CN106834180A - Improvement Phyllosphere of cucumber Tiny ecosystem prevents and treats enterobacteria 3bh19 and its application of downy mildew - Google Patents

Improvement Phyllosphere of cucumber Tiny ecosystem prevents and treats enterobacteria 3bh19 and its application of downy mildew Download PDF

Info

Publication number
CN106834180A
CN106834180A CN201710101720.0A CN201710101720A CN106834180A CN 106834180 A CN106834180 A CN 106834180A CN 201710101720 A CN201710101720 A CN 201710101720A CN 106834180 A CN106834180 A CN 106834180A
Authority
CN
China
Prior art keywords
enterobacteria
cucumber
microbial inoculum
downy mildew
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710101720.0A
Other languages
Chinese (zh)
Other versions
CN106834180B (en
Inventor
罗玉明
张丽娜
杨威
郑丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhenjiang Ulu Biotechnology Co.,Ltd.
Original Assignee
Huaiyin Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huaiyin Normal University filed Critical Huaiyin Normal University
Priority to CN201710101720.0A priority Critical patent/CN106834180B/en
Publication of CN106834180A publication Critical patent/CN106834180A/en
Application granted granted Critical
Publication of CN106834180B publication Critical patent/CN106834180B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Pretreatment Of Seeds And Plants (AREA)

Abstract

The invention discloses enterobacteria 3bh19 and its application that improvement Phyllosphere of cucumber Tiny ecosystem prevents and treats downy mildew.Biocontrol microorganisms 3bh19 is enterobacteria (Enterobacter sp.).The bacterium is made concentration 1 × 108The microbial inoculum of CFU/mL concentrations above, under the conditions of greenhouse normal management, enterobacteria 3bh19 microbial inoculum leaves enclose after spraying treatment and reach more than 63.32% to cucumber downy mildew biocontrol effect;And the 30th day cucumber plant biomass and compare and compare and increase above more than 32% after treatment;In field, to various cucumber downy mildew prevention effects more than 53.55%, growth-promoting effect highly significant;And the resistance of plant can be significantly put forward, and leaves of plants can be significantly improved and enclose microbial diversity, improve Tiny ecosystem.

Description

Improvement Phyllosphere of cucumber Tiny ecosystem prevents and treats enterobacteria 3bh19 and its application of downy mildew
Technical field
The invention belongs to plant protection art, it is related to be prevented and treated for improvement Phyllosphere of cucumber Tiny ecosystem the enterobacteria of downy mildew 3bh19 and its application.
Background technology
Cucumber (Cucums sativus L.) belongs to Curcurbitaceae (Cucurbitaceae), Cucumis in Plant Taxonomy (Cucums) it is, one of global ten big vegetable growing crops, critical role is occupied in China's the "shopping basket' project.According to the United Nations Food and Agriculture Organization counts, and from 2000 to 2004, China's cucumber cultivation area was from 116 549 hectares of (hm2) increase to 1 502 900 hectares of (hm2), yield increases to 25 558 000 million tons (Mt) from 19 869 181 million tons (Mt).With field Between facility plastic greenhouse it is prevailing, there is huge change in cucumber cultivation mode.According to incompletely statistics, current China cucumber is most of uses The facility plastic greenhouse plantation in field, while bringing tremendous economic income to vegetable grower, to plant protection expert it is also proposed that being directed to disease control High request.As China industrial crops and vegetable at protected field area extend rapidly, wherein especially cucumber is this simultaneous with vegetables The famous bulk vegetable of fruit.In the facility plastic greenhouse green cucumber of field, the disease for often occurring has gray mold of cucumber, cucumber mosaic virus Viral disease, powdery mildew of cucumber, cucumber bacterial angular leaf spot, cucumber downy mildew and cucumber root-knot nematode, cucumber fusarium axysporum etc., wherein especially Popular fast with cucumber downy mildew, morbidity weight, difficulty of prevention and cure is big.Its leaf diseases because its condition is suitable and vegetable continuous cropping and it is increasingly tight Weight, wherein downy mildew Host transfer, are 10-30% in big Tanaka's average attack rate;Facility plastic greenhouse average attack rate 50%, severe one Total crop failure.
Cucumber downy mildew is caused by Cuba artificial downy mildew (Pseudoperonospora cubensis), is the whole world In the range of one of main leaf diseases in cucumber producing region, the whole world about more than 70 a country successively there is this disease, to Huang Melon production threatens very big.During disease investigation being carried out to Beijing periphery, Shandong, Hebei and other places, it has been found that the disease causes harm sternly Weight, in serious greenhouse of falling ill, up to more than 85%, fruit development is slow, yield reduction for sick leaf rate, is caused to peasant very big Economic loss.Only Hebei Qing County spring greenhouse investigation, cucumber downy mildew occurring area is lost more than 20,000,000 more than 1330hm2 First (Li Baoju, 2008);Investigated in yellow sky brilliance village Vegetable Base according to Jiangsu Tongzhou agricultural station, 2 Huangs of cucumber booth The melon downy mildew canopy incidence of disease is 33.33%, and sick leaf rate average 5%, the Xin San Yuan of March 22 villages investigate 10 cucumber booths, canopy The incidence of disease 50%, sick leaf rate average 10.98% is early stage (Jiangsu Tongzhou, 2009);In Jiangsu Huaian, cucumber is mould White disease is that occur that the most common, duration is long, harm most serious diseases in heliogreenhouse facility plastic greenhouse, is also that current cucumber is used The maximum disease of dose, causes the underproduction up to 20%-40%, or even total crop failure (Liu Feng, 2011) throughout the year.
The generation and induction raising crop anti-adversity ability that disease is controlled using environmental beneficial microorganism are in the last few years The focus of research, especially these microorganisms are environmentally safe, cause scientists using biological control means control disease, And the interest of reply poor environment.Enterobacteria (Enterobacter sp.), can produce in the growth course of its own A series of metabolite, these metabolites enable that enterobacteria has the activity for widely suppressing fungi and bacterium, or Person's inducing plant resistance.It can by different way or approach influence plant many metabolic processes, increase plant roots it is long, change plant Thing Root morphology is built up, and promotes absorption of the root system to moisture content and nutrient, and enterobacteria can improve the resistance against diseases of plant, support Anti-microbial pathogen infects.
Enterobacteria be distributed in nature it is very wide, while inhibitory action can be produced to various fungies and bacterium.Cause This, has broad application prospects in terms of biological control, the traditional chemical pesticide of replacement that can be appropriate.Meanwhile, with point The raising of sub- investigative technique, the gene function of enterobacteria is more appreciated that, increases applicable feasibility.And fermentation condition Optimization cause enterobacteria large-scale application also possess objective condition.
The content of the invention
The purpose of the present invention is directed to the deficiency of existing preventing and treating preventing and treating cucumber downy mildew, there is provided a kind of environmental protection can be carried Broad-spectrum plant diseases prevention high, growth-promoting, the enterobacteria 3bh19 of Tiny ecosystem improvement.
It is a further object of the present invention to provide the application of the enterobacteria.
The purpose of the present invention can be achieved through the following technical solutions:
Biocontrol microorganisms 3bh19 is enterobacteria (Enterobacter sp.).For various cucumber diseases preventions, growth-promoting, degeneration-resistant, micro- life The biocontrol microorganisms 3bh19 of state improvement, the strain classification was named as enterobacteria (Enterobacter sp.), on 06 13rd, 2016 China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in, culture presevation number is CGMCC NO.12608.
Described enterobacteria 3bh19 promotes cucumber overground part or underground part to grow and carry preferably in preventing and treating cucumber downy mildew High-quality, the application improved in its resistance, Tiny ecosystem improvement;Described resistance be selected from drought resisting, cold-resistant, it is heat-resisting, waterlogging in One or more.
Microbial inoculum prepared by enterobacteria 3bh19 of the present invention.
Microbial inoculum of the present invention, is preferably prepared by the following method and obtains:By enterobacteria 3bh19 described in claim 1 28 DEG C of 180rpm shaken cultivation 12-16h in LB nutrient solutions, then 6000rpm centrifugation 10min obtain thalline, entered with aqua sterilisa Row dilution is made microbial inoculum, and viable bacteria total concentration is 1 × 10 in microbial inoculum finished product9-1×1010CFU/mL。
Described microbial inoculum is enclosed by pouring root or leaf and sprays treatment.
Beneficial effect
The present invention prevents and treats cucumber downy mildew using the microbial bacterial agent to environment nonhazardous, there is provided a kind of environmental protection Enterobacteria microbial inoculum, promotes growth and the improve quality and to improve its resistance (including drought resisting, cold-resistant, heat-resisting, waterlogging of cucumber plant Deng the bad climate such as resistance cold spell in later spring).The problems such as solving other method effect on driving birds is not good such as chemical agent or have residual, protects Retaining ring border, promotes agricultural sustainable development.
After the enterobacteria 3bh19 preparation root irrigations it is long to the plant height and root of cucumber have significantly improve, have to plant There are certain growth-promoting functions, through the cucumber of 3bh19 treatment compared with control group, the 30th day biomass compares increasing with control after treatment Plus more than 32%.Enterobacteria microbial inoculum, can room temperature preservation -1 year 6 months.The plant greenhouse diseases prevention of enterobacteria 3bh19 microbial inoculums treatment promotees Raw result of the test shows that more than 62.32% is up to diseases control, and the plant field diseases prevention of enterobacteria 3bh19 microbial inoculums treatment promotees Raw result of the test shows, is up to more than 53.55% to diseases control, and can improve the quality of cucumber, improves leaf and encloses micro- life The diversity of thing.
Brief description of the drawings
Fig. 1, enterobacteria 3bh19 microbial inoculums process the biocontrol effect to cucumber downy mildew
The influence of Fig. 2, the treatment of enterobacteria 3bh19 microbial inoculums to cucumber biomass
The influence of Fig. 3, the treatment of enterobacteria 3bh19 microbial inoculums to cucumber resistance
Fig. 4, the treatment of enterobacteria 3bh19 microbial inoculums are analyzed Phyllosphere of cucumber sample DGGE
1-3 swimming lanes:3bh19 bacterial strain 0d Phyllosphere of cucumber bacteria samples (3 repeat);4-6 swimming lanes:3bh19 bacterial strain 30d cucumber leafs Enclose bacteria samples (3 repeat);7-9 swimming lanes:Control 0d Phyllosphere of cucumber bacteria samples (3 repeat);10-12 swimming lanes:Control 30d Phyllosphere of cucumber bacteria samples (3 repeat);Arrow is new band.
Biomaterial preservation information
Enterobacteria 3bh19, is enterobacteria (Enterobacter sp.).Chinese micro- life was preserved on 06 13rd, 2016 Thing culture presevation administration committee common micro-organisms center, culture presevation number is CGMCC NO.12608, address:Beijing is exposed to the sun The institute of microbiology of the Chinese Academy of Sciences of institute of area North Star West Road 1.
Specific embodiment
The molecules identification of the enterobacteria 3bh19 of embodiment 1
After bacterial genomes kit (SBS Genetech company) extracts bacterial gene DNA, with gyrB universal primer gyrB1 (5'- GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA-3');gyrB2R(5'– AGCAGGATACGGATGTGCGAGC CRTCNACRTCNGCRTCNGTCAT-3') gyrB genes are amplified from genomic DNA Fragment.Specific amplification system and program (25ul) are as follows:Each 1 μ l of primer 1,2 (10 μM);Mix:12.5μl;Taq:0.5μl. ddH2O:10μl;Template:1μl.94 DEG C of predegenerations 5min, 94 DEG C of denaturation 1min, 56 DEG C of annealing 2min, 72 DEG C extend 2m in, 35 Individual circulation, 72 DEG C of extension 10min, 4 DEG C of preservations.Pcr amplification product detected with 1% agarose gel electrophoresis, 90V, 30min;EB dyes 30min, detects amplified production.Amplified production is connected to pMD19-T carriers after purification, convert in Escherichia coli DH5 α, extract positive colony plasmid, and NCBI (Natio nal are submitted in the sequencing of commission TaKaRa companies to Center for Biotechnology Information) compare.Enterobacteria (E is accredited as according to comparison result nterobacter sp.)。
Embodiment 2
It is a kind of to improve cucumber downy mildew biological control effect and growth-promoting, degeneration-resistant, Tiny ecosystem improvement enterobacteria 3bh19, Containing microbe composition:Enterobacteria 3bh19 (preserving number is CGMCC NO.12608).By being separated in the Cucumber rhizosphere soil of Huaian Arrive.
The preparation method of enterobacteria 3bh19 microbial inoculums is as follows:
Enterobacteria 3b,h19 28 DEG C of 180rpm shaken cultivation 12-16h in LB nutrient solutions, then 6000rpm centrifugation 10min Thalline is obtained, thalline is diluted with aqua sterilisa is made microbial inoculum, viable bacteria total concentration is 1 × 10 in microbial inoculum finished product9-1× 1010CFU/mL。
Greenhouse growth-promoting experiments of the enterobacteria 3bh19 of embodiment 3 to cucumber
Method:To be participated in the experiment cucumber seeds 10%H2O2Surface sterilization 10min, sterilized water dries standby after cleaning.Each battalion Support alms bowl and sow 10 seeds.Normally water after managing 4 weeks, by the consistent transplantation of seedlings of growing way to 330ml plastic cups, incited somebody to action during transplanting The enterobacteria 3bh19 microbial inoculums for having suspended are with 1.0 × 107The concentration pouring root of CFU/mL is applied to crop root, every plant of 30mL amount.So After be placed in greenhouse cultivate, 28 DEG C, 70% relative humidity.Using clear water treatment as control, every group of young plant for the treatment of 48 is put at random Put, altogether in triplicate.The biomass such as cucumber plant plant height, stem thick, fresh weight, dry weight are determined after 30d.
Influences of the enterobacteria 3bh19 of table 1 to cucumber biomass
Note:Different lowercase persons represent the significant difference in 0.05 level.
As seen from the above table, said preparation has significantly to long to the plant height and root of cucumber after enterobacteria 3bh19 root irrigations Improve, there are certain growth-promoting functions to plant, through the cucumber of 3bh19 treatment compared with control group, the 30th day biology after treatment Amount is compared with control and increases above 32%.
Cucumber downy mildew greenhouse diseases prevention experiments of the enterobacteria 3bh19 of embodiment 4 to cucumber
To be participated in the experiment cucumber seeds 10%H2O2Surface sterilization 10min, sterilized water dries standby after cleaning.Each nutritive cube 10 seeds of sowing.Normally water after managing 4 weeks, by the consistent transplantation of seedlings of growing way to 330ml plastic cups, treat that it grows 10 True leaf carries out spraying treatment.Often treatment sets 4 repetitions, and each repeats 48 seedlings.Treatment group sprays what 30ml suspended per young plant 1.0×107The enterobacteria 3bh19 aqueous solution of CFU/mL concentration, control group equivalent aqua sterilisa is sprayed in the same way;It is each above Individual treatment group adds final concentration of 0.01% surfactant Tween-20 when spraying.5d is sprayed in the way of spraying treatment Inoculum density is 105The cucumber downy mildew pathogen of individual sporangium/ml.Disease severity is investigated after inoculation pathogen 15d and is counted Calculate biocontrol effect.Disease survey method:0 grade:Without illness;1 grade:Vaccination has slight scab, and its diameter is less than 0.5cm;3 grades: Lesion diameter 0.5-1.3cm;5 grades:Vaccination yellow area accounts for cotyledon area below 1/2, and necrosis area accounts for less than 1/3;7 grades: Necrotic plaque area accounts for leaf area 1/3-2/3;9 grades:Necrotic plaque area accounts for leaf area more than 2/3 or complete stool is withered.
Disease index (%)=[∑ (the sick series × sick level plant number)/(highest disease level × total plant number)] × 100;
Biocontrol effect (%)=[(control disease severity-treatment group disease severity)/control disease severity] × 100
Influences of the enterobacteria 3bh19 of table 9 to cucumber plant
Note:Different lowercase persons represent the significant difference in 0.05 level.
Result of the test shows that enterobacteria 3bh19 can significantly reduce the disease severity of greenhouse cucumber downy mildew, to disease Preventive effect is up to 62.32%, and can significantly improve yield and quality.
The preventing and treating fruit cucumber downy mildew of the enterobacteria 3bh19 microbial inoculums of embodiment 5 treatment and raising fruit yield experiment
To be participated in the experiment cucumber seeds 10%H2O2Surface sterilization 10min, sterilized water dries standby after cleaning.
During cucumber seeds after vernalization are seeded in equipped with basin Portland in aseptic soil, per one, basin, soil is kept before sowing More dry.When tomato grew to for 2 leaf phase, field is transplanted to, every group of young plant for the treatment of 48 is randomly placed, by the intestines bar for having suspended Bacterium 3bh19 biocontrol agents are with 1.0 × 107The concentration of CFU/mL is sprayed for crop leaf portion, and cucumber growth-promoting, diseases prevention are counted after 30d And disease control result.Disease survey method:0 grade:Without illness;1 grade:Vaccination has slight scab, and its diameter is less than 0.5cm;3 Level:Lesion diameter 0.5-1.3cm;5 grades:Vaccination yellow area accounts for cotyledon area below 1/2, and necrosis area accounts for less than 1/3;7 Level:Necrotic plaque area accounts for leaf area 1/3-2/3;9 grades:Necrotic plaque area accounts for leaf area more than 2/3 or complete stool is withered.
Disease index (%)=[∑ (the sick series × sick level plant number)/(highest disease level × total plant number)] × 100;
Biocontrol effect (%)=[(control disease severity-treatment group disease severity)/control disease severity] × 100
Result of the test shows that the disease severity of cucumber downy mildew can significantly drop in enterobacteria 3bh19, and its average preventive effect reaches 59.96%;And yield and quality can be significantly improved.
Influences of the enterobacteria 3bh19 of table 9 to cucumber plant
Note:Different lowercase persons represent the significant difference in 0.05 level.
Influences of the 3bh19 of table 10 to cucumber quality
Note:Different lowercase persons represent the significant difference in 0.05 level.
The induced resistance experiment of the enterobacteria 3bh19 microbial inoculums of embodiment 6 treatment
Method:To be participated in the experiment cucumber seeds 10%H2O2Surface sterilization 10min, sterilized water dries standby after cleaning.
During cucumber seeds after vernalization are seeded in equipped with basin Portland in aseptic soil, per one, basin, soil is kept before sowing More dry.When cucumber grew to for 6 leaf phase, by the enterobacteria 3bh19 biocontrol agents for having suspended with 1.0 × 107CFU/mL's is dense Degree pouring root is applied to crop root, is subsequently placed at culture in greenhouse, and arid of cutting off the water supply is carried out after 1 month, and drought stress continues 15d, Normally watered after drought stress, observe the restoration ecosystem situation of cucumber seedling.Every group of young plant for the treatment of 48, randomly places, and altogether repeatedly 3 It is secondary.Put according to randomized complete-block design in greenhouse.
Water after carrying out restoration ecosystem 1d, enterobacteria 3bh19 treatment group plant restore normal growth, and and control group plant It is all dead.
Influences of the enterobacteria 3bh19 of table 11 to drought resistance in plants
Note:Different lowercase persons represent the significant difference in 0.05 level.
The Tiny ecosystem improved test of the enterobacteria 3bh19 microbial inoculums of embodiment 7 treatment
Method:To be participated in the experiment cucumber seeds 10%H2O2Surface sterilization 10min, sterilized water dries standby after cleaning.
During cucumber seeds after vernalization are seeded in equipped with basin Portland in aseptic soil, per one, basin, soil is kept before sowing More dry.When tomato grew to for 2 leaf phase, field is transplanted to, every group of young plant for the treatment of 48 is randomly placed, be repeated 3 times altogether.Treat 30d After (10 leaf), by the enterobacteria 3bh19 biocontrol agents for having suspended with 1.0 × 107The concentration of CFU/mL is sprayed for crop leaf portion, The sampling of 30d rear blades (carries out mark, in case the new leaf influence for growing) in advance, and the leaf of biocontrol microorganisms is sprayed with sterilizing scissors clip Son.The leaf sample fetched respectively claim to be transferred under 10g, aseptic condition 100ml eluents (0.1mol/L kaliumphosphate buffers, PH7.0), 15 DEG C of 200r/min concussions 30min, ultrasonically treated 5min in ultrasonic washing instrument.Collect eluent, 4 DEG C of 10000r/ M in are centrifuged 20min, collect precipitation, are extracted as microbial DNA.Plant phyllospheric is directly extracted using improved chemical cleavage method Genomic DNA, method is as follows:The plant phyllospheric microorganism for taking the above-mentioned collections of 0.2g is suspended in 800 μ L lysates, adds 5 μ The Proteinase K of L20mg/ml, 37 DEG C of warm bath 30min;Adding 20% SDS solution makes its final concentration of 2%, mixing, 60 DEG C Concussion 4-5 times is taken out during warm bath 1h, warm bath;Isometric chloroform is added, is mixed, 1000r/min centrifugations 8min;In supernatant 0.6 times of isopropanol of volume is added, is stood overnight under normal temperature, 12000r/min centrifugations 20min;Supernatant is abandoned, is resuspended in after drying In 30 μ L TE buffer solutions.Bacterium is expanded using 16SrDNA sequence V3 section Specific PCR primers F338-GC and R518: F338-GC:5-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCA CGGGGGGACTCCTACGGGAGGCAGCAG-3′, R518:5′-GCGTGTGTACAAGACCC-3′.Primer is synthesized by Beijing SBS Genetech gene technology Co., Ltd.PCR primer is about 230bp.PCR response procedures are:94℃,7min;94℃,30s;55℃,30s;72 DEG C, 30s, 35 circulations;72℃,7min;4 DEG C preserve.PCR reaction systems are:50 μ l systems, Buffer5 μ l;The μ l of DNA profiling 1;Mg2+4μl;dNTP 4μl;Each 0.8 μ of primer l;The μ l of Taq DNA polymerase 0.8;The μ l of deionized water 33.6.Primer is synthesized by Beijing SBS Genetech gene technology Co., Ltd.PCR is produced Thing is about 260bp.PCR response procedures are:94℃,5min;94℃,30s;56℃,30s;72 DEG C, 90s, 35 circulations;72℃, 10min;4 DEG C of preservations.Denaturing gradient gel electrophoresis (DGGE) analysis that PCR primer is carried out, DGGE is in DCode abrupt climatic changes system Completed in system (Dcode Universal Mutation Detection System) (B io-Rad).Concentrated with the PCR of 25 μ L Product carries out DGGE, use denatured gradient for 30%~60% 8% acrylamide gel (chemical denaturant be 100% urine The deionized formamide of plain 7mol L-1 and 40% (v/v)) in 1 × TAE electrophoretic buffers, 130V voltages, electrophoresis at 60 DEG C 7h.10~15min of Silver stain is used after electrophoresis, is then taken pictures with Al phimager systems.Treatment point is analyzed to DGGE collection of illustrative plates Analysis, using Quantity One analysis softwares (Bio-Rad) determine sample electrophoresis band number and band brightness peak value, obtain To the dendrogram of DGGE collection of illustrative plates, the change of cucumber different growing rhizosphere Tiny ecosystem is determined.
As a result (Fig. 4) display:Enterobacteria 3bh19 can significantly improve the diversity of Phyllosphere of cucumber microorganism.

Claims (7)

1. one plant of enterobacteria 3bh19, the strain classification was named as enterobacteria (Enterobacter sp.), in 06 month 2016 13 It is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center day, culture presevation number is CGMCC NO.12608。
2. the enterobacteria 3bh19 described in claim 1 is preventing and treating cucumber downy mildew, the growth of promotion cucumber and improve quality, is carrying Its resistance high, improvement leaf enclose the application in the microbial inoculum of Tiny ecosystem.
3. application according to claim 2, it is characterised in that described enterobacteria 3bh19 promotees in preventing and treating cucumber downy mildew Enter cucumber plant overground part or underground part growth and improve quality and/or improve its drought resisting, cold-resistant, heat-resisting, waterlogging, Tiny ecosystem and change Application in good microbial inoculum.
4. the microbial inoculum for being prepared with the enterobacteria 3bh19 described in claim 1.
5. microbial inoculum according to claim 4, it is characterised in that be prepared by the following method and obtain:By described in claim 1 Enterobacteria 3b,h19 28 DEG C of 180rpm shaken cultivation 12-16h in LB nutrient solutions, then 6000rpm centrifugation 10min obtain thalline, It is diluted with aqua sterilisa and is made microbial inoculum, viable bacteria total concentration is 1 × 10 in microbial inoculum finished product9-1×1010CFU/mL。
6. microbial inoculum described in claim 4 or 5 promotes cucumber overground part or underground part to grow and improve product in preventing and treating cucumber downy mildew Matter, the application improved in its resistance, Tiny ecosystem improvement.
7. application according to claim 6, it is characterised in that described microbial inoculum sprays treatment by pouring root and leaf portion.
CN201710101720.0A 2017-02-24 2017-02-24 Improve enterobacteria 3bh19 and its application of Phyllosphere of cucumber Tiny ecosystem prevention and treatment downy mildew Active CN106834180B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710101720.0A CN106834180B (en) 2017-02-24 2017-02-24 Improve enterobacteria 3bh19 and its application of Phyllosphere of cucumber Tiny ecosystem prevention and treatment downy mildew

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710101720.0A CN106834180B (en) 2017-02-24 2017-02-24 Improve enterobacteria 3bh19 and its application of Phyllosphere of cucumber Tiny ecosystem prevention and treatment downy mildew

Publications (2)

Publication Number Publication Date
CN106834180A true CN106834180A (en) 2017-06-13
CN106834180B CN106834180B (en) 2019-09-13

Family

ID=59133455

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710101720.0A Active CN106834180B (en) 2017-02-24 2017-02-24 Improve enterobacteria 3bh19 and its application of Phyllosphere of cucumber Tiny ecosystem prevention and treatment downy mildew

Country Status (1)

Country Link
CN (1) CN106834180B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115104617A (en) * 2022-07-27 2022-09-27 淮阴师范学院 Composition for preventing and treating cucumber fusarium wilt
CN115354003A (en) * 2022-08-25 2022-11-18 安徽省农业科学院园艺研究所 Bacterial strain for promoting high-density growth of cucurbit and reducing cadmium absorption and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102321561A (en) * 2011-10-12 2012-01-18 淮阴师范学院 Biocontrol strain CYW72 for controlling greenhouse cucumber downy mildew and application thereof
CN102428964A (en) * 2011-09-26 2012-05-02 南京农业大学 Bio-control combined bacterium agent CB28 admixture for preventing cucumber downy mildew
CN102533610A (en) * 2012-02-09 2012-07-04 河北省农林科学院植物保护研究所 Bacillus subtilis for preventing and treating cucumber ampho disease, and microbial agent thereof
CN105907689A (en) * 2016-07-01 2016-08-31 淮阴工学院 Biocontrol strain for preventing and controlling cucumber downy mildew and biocontrol microbial agent prepared by biocontrol strain

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102428964A (en) * 2011-09-26 2012-05-02 南京农业大学 Bio-control combined bacterium agent CB28 admixture for preventing cucumber downy mildew
CN102321561A (en) * 2011-10-12 2012-01-18 淮阴师范学院 Biocontrol strain CYW72 for controlling greenhouse cucumber downy mildew and application thereof
CN102533610A (en) * 2012-02-09 2012-07-04 河北省农林科学院植物保护研究所 Bacillus subtilis for preventing and treating cucumber ampho disease, and microbial agent thereof
CN105907689A (en) * 2016-07-01 2016-08-31 淮阴工学院 Biocontrol strain for preventing and controlling cucumber downy mildew and biocontrol microbial agent prepared by biocontrol strain

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115104617A (en) * 2022-07-27 2022-09-27 淮阴师范学院 Composition for preventing and treating cucumber fusarium wilt
CN115354003A (en) * 2022-08-25 2022-11-18 安徽省农业科学院园艺研究所 Bacterial strain for promoting high-density growth of cucurbit and reducing cadmium absorption and application thereof
CN115354003B (en) * 2022-08-25 2023-12-19 安徽省农业科学院园艺研究所 Strain for promoting high-density growth of cucurbits and reducing cadmium absorption and application thereof

Also Published As

Publication number Publication date
CN106834180B (en) 2019-09-13

Similar Documents

Publication Publication Date Title
CN104726383B (en) Bacillus amyloliquefaciens JK6 and bio-fertilizer and application
CN104531559B (en) Bacillus amyloliquefaciens Lh 1 and its application
CN101250495B (en) Plant pathogenic fungi antagonistic bacteria strain and its use in control of plant diseases
CN105907680B (en) A kind of bacillus subtilis J-5 and its bacteria agent and application
CN109825457B (en) Salt-tolerant bacillus E40207a2 and application thereof
CN106479938B (en) A kind of Brevibacillus brevis bacterial strain and its application
CN114231444B (en) Salt-tolerant bacillus and application thereof
CN105950506A (en) Bacillus amyloliquefaciens for preventing and curing tomato bacterial wilt and application of bacillus amyloliquefaciens
CN106635921B (en) Bacillus amyloliquefaciens Y15 and its application
KR20130056585A (en) Plant growth promotion by using bacterial strains isolated from roots of miscanthus sacchariflorus
CN107365710A (en) One plant of Metarhizium Strains and its application to hazelnut weevil with High pathogenicity
CN106834180B (en) Improve enterobacteria 3bh19 and its application of Phyllosphere of cucumber Tiny ecosystem prevention and treatment downy mildew
CN102604869B (en) Bio-control bacteria strain 1JN2 for preventing and treating bacterial fruit blotches of watermelons and application thereof
CN109749953B (en) Bacillus cereus, microbial inoculum and preparation method and application thereof
CN109609403B (en) Biocontrol bacterium and application thereof in prevention and control of downy mildew of crops
CN107858300A (en) For the diseases prevention of tomato, growth-promoting, quality-improving and degeneration-resistant bacillus amyloliquefaciens 2YN11 and its application
CN101323842A (en) Breeding method of disease-resistant and high-yield cotton and use
CN106754529A (en) The bacillus amyloliquefaciens of one plant of antagonism matrimony vine root rot and its application
CN107841474B (en) Pond-borne dalfot bacterium and application thereof in prevention and treatment of rice false smut
CN104962501A (en) Preparation and application of bacterial strain resistant to gray mould of vegetables and fruits and antagonist
CN112760264B (en) Enterobacter cloacae strain and application thereof
CN111837766B (en) Method for controlling pathogen of seedling phlobacterium phlogistii by composite microorganism treatment and application
CN114467975A (en) Application of staphylococcus equi in prevention and treatment of fruit and vegetable diseases
CN107217016A (en) One plant has the endophytic Bacillus bacterial strain ZY122 for suppressing rice sheath blight disease and its application
CN106701624A (en) Fructus lycii root rot-resistant bacillus tequilensis and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20220321

Address after: 212000 building 30, R & D center, No. 99, Chuqiao Road, New District, Zhenjiang City, Jiangsu Province

Patentee after: Zhenjiang Ulu Biotechnology Co.,Ltd.

Address before: 223300 No. 111 Changjiang West Road, Huaiyin District, Jiangsu, Huaian

Patentee before: HUAIYIN NORMAL University

EE01 Entry into force of recordation of patent licensing contract
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20170613

Assignee: Zhenjiang Guangwei Biotechnology Co.,Ltd.

Assignor: Zhenjiang Ulu Biotechnology Co.,Ltd.

Contract record no.: X2023320000158

Denomination of invention: Improving the Microecology of Cucumber Leaf Surrounding to Control Downy Mildew by Enterobacterium 3bh19 and Its Application

Granted publication date: 20190913

License type: Common License

Record date: 20230626

Application publication date: 20170613

Assignee: Nanjing lvzheng Biotechnology Co.,Ltd.

Assignor: Zhenjiang Ulu Biotechnology Co.,Ltd.

Contract record no.: X2023320000157

Denomination of invention: Improving the Microecology of Cucumber Leaf Surrounding to Control Downy Mildew by Enterobacterium 3bh19 and Its Application

Granted publication date: 20190913

License type: Common License

Record date: 20230626