high resolution melting analysis | |
| CN111808944A (en) | Gene detection method for children personalized medicine | |
| CN111893173A (en) | Primer, method and kit for detecting PEAR1 SNP locus | |
| CN107557460A (en) | Method based on nucleic acid mass-spectrometric technique detection colorectal cancer driving gene and susceptible SNP | |
| CN108531575A (en) | Detect primer, kit and the method for the full exon sequence mutation of TERC genes | |
| CN105886606A (en) | Kit for rapid detection of polymorphism of Warfarin metabolic enzyme gene by virtue of pyrosequencing method and application of kit | |
| CN110699446A (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| US8435764B2 (en) | Multiplex detection of hepatitis virus variations | |
| CN111304311B (en) | SNP marker for detecting O gene mutation in ABO blood group system | |
| CN106834454B (en) | Kit and method for detecting whether male can be naturally cleared after being infected with HBV | |
| CN110499368B (en) | SNP marker related to oral cancer prognosis prediction and application thereof | |
| CN106834453B (en) | Kit and method for detecting whether chronic hepatitis B or HBV carrier is liver cancer susceptible population | |
| CN106755335B (en) | Detection primer, kit and detection method for gene mutation of Leber hereditary optic neuropathy mitochondria DNA | |
| Mohammed et al. | Single nucleotide polymorphism rs7908486 of the tcf7l2 gene is highly associated with obesity in the Iraqi population | |
| JP2008529524A (en) | Method for diagnosing type 2 diabetes using multilocus marker, polynucleotide containing marker related to type 2 diabetes, microarray containing the same, and kit for diagnosing type 2 diabetes | |
| JP2008531041A (en) | Breast cancer diagnostic method and composition therefor | |
| CN106834455B (en) | Kit and method for detecting liver cancer susceptibility gene of HBeAg negative HBV chronic infection cirrhosis patient | |
| CN111321224A (en) | miRNA biomarker combination for diagnosis or auxiliary diagnosis of gastric cancer and kit thereof | |
| Wanga et al. | Hepatic miR-122 expression correlated with IL-28B genetic polymorphisms in hepatocellular carcinoma patients with living donor liver transplantation | |
| CN114672548A (en) | Human venous thrombosis risk gene polymorphism detection kit, process and application | |
| CN110157798B (en) | Primer probe combination for guiding polymorphism of gene locus of diabetes personalized medicine, application and kit thereof | |
| CN112063704A (en) | SNP (single nucleotide polymorphism) site related to A variant in ABO (anaerobic-baffled oxide) blood group system | |
| KR101402608B1 (en) | Composition for anticipating drug resistance against therapeutic agent of chronic Hepatitis B and method thereof | |
| CN111394451A (en) | Insulin resistance gene polymorphism detection primer, application and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |