CN106823467A - A kind of zearalenone aptamers affinity column and its production and use - Google Patents
A kind of zearalenone aptamers affinity column and its production and use Download PDFInfo
- Publication number
- CN106823467A CN106823467A CN201710049292.1A CN201710049292A CN106823467A CN 106823467 A CN106823467 A CN 106823467A CN 201710049292 A CN201710049292 A CN 201710049292A CN 106823467 A CN106823467 A CN 106823467A
- Authority
- CN
- China
- Prior art keywords
- aptamers
- zearalenone
- carrier
- affinity column
- gel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
- B01D15/08—Selective adsorption, e.g. chromatography
- B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
- B01D15/38—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving specific interaction not covered by one or more of groups B01D15/265 - B01D15/36
- B01D15/3804—Affinity chromatography
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N1/00—Sampling; Preparing specimens for investigation
- G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
- G01N1/34—Purifying; Cleaning
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Solid-Sorbent Or Filter-Aiding Compositions (AREA)
Abstract
The present invention relates to a kind of zearalenone aptamers affinity column and its production and use.Then the affinity purification post carries out covalent coupling using the solid phase carrier of chemical modification with the aptamer and carrier of zearalenone.Then affinity column is loaded.The aptamers affinity column is mainly useful for the purifying of the zearalenone in food, feed, milk, blood sample and other various samples, in order to the later stage to the high performance liquid chromatography of zearalenone in sample（HPLC）Detection and fluoroscopic examination.
Description
Technical field
Aptamers affinity column the present invention relates to a kind of zearalenone and its production and use.Category food security
Detection field.
Background technology
Zearalenone (zearalenone, ZEN), also known as F-2 toxin, is a kind of 2,4- dihydroxy-benzoic acids
Lactone compound, has an estrogen active, and chemical name is 6- (10- hydroxyl -6- epoxide carbenes base)-β thunders lock acid-μ-interior
Ester.It is by the mycotoxin of the generations such as Fusarium graminearum and fusarium culmorum.It is widely present in nature, the life to animal
Long hair gives birth to important effect, is acted on very strong female hormone, can cause many animals such as pig, rat, mouse, poultry
With the hyperestrogenism syndrome of people, also with Reproductive and developmental toxicity, immunotoxicity, genotoxicity and suspicious carcinogenicity etc..It is main
The grain cereal crops such as corn, wheat, barley are polluted,.Plcinta is raised to the cereal of nearly 20 countries in the world and animal
Mycotoxin levels in material have done an investigation, in the cereal and animal feed of discovery most countries all to some extent
By ZEN pollution and cause poisoning for poultry, the ground such as Jiangsu, Sichuan, Hebei, suburb of Shanghai of China also occurred because
ZEN causes the event that pig is poisoned.For the harm for controlling ZEN to produce humans and animals, to 2003, in the world 19
ZEN unifies limit standard during individual country has worked out ZEN limit standards in food, and European Union formulated food in 2005.
For example in Australia's regulation cereal, no more than 50ng/g, Italy's regulation is in the middle of cereal and cereal product for the content of ZEN
The content of ZEN is no more than 100ng/g, and the content of ZEN have to be lower than 200ng/ in the middle of France, vegetable oil and cereal
g .At present, China not yet sets up the national standard detection method of ZEN in food, is protection Chinese in world's grain trade
Economic interests and consumer health, in the urgent need to set up determine ZEN national standard detection method, and work out its limitation mark
It is accurate.
The detection method of current zearalenone has TLC, high performance liquid chromatography（HPLC）, enzyme linked immunological
Absorption method（ELISA）, enzyme-linked immunosorbent assay etc..
Wherein TLC is to use the method for being also most widely used detection zearalenone, its advantage earliest
The human users not by special training, and low cost are suitable for, without expensive instrument,.But thin-layer chromatography
Method is cumbersome to sample treatment, and experimentation is complicated, and required detection cycle is more long, is easily disturbed by impurity.Mesh during measure
Sxemiquantitative is surveyed, subjective impact is larger, and sensitivity is not high, and modern measure requirement far can not be met.
EUSA（EL ISA ）Detection method detection is special, quick, sensitivity is high and cost is relatively low.
The characteristics of low cost, suitable for the screening and generaI investigation of a large amount of samples of infrastructure, time and expense can be greatlyd save, therefore more
More to be welcome by Inspection Unit of basic unit.The subject matter of ELISA method is to easily cause false positive.Therefore it is mainly used in base
The examination detection of layer.
High performance liquid chromatography (HPLC) has the advantages that the degree of accuracy is high, sensitivity strong, can microdetermination, be conventional at present
In the method for sitotoxismus element detection.But because its requirement to toxin purity in sample is higher, cause that testing cost is high, the cycle
It is long, batch samples cannot be met quickly the need for screening, so using being restricted.The affine in immunity that this year grows up
Post-high performance liquid chromatography（IAC-HPLC)）Immunoaffinity purification technology is combined with high performance liquid chromatography.Make the use of HPLC
It is more extensive.Immune affinity column applies more and more extensive as a kind of new purification techniques in the analysis detection of mycotoxin.
It is that specific antibody is attached to filling on the solid phase carrier of activation to form.It is therein when sample extracting solution passes through pillar
Antigen is combined with antibody, and other impurities are then washed off by the aqueous solution, then by antigen is that toxin eluent gets off with organic solvent, so that
The toxin in sample is set to be purified.[the J Chromatogra2phy A, 1998,815 such as Angelo:133~140.9]
Corn sample is extracted with the water of acetonitrile 2 (90: 10), is purified with VicamZEN immune affinity columns, and examined with reversed-phase HPLC
Survey.It is 93 %~99. 5 % in the rate of recovery of the mark-on level of 0. 1~10 μ g/ g, relative standard deviation is 6 %, detection
It is limited to 3 ng/ g, signal to noise ratio 3: 1.
Immune affinity column has simple to operate, specificity advantage high.But because antibody obtains difficult, immune affinity column
It is typically relatively expensive.And it is in itself a kind of protein due to antibody, its activity is affected by the ambient.Preserve it is improper or
Person's misoperation easily causes antibody inactivation so as to influence the efficiency of immune affinity column.
Aptamers are one section of nucleotide sequences, usually DNA or RNA sequence.Single-stranded nucleotide sequence can form two grades
Structure, so as to be specifically bound with target spot.By multiple enrichment and screening, can screen has high-affinity with target spot
Specific aptamers.Herman etc. describes the binding specificity of aptamer, [Science 287,820-825] nucleic acid
Aptamers are more stable for antibody, are not easily susceptible to the influence of environment, and aptamer can be with chemical synthesis, it is ensured that
The accuracy of sequence.[Song. Trends Analy. Chem 2008.27(2)].
Aptamer is applied to the detection of small molecule, in patent CN105505940A, describes a kind of aspergillus flavus
The aptamers DNA sensor of toxin B1.Prepare DNA and pass by the aptamers of AFB1, and a plurality of complementary probe sequences
Sensor, is reacted by zymolyte, realizes the detection of AFB1.In patent CN105400790A, a kind of Huang is described
The detection method of aspertoxin.Combined with invertase using the aptamers of AFB1, it is mutual with sugared substrate by enzyme
Effect, the detection of AFB1 is realized by blood glucose meter.The above-mentioned detection for being all to be realized using aptamers mycotoxin.
The report for carrying out mycotoxin separation using aptamers is less, in patent CN104399283, describes a kind of Huang
The aptamers affinity column of aspertoxin B1.The agarose microbeads of the patent utilization epoxy-activated, by the suitable of AFB1
Ligand coupling, is prepared into affinity column.Realize the separation of AFB1.
The content of the invention
It is an object of the invention to provide a kind of zearalenone aptamers affinity column and its production and use
In the present invention, we utilize SELEX systems, and high specific, a high-affinity are screened from aptamers library
New zearalenone DNA aptamers.The carrier activated with N-hydroxy-succinamide after aptamers modification passes through
Covalent bond is coupled.The idiosyncratic carrier of zearalenone is obtained by washing and closing.It is formed after carrier dress post
The zearalenone aptamers affinity column of high-affinity
The affinity column is easy to operate, purifying corn zeranol efficiency high.Organic solvent is resistant to, and can be reused.
Sample obtains purity zearalenone very high by can be carried out purifying after simple treatment.For high-efficient liquid phase color
Spectrum detection and luminoscope detection.
Concrete operations are as follows：
Maximum advantage of the invention is exactly the characteristic that make use of aptamer, by steps such as enrichment, washing, the amplifications taken turns more
Suddenly, the specific aptamers for zearalenone are filtered out.The sequence of aptamers is obtained by sequencing
Aptamer for antibody, with adapt to environment extensively, be resistant to high temperature, be resistant to organic solvent and
Easy to operate the advantages of.Topmost, aptamers need not move through the process in animal body in preparation process, but by changing
Synthesis is learned to obtain.Therefore, it is with short production cycle, and the accuracy of sequence can be ensured by synthesis condition
The affinity column prepared based on aptamer has specificity good, and zearalenone binding capacity is big, purification efficiency
High the characteristics of.
Zearalenone aptamers affinity column and preparation method thereof is described as follows
1. N-hydroxy-succinamide is selected（NHS）The agarose carrier sepharose4B of modification, is activated
The agarose of 1gN- HOSu NHSs modification is taken, the HCl with 50ml 1mM is added, after swelling 30min, gel is used
100ml 1mM HCl are washed 6 times, then use 100ml milli-Q waters
2. the Ago-Gel sepharose4B coupling buffers that will have been activated（The NaHCO of 0.1M3, 0.8M NaCl,
PH8.2）Washing 3 times.The amido modified zearalenone aptamers of 20mol/L, room temperature are added to be coupled 8 hours
3. the phosphate buffer PBS washings 3 of the zearalenone aptamers that will be coupled-agarose carrier 20mM, PH7.4
It is secondary
4. close
The Tris.Cl PH8.0 of 100mmol/L, room are added in the zearalenone aptamers-agarose carrier that will be coupled
Temperature reaction 2 hours
5. the phosphate buffer PBS washings 3 of the zearalenone aptamers that will have been closed-agarose carrier 20mM, PH7.4
It is secondary
6. post is filled
Zearalenone-agarose carrier is fitted into chromatographic column as needed, the jade of different capabilities can be as needed prepared
Zearlenone affinity column.The structure of chromatographic column is as shown in Figure 1.
Compared with prior art, the invention has the advantages that：
1. the present invention sufficiently make use of the advantage of aptamer, by the screening and enrichment of many wheels.High specific is obtained
The zearalenone aptamer of high-affinity.The aptamers can be in specific combination sample Gibberella zeae alkene
Ketone, reduces the cross reactivity that antibody affinity column is frequently encountered.Affine column efficiency is increased substantially
Aptamer is not influenceed by operating environment and organic solvent, be especially suitable for Aflatrem liposoluble substance it is pure
Change.Compare, due to the not organic solvent-resistant of the antibody in immune affinity column, organic solvent can usually cause the inactivation of antibody and make
Affine column efficiency reduction
Further, since organic solvent causes antibody to inactivate, therefore immune affinity column is usually single use.And aptamer
Affinity column can tolerate organic solvent, can be reused many times, and considerably reduce use cost
2. the aptamer that the present invention is used can be obtained by chemical synthesis, it is ensured that the correctness of sequence.Significantly
Degree reduces the variation between different batches.And comparatively, the antibody of different batches comes from different mouse or rabbit, lead
Qualitative variability is larger between causing antibody, affinity column quality is there is difference
3. easy to operate using purifying corn zeranol of the present invention, several steps can be obtained by purity Gibberella zeae alkene higher
Ketone.More convenient operator uses
4. the zearalenone purity for being obtained using product of the invention is very high, subsequently can without doing other purification process again
To be directly used in high performance liquid chromatography detection or fluoroscopic examination.Save time and the expense of operator.
Brief description of the drawings
Fig. 1：Zearalenone aptamers affinity column structural component schematic diagram
A：Injection port plug；B：Piston adaptor；C：Stable ferrule；D：Upper sieve plate；E：Cylinder；F：Carrier filler； G：Lower sieve plate；H：
Outlet plug
Fig. 2：Zearalenone aptamers affinity column appearance assumption diagram
A：Injection port plug；B：Piston adaptor；C：Stable ferrule；D：Upper sieve plate；E：Cylinder；F：Carrier filler； G：Lower sieve plate；H：
Outlet plug
Fig. 3：The liquid chromatographic detection figure of zearalenone standard items is added in corn sample
Fig. 4：The liquid chromatographic detection figure of zearalenone standard items is added in Feed Sample.
Specific embodiment
Embodiment 1：Affinity column is prepared using amido modified zearalenone aptamers
The preferred embodiment that the present invention prepares zearalenone aptamers affinity column is as follows：
1. support-activated
Selection N-hydroxy-succinamide（NHS）The agarose carrier sepharose4B of modification, is activated
The agarose of 1gN- HOSu NHSs modification is taken, the HCl with 50ml 1mM is added, after swelling 30min, gel is used
100ml 1mM HCl are washed 6 times, then use 100ml milli-Q waters
2. the Ago-Gel sepharose4B coupling buffers that will have been activated（The NaHCO of 0.1M3, 0.8MNaCl,
PH8.2）Washing 3 times.The amido modified zearalenone aptamers of 20mol/L, room temperature are added to be coupled 8 hours
3. the phosphate buffer PBS washings 3 of the zearalenone aptamers that will be coupled-agarose carrier 20mM, PH7.4
It is secondary
4. close
The Tris.Cl PH8.0 of 100mmol/L, room are added in the zearalenone aptamers-agarose carrier that will be coupled
Temperature reaction 2 hours
5. the phosphate buffer PBS washings 3 of the zearalenone aptamers that will have been closed-agarose carrier 20mM, PH7.4
It is secondary
6. post is filled
Zearalenone-Ago-Gel after crosslinking is resuspended with 10 milliliters of 20mM PBS PH7.4, it is then charged into sky
In affinity purification post cylinder
1) cylinder of sky is taken, lower screening deck is added, 1mlPBS is added, it is drained off naturally
2) lower section outlet plug is added, the zearalenone aptamers-agarose after adding the above-mentioned treatment of 1ml in cylinder coagulates
Glue carrier, static 5 minutes, makes carrier natural subsidence
3) upper screening deck is added, sieve plate is pressed, it is reached carrier top
4) piston adaptor is added, adapter has a pressuring action, upper screening deck is close to carrier
5) stable ferrule is enclosed within cylinder from below, it is close to injection port
6) outlet plug is pulled out, 5mlPBS is taken with syringe, syringe is connected on injection port, PBS is slowly injected into parent
In post, use liquid speed degree and be maintained at 1-2 drops/sec.Until whole liquid injection affinity columns
7) outlet plug is put, injection port plug is put, the zearalenone aptamers affinity column that will be prepared is put into 4 DEG C of guarantors
Deposit.
Embodiment 2：Affinity column is prepared using the zearalenone aptamers of biotin modification
The preferred embodiment that the present invention prepares zearalenone aptamers affinity column is as follows：
1. 1ml Streptavidins are taken（SA）The Ago-Gel sepharose4B of modification, with 10ml milli-Q waters 3 times
2. will（SA）The Ago-Gel sepharose4B coupling buffers of modification（The PBS of 0.02M, 0.8M NaCl,
PH7.4）Washing 3 times.The zearalenone aptamers of the biotin modification of 20mol/L, room temperature are added to be coupled 4 hours
3. the phosphate buffer PBS washings 3 of the zearalenone aptamers that will be coupled-agarose carrier 20mM, PH7.4
It is secondary
4. post is filled
Zearalenone-agarose carrier is fitted into chromatographic column as needed, the jade of different capabilities can be as needed prepared
Zearlenone affinity purification post
1) cylinder of sky is taken, lower screening deck is added, 1mlPBS is added, it is drained off naturally
2) lower section outlet plug is added, the zearalenone aptamers-agarose after adding the above-mentioned treatment of 1ml in cylinder coagulates
Glue carrier, static 5 minutes, makes carrier natural subsidence
3) upper screening deck is added, sieve plate is pressed, it is reached carrier top
4) piston adaptor is added, one pressuring action of adapter makes upper screening deck be close to carrier
5) stable ferrule is enclosed within cylinder from below, it is close to injection port
6) outlet plug is pulled out, 5mlPBS is taken with syringe, syringe is connected on injection port, PBS is slowly injected into parent
In post, use liquid speed degree and be maintained at 1-2 drops/sec.Until whole liquid injection affinity columns
7) outlet plug is put, injection port plug is put, the zearalenone aptamers affinity column that will be prepared is put into 4 DEG C of guarantors
Deposit.
Embodiment 3：The Gibberella zeae alkene in corn sample is purified and detected using zearalenone aptamers affinity column
Ketone
The present embodiment is quantitatively adding the standard items of zearalenone using normal corn sample, then uses zearalenone
Aptamers affinity column is purified, and high performance liquid chromatography detection is used after purification.Determine the rate of recovery
1. corn sample treatment
According to every gram of standard of the nanogram of sample 60, zearalenone standard items are added in corn sample after being pulverized
1) extract
--- -20g ± 0.01g samples（Solid sample needs to crush, and crosses 2mm sub-sieves）, add 100mL extract solutions（80% acetonitrile-
The aqueous solution）Mix；
----high speed homogenization（≥10,000r/min）1min, or shaking table（200r/min~300r/min）20min is acutely vibrated,
Filtered with fast qualitative filter paper, collect filtrate；
----take 10mL filtrates add 40mL 0.01M PBST dilutions, then are filtered with microfibre filter paper, and collect filtrate as upper
Sample liquid；
----take 25mL sample solutions cross affine in immunity column purification
Extension rate：1
2) purify
----immune affinity column is connected under 10.0 ml disposable syringes.According to pre-treatment requirement, corresponding body is accurately pipetted
In long-pending sample extracting solution injection disposable syringe, air pressure pump is connected regulation switch with glass syringe, makes liquid
Flowed out with 1~2 drop/sec of speed；
----after after drain, washing 10mL with the 0.1%Tween-20 aqueous solution first, then washed with distilled water or deionization
Wash 10mL, 2~3 drops/sec of flow velocity；
----after syringe after drain, is more renewed, loading 2ml acetonitriles connect eluent, 1 drop/sec of flow velocity with scale test tube；
--- liquid nitrogen is blown near dry under the conditions of 30 DEG C after-wash-out；
----dissolved with 10% acetonitrile solution and constant volume is to 1ml；
--- eluent is transferred to sample bottle and is analyzed for HPLC after being filtered with 0.22 μm of millipore filter
2. eluted product is detected with high-efficient liquid phase chromatogram HPLC
High performance liquid chromatography detection result shows, from testing result as can be seen that being added in corn sample after the crushing of 1g
The zearalenone of 60ng, can be returned by 60.6ng with aptamers affinity column of the invention.The rate of recovery is 101%.Chromatogram
See accompanying drawing 3.
Embodiment 4：The Gibberella zeae alkene in Feed Sample is purified and detected using zearalenone aptamers affinity column
Ketone
1. pre-treatment
According to every gram of standard of the nanogram of sample 500, zearalenone standard items are added in corn sample after being pulverized；
1) 25g ± 0.01g samples（Solid sample needs to crush, and crosses 2mm sub-sieves）Add 5g sodium chloride and 125mL extract solutions
（70% methanol-water solution）Mix；
2) high speed homogenization（≥10,000r/min）1min, or shaking table（200r/min~300r/min）Acutely vibration 20min, uses
Fast qualitative filter paper is filtered, and collects filtrate；
3) 10mL filtrates are taken and adds 20mL distilled water dilutings（Liquid pH value after dilution should ensure that between 6 ~ 8, can use 1M
" NaOH " or " HCl " is adjusted）, then filtered with microfibre filter paper, and filtrate is collected as sample solution；
4) 15mL sample solutions are taken and crosses affine in immunity column purification
2. purify
1) affinity column is connected under 10.0 ml disposable syringes.According to pre-treatment requirement, the sample of respective volume is accurately pipetted
In product extract solution injection disposable syringe, air pressure pump is connected regulation switch with glass syringe, makes liquid with 1~2
Drop/sec speed outflow；
2) after after drain, washed with distilled water or deionized water 2 times, each 10mL；
3) after after drain, loading 1mL methyl alcohol, 1 drop/sec of flow velocity collects eluent and is settled to 1mL；
4) eluent is transferred to sample bottle and is analyzed for HPLC after being filtered with 0.22 μm of millipore filter；
5) testing result see the table below
Chromatogram is shown in accompanying drawing 4.
Embodiment 5：Zearalenone aptamers affinity column reuses the change of column capacity
Then the present embodiment is carried out using the standard items of quantitative zearalenone with zearalenone aptamers affinity column
Purifying.After zearalenone on affinity column is eluted with organic solvent, with its concentration of high performance liquid chromatography detection.Affinity column weight
Loading and wash-out are repeated after new balance, the zearalenone concentration of wash-out is determined.Main purpose is test zearalenone
The reusability of aptamers affinity column
1. the zearalenone standard items of 5ug/ml are prepared
2. zearalenone aptamers affinity column is taken out, injection port plug is opened, injection port is connected with injector syringe, syringe
It is linked on gas control crosshead
3. outlet plug is opened, affinity column is washed 3 times with 10mmol/L PBS PH7.4,10 milliliters every time, regulation stomata operation
Frame air pump pressure, makes liquid be flowed out with 3 drops/sec of flow velocity
4. the zearalenone standard items of the above-mentioned preparations of 100ul are taken, and total amount 5ug is added in affinity column post, adjusts flow to 1-
2 drops/sec.Until sample all flows out affinity column
5. distillation water washing purification column 3 times, every time 5 milliliters is used
6. 1ml methyl alcohol is added, eluted product is collected
7. eluted product is detected with high-efficient liquid phase chromatogram HPLC
8. affinity column milli-Q water 3 times, then each 10ml washs affinity column 3 times, often with 10mmol/L PBS PH7.4
Secondary 10 milliliters
9. loading 100ul zearalenones standard items, total amount 500ng again
10. washed according to aforesaid operations and eluted, eluted product its concentration of high performance liquid chromatography detection
11. repeat step 8.9.10 tri- times.Detect the concentration of eluted product
The rate of recovery of the 12. zearalenone aptamers affinity column purifying for calculating 5 times altogether
High performance liquid chromatography detection the results are shown in Table 4：
It can be seen from the results above that after zearalenone aptamers affinity column reuses 5 times, its binding ability is not bright
Aobvious reduction.
Zearalenone aptamers sequence
5’-TTCACGGTAGCACGCATAGGCATATCACATTACAGATAGTAATGTACCATAGATAGATGACATCTGACCT
CTGTGCTGCT-3’ -3
Claims (12)
1. a kind of affinity column of zearalenone, it is characterised in that include carrier and zearalenone aptamers.
2. the affinity column according to claim 1, it is characterised in that aptamers are coupled on carrier by chemical bond.
3. the affinity column according to claim 1, it is characterised in that described aptamers are aptamers, more specifically
It is oligodeoxynucleotide aptamers.
4. the aptamer according to claim 3, it is characterised in that described aptamers sequence is described by sequence 1
Nucleotide sequence.
5. aptamers according to described in claim 1, it is characterised in that aptamers are by the aptamers of chemical modification.
6. aptamers according to described in claim 5, it is characterised in that modification mode is including but not limited to amido modified, carboxylic
Base modification, sulfydryl modification and biotin modification.
7. the aptamers affinity column according to claim 1, it is characterised in that described carrier be Ago-Gel or
The solid phase carrier of chemical synthesis.
8. the affinity column according to claim 5, it is characterised in that described Ago-Gel is including but not limited to N- hydroxyls
The succinimide activated Ago-Gel of base, the Ago-Gel of cyanogen bromide-activated, Ago-Gel, the polyacrylic acid of crosslinking
Ago-Gel,.
9. the solid phase carrier carrier of the chemical synthesis according to described in claim 5, including but not limited to polystyrene, porous
Polystyrene and cross-linked porous polystyrene filler.
10. a kind of affine column preparation method of purifying corn zeranol, it is characterised in that
Carrier after selection N-hydroxy-succinamide activation, carrier dry powder is lived with the hydrochloric acid soaked overnight of 1mmol/L
Change
Every gram of carrier of activation adds the aptamers of 30-200nmol, in 0.1M NaHCO3, the buffer solution of 0.5M NaCl PH8.3
In, room temperature is coupled 2 hours；Or 4 DEG C of couplings are overnight
Coupled product 8.0 room temperature reactions of 1M Tris.HCl PH 2 hours
Carrier-the aptamers being coupled, are washed with the PBS of 20mM PH7.4
Zearalenone aptamers-carrier conjugation product is washed with the 10mM PBS PH7.4 containing 0.01% thimerosal, is filled
Post, is put in 4 DEG C of preservations.
A kind of 11. affinity columns of zearalenone, its purposes is to the enrichment of the zearalenone in thing to be checked and pure
Change.
12. things to be checked according to claim 11, it is characterised in that thing to be checked is including but not limited to grain, feed, milk
And dairy products, aquatic products, blood, urine and water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049292.1A CN106823467A (en) | 2017-01-23 | 2017-01-23 | A kind of zearalenone aptamers affinity column and its production and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049292.1A CN106823467A (en) | 2017-01-23 | 2017-01-23 | A kind of zearalenone aptamers affinity column and its production and use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106823467A true CN106823467A (en) | 2017-06-13 |
Family
ID=59120987
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710049292.1A Pending CN106823467A (en) | 2017-01-23 | 2017-01-23 | A kind of zearalenone aptamers affinity column and its production and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106823467A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112920152A (en) * | 2019-12-06 | 2021-06-08 | 中国科学院大连化学物理研究所 | High-efficiency preparation chromatographic method for removing zearalenone from natural vitamin E |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009041776A2 (en) * | 2007-09-27 | 2009-04-02 | Korea University Industrial & Academic Collaboration Foundation | Dna aptamer binding to oxytetracycline with specificity and production method thereof |
| WO2011020198A1 (en) * | 2009-08-21 | 2011-02-24 | Neoventures Biotechnology Limited | Dna ligands for aflatoxin and zearalenone |
| CN104730172A (en) * | 2013-12-20 | 2015-06-24 | 中国医学科学院药用植物研究所 | New purification method and testing technology of ochratoxin A in traditional Chinese medicines |
| CN105126793A (en) * | 2015-08-18 | 2015-12-09 | 华南师范大学 | Preparation method for organic/inorganic hybrid quartz capillary monolithic column modified by single-chain DNA nucleic acid aptamer |
-
2017
- 2017-01-23 CN CN201710049292.1A patent/CN106823467A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009041776A2 (en) * | 2007-09-27 | 2009-04-02 | Korea University Industrial & Academic Collaboration Foundation | Dna aptamer binding to oxytetracycline with specificity and production method thereof |
| WO2011020198A1 (en) * | 2009-08-21 | 2011-02-24 | Neoventures Biotechnology Limited | Dna ligands for aflatoxin and zearalenone |
| CN104730172A (en) * | 2013-12-20 | 2015-06-24 | 中国医学科学院药用植物研究所 | New purification method and testing technology of ochratoxin A in traditional Chinese medicines |
| CN105126793A (en) * | 2015-08-18 | 2015-12-09 | 华南师范大学 | Preparation method for organic/inorganic hybrid quartz capillary monolithic column modified by single-chain DNA nucleic acid aptamer |
Non-Patent Citations (1)
| Title |
|---|
| 丁金凤等主编: "《基因分析和生物芯片技术》", 31 January 2004, 湖北科学技术出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112920152A (en) * | 2019-12-06 | 2021-06-08 | 中国科学院大连化学物理研究所 | High-efficiency preparation chromatographic method for removing zearalenone from natural vitamin E |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Weller | Immunochromatographic techniques–a critical review | |
| Xu et al. | Separation and screening of compounds of biological origin using molecularly imprinted polymers | |
| US6794148B2 (en) | High speed, automated, continuous flow, multi-dimensional molecular selection and analysis | |
| CN106970172A (en) | A kind of aflatoxin aptamers affinity column and its production and use | |
| CN103157439B (en) | Mycotoxin composite immunosorbent, immunoaffinity column and kit, and applications thereof | |
| CN107063820A (en) | A kind of T2 toxin aptamers affinity column and its production and use | |
| CN108251427A (en) | Aflatoxin B2Aptamers affinity column and preparation method and application | |
| CN107262074A (en) | A kind of deoxynivalenol aptamers affinity column and its production and use | |
| Zhang et al. | Immunoaffinity chromatography purification and ultrahigh performance liquid chromatography tandem mass spectrometry determination of tetrodotoxin in marine organisms | |
| CN103160471B (en) | Ochratoxin A hybridoma cell strain, antibody, compound immunoadsorbent, immunoaffinity column, kit and applications of immunoadsorbent, immunoaffinity column and kit | |
| AU2019101761A4 (en) | An aptamer affinity column of Alternariol and preparation method and application thereof | |
| CN103160470B (en) | Hybridoma cell strain, antibody, immunoadsorbent, immunoaffinity column, kit and applications of immunoadsorbent, immunoaffinity column and kit | |
| Vera-Avila et al. | Determination of carbofuran in surface water and biological tissue by sol–gel immunoaffinity extraction and on-line preconcentration/HPLC/UV analysis | |
| Li et al. | Establishment of an immunoaffinity chromatography for simultaneously selective extraction of Sudan I, II, III and IV from food samples | |
| CN104117228B (en) | A kind of 6-(10-hydroxy-6-oxo-trans-1-undecenyl)-.beta.-resorcylic acid lactone immune affinity column and its production and use | |
| CN108169471A (en) | Aflatoxin B1 and B2 aptamers affinity columns and preparation method and application | |
| CN104117227B (en) | A kind of deoxynivalenol immune affinity column and its production and use | |
| CN102258987B (en) | Preparation and use of dehydro methyltestosterone immunoaffinity column with chitosan (CTS) as vector | |
| Lecas et al. | Affinity chromatography: A powerful tool in drug discovery for investigating ligand/membrane protein interactions | |
| CN106823467A (en) | A kind of zearalenone aptamers affinity column and its production and use | |
| CN106693443A (en) | Vitamin B12 aptamer affinity column, and preparation method and application thereof | |
| CN104383889B (en) | A kind of Dihydrocapsaicin polyclonal antibody adsorbent, immune affinity column and its preparation method and application | |
| CN106984067A (en) | A kind of ochratoxin aptamers affinity column and its production and use | |
| CN104181300B (en) | A kind of fumonisin immune affinity column and its production and use | |
| Aerts et al. | Determination of residues of carbadox and some of its metabolites in swine tissues by high-performance liquid chromatography using on-line pre-column enrichment and post-column derivatization with UV—VIS detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170613 |
|
| RJ01 | Rejection of invention patent application after publication |