CN106754964B - The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application - Google Patents
The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application Download PDFInfo
- Publication number
- CN106754964B CN106754964B CN201710030300.8A CN201710030300A CN106754964B CN 106754964 B CN106754964 B CN 106754964B CN 201710030300 A CN201710030300 A CN 201710030300A CN 106754964 B CN106754964 B CN 106754964B
- Authority
- CN
- China
- Prior art keywords
- rfn
- gene
- leu
- cabbage type
- type rape
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention provides separation clone, functional verification and the applications of a kind of cabbage type rape cytoplasmic male sterility restoring gene.The cabbage type rape nap cytoplasmic male sterility restoring gene Rfn that the present invention separates, nucleotide sequence is as shown in SEQ ID NO:1, and the amino acid sequence that it is encoded is as shown in SEQ ID NO:2.The gene belongs to the member of PPR gene family, is the gene of a constitutive expression.Rfn conversion is imported to the rape for not containing nap cytoplasm restoring gene, the plant of fertility restorer can be obtained.The phenomenon that clone of restoring gene Rfn and verifying can be used for cabbage type rape Elite inbred and conventional variety breeding, solve some materials pollen is insufficient under cryogenic, yield decline.
Description
Technical field
The invention belongs to field of plant genetic project technology, and in particular to a kind of cabbage type rape nap cytoplasmatic male is not
Educate restoring gene and its application.
Background technique
Male plant reproductive organs cannot generate normal andro gamete i.e. pollen the phenomenon that referred to as male sterility, have male
The plant of sterile gene or crop lines are known as sterile line.And some strains hybridize with sterile line and can generate with normal fertility
Plant, these plants or crop lines are known as restorer.It is miscellaneous to make paternal hybrid progress using sterile line work female parent and restorer
It hands over, the cenospecies of preparing high-purity can be matched.Therefore, sterile line and restorer have important value in crop hybrid breeding.
For male sterility and its fertility restorer research in multiple kinds of crops such as rice, wheat, corn and soybean, rape
Deng it has been reported that being widely used to cenospecies production in production.Male sterile hereditary basis includes what karyogene controlled
The cytoplasmic male sterility of nuclear male sterility (Genic male sterility, abbreviation GMS) and cytoplasm control
(Cytoplasmic male sterility, abbreviation CMS).The side being cross-breeding using CMS and its fertility restorer characteristic
Method is commonly referred to as " three line method ", i.e. sterile line, restorer and holding system.Wherein sterile line has special base in mitochondrial genomes
Because of the cytoplasmic male sterility characteristic of control.Restorer has the cytoplasm of normal cytoplasm or infertility, and pollen is normally fertile,
Selfing can be solid, its main feature is that carrying restoring gene (fertility restorer gene, abbreviation in Matrix attachment region
Rf).Keep system that there is normal cytoplasm, pollen is normally fertile, but does not carry functional restoring gene in its Matrix attachment region.
There are many types, such as homologous cytoplasm type nap CMS and pol CMS for cabbage type rape cytoplasmic male sterility；It is different
Source cytoplasm type has ogu CMS, tour CMS, hau CMS etc..Pol CMS, ogu CMS and tour CMS at home and abroad rape
There is wide application in crossbreeding.Due to the equal recovery base containing nap CMS in most of cabbage type rape cultivar
It thus shows as fertile.Only a small number of kinds show as infertility or partial sterility due to lacking restoring gene Rfn, while nap
CMS sterile plant be changing under relatively high temperature conditions part it is fertile or completely it is fertile (Fan and Stefan,
1986) application of the system in cross rape production, is limited.However it is selected in cabbage type rape self-mating system or conventional variety
During educating, often there is kind the phenomenon that sectional fructification occur.Specific manifestation are as follows: under cryogenic conditions, effective inflorescence section part flower
Flower bud when not yet open, that is, yellowing and shedding, or can normally bloom but be unable to that normal development is solid, and some flowers are i.e. enabled develops into angle
Fruit, but each silique only has a small amount of seed, and it is then solid completely normal in the higher situation of temperature.This will lead to invalid angle
Fruit increases, yield decline.
Summary of the invention
The purpose of the present invention is to provide a cabbage type rape cytoplasmic male sterility restoring gene Rfn, utilize the base
Cause can restore the fertility of cabbage type rape nap CMS, or as molecular labeling, promote cabbage type rape Elite inbred and routine
Breed breeding.
In order to achieve the object of the present invention, inventor is by a large number of experiments research and unremitting effort, finally from Wild cabbage type oil
Isolated a kind of restoring gene Rfn of cabbage type rape nap CMS in dish, SEQ ID in nucleotide sequence such as sequence table
Shown in NO:1.
According to ordinary skill in the art means, the present inventor can be using the polynucleotide sequence cloned as spy
Needle, screening obtains gene or homologous gene of the invention from genome or cDNA library.Equally, use round pcr can also be with
Amplification obtains gene or any one section of interested nucleotide sequence or homologous with it of the invention from genome and cNDA
Nucleotide sequence.Therefore, under strict conditions with nucleotide sequence hybridization shown in SEQ ID NO:1 in sequence table and coding phase
The nucleotide sequence of congenerous protein also belongs to the restoring gene sequence of cabbage type rape nap CMS.
Further, any one of the above nucleotide sequence is prominent through nucleotide addition, the conservative deleted, replace, modified
The conservative variant for becoming and obtaining also belongs to the restoring gene sequence of cabbage type rape nap CMS.
In addition, the present invention also provides a kind of albumen for expressing cabbage type rape cytoplasmic male sterility restoring gene Rfn,
Its amino acid sequence is nucleotide sequence coded by any one of the above.It is further preferred that the expression cabbage type rape cell
The albumen of matter fertility restorer gene Rfn, amino acid sequence is as shown in SEQ ID NO.2 in sequence table.
Furthermore the present invention also provides the equipotentials of above-mentioned cabbage type rape cytoplasmic male sterility restoring gene Rfn a kind of
Gene, nucleotide sequence it is selected from the following any one:
(1) nucleotide sequence shown in SEQ ID NO.3 in sequence table；
(2) nucleotide of the nucleotide sequence hybridization and coding identical function protein that are limited under strict conditions with (1)
Sequence；
(3) conservative mutation of the nucleotide sequence limited with (1) or (2) through nucleotide addition, deletion, replacement, modification
And the conservative variant obtained.
Finally, the present invention also provides above-mentioned cabbage type rape cytoplasmic male sterility restoring gene Rfn in Wild cabbage type
Application in rape genetic improvement.And the allele of above-mentioned cabbage type rape cytoplasmic male sterility restoring gene Rfn
Application in cabbage type rape genetic improvement.
Compared with prior art, present invention firstly provides the restoring gene Rfn of cabbage type rape nap CMS a kind of, should
Gene belongs to the member of PPR gene family, is the gene of a constitutive expression.Rfn conversion is imported and does not contain nap cytoplasm
The rape of restoring gene can obtain the plant of fertility restorer.The clone of restoring gene Rfn and verifying can be used for cabbage type rape
Elite inbred and conventional variety breeding, the phenomenon that solving some materials pollen is insufficient under cryogenic, yield decline.Separately
Outside, the molecular labeling for the close linkage that the sequence with cabbage type rape restoring gene Rfn sequence itself or nearby generates, can be used for
Cabbage type rape self-mating system and conventional variety molecular marker assisted selection breeding.
Detailed description of the invention
Fig. 1 is the form under cabbage type rape nap cytoplasmic male sterile line and its restorer condition of different temperatures.
Fig. 2 is the local genetic linkage map in the site cabbage type rape nap cytoplasmic male sterile line restoring gene Rfn.
Fig. 3 is the deliberate genetic linkage map in the site cabbage type rape nap cytoplasmic male sterile line restoring gene Rfn.
Fig. 4 is the physical map for covering cabbage type rape nap cytoplasmic male sterility restoring gene Rfn section.
Fig. 5 has complementary functions for cabbage type rape and tests expression vector pFGC-Rfn carrier schematic diagram.
Fig. 6 is the T with 181A genetic background0For fertility phenotype and 181A after genetic transformation cabbage type rape plant blossom
The comparison of phenotype.181A genetic transformation T0The candidate gene that dominant gene Rfn is carried for plant shows as filigree elongation, fertility
Restore, the dyeing of pollen grain aceto-camine is normal.
Fig. 7 is transgenic positive individual plant selfing offspring's strain PCR identification and fertility coseparation analysis.F is fertile plant, and S is
Sterile plant, N are negative control, and P is positive plasmid control, and M is DL2000 molecular weight standard.
Specific embodiment
Below in conjunction with specific embodiment, the present invention will be further described.It is explained in the following description many specific thin
Section is to fully understand the present invention.But the invention can be embodied in many other ways as described herein, this
Field technical staff can do similar improvement without violating the connotation of the present invention, therefore protection scope of the present invention is to weigh
Subject to sharp claim, do not limited by following public specific implementation.If experimental method used in following is without specified otherwise,
For the existing conventional method of the art and technology, used agent prescription or material are obtained by commercial sources.
The discovery and genetic analysis of 1 cabbage type rape nap cytoplasmic male sterile line of embodiment and its restorer
Inventor has found in cabbage type rape breeding process, containing the cytoplasmic Elite inbred 181-1 of nap opposite
Petal shrinkage when low temperature, stamen development is abnormal, and stamen development returns to normal (figure under conditions of temperature is relatively high
1).Found by a large amount of test crosses, Elite inbred H5 can under cryogenic single-minded recovery 181-1 to normal stamen phenotype,
H5 and pol sterile line 1141A, 245A, 7492A filial generation keep infertility.H5 hybridizes F with 181-11It is obtained with 181-1 backcrossing
The BC obtained1The band fertile and sterile segregation ratio for showing as 1:1 under cryogenic, F1Self progeny under cryogenic it is fertile and
Infertility shows as the segregation ratio (table 1) of 3:1.It is subsequent that 181-1 is named as 181A.
The genetic analysis of 1 cabbage type rape nap cytoplasmic male sterility restoring gene of table
*χ2(0.05,1)=3.84
The finely positioning of 2 cabbage type rape nap cytoplasmic male sterility restoring gene of embodiment
1. experimental material:
The parent material of finely positioning of this experiment for cabbage type rape nap cytoplasmic male sterility restoring gene be
181A and H5.Hybridized by 181A with H5 and obtains F1Plant, by F1Plant selfing obtains F2Group, in planted in fall in 2012 in force
The Chinese, spring in 2013 extract the DNA (extract the method for DNA referring to Stewart and Via, 1993) of 225 sterile single plants,
Primary Location for Rfn gene.Simultaneously by F1Building BC is returned with 181A1Group, in planted in fall in 2013 in Wuhan,
Spring in 2014 extracts 5,652 BC1The DNA of single plant, the finely positioning for gene.
2. the finely positioning of restoring gene Rfn:
According to previous studies as a result, cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and pol cytoplasm male
Property sterile restoring gene Rfp may be same karyogene site not iso-allele and haplotype (Li et al., 1998).
Applicant using the primer screening and Rfn chain molecular labeling during pol CMS fertility restorer gene mapping, discovery 6 with
The molecular labeling of Rfn close linkage.
6 are as shown in the table with the sequence of the molecular labeling of Rfn close linkage:
BrIP24F:ATCAGTCCCTCTGATCGGCT
BrIP24R:GCGACCTGAAGTTGGACGA
BrIP47F:GACGCACCTCAAGCCAAAG
BrIP47R:GGCTACGACATTCCCACCA
BrIP53F:CGTTTGGACAAGTTTTCACG
BrIP53R:CTTTGAACTATTGCCGGTGA
BrIP59F:GAATCTGGTGAAGGCAGTAAC
BrIP59R:TCTCCTCTTTCTTACCTGCTG
BrIP63F:TGGGATGCTCTGTTTCTGAC
BrIP63R:GATCTAGCCGAGTGTAAGCG
BrSC39F:TAATGCGAATTTTCAGGGGT
BrSC39R:ATGGACCAGGCTTTACTTCC
Applicant is according to above 6 labels in F2Group's sterile plant genotype call results are detected according to each label
Single plant number is exchanged, calculates the recombination fraction between label and the site Rfn, and count using Kosambi function (Kosambi, 1944)
Genetic distance is calculated, local linkage map as shown in Figure 2 is drawn.It was found that these labels are respectively positioned on the side in the site Rfn.
For the label for obtaining the other side and Rfn gene linkage, applicant is according to the sequence of target area (with the Chinese cabbage of announcement
Genome sequence is classified as reference) it designs and identifies the chain polymorphism mark of Rfn.Molecular labeling BrIP47 and BnSR21 are in BC1
79 and 25 exchange single plants are detected in group respectively, recombination (figure has occurred between two labels and Rfn in these single plants
4).Then exchange single plant to be analyzed with remaining label, the nearest label in discovery two sides is BnSR33 and BrIP77, two
Label has 4 respectively and 2 single plants show between label and Rfn and exchange (Fig. 3).By the above finely positioning, Rfn gene is determined
Cabbage type rape is with reference in the range of genome about 10.5kb in position.The nucleotide sequence of primer for finely positioning Rfn is such as
Shown in table 2.
The nucleotide sequence of the primer of 2. finely positioning Rfn gene of table
Separation, conversion and the functional verification of 3 restoring gene Rfn candidate gene of embodiment
1. the determination of restoring gene Rfn candidate gene
Blast that the program of the sequence alignment used in the present embodiment is provided from Chinese cabbage genome website (http: //
Brassicadb.org/brad/blastPage.php) software is analyzed the sequence of candidate section 10.5kb, therefrom in advance
Survey the candidate gene ORF2 of a coding PPR albumen.According to reference genome sequence, develops corresponding primer and amplify target base
Because of the genome sequence of ORF2.Restriction enzyme site analysis is carried out to ORF2 gene order, finds it without containing EcoR I and BamH I
Restriction enzyme site.The primer ORF2F (R) of amplification gene overall length is designed, left and right primer adds the digestion of EcoR I and BamH I respectively
Site, using High fidelity PCR polymerase, (Phusion High-Fidetity DNA Potymerse comes from New England
Biolabs company) expand the segment for obtaining a 5,620bp.
ORF2F (forward primer): CGgaattcGTCCAACCACAATGGCTTTAAC
ORF2R (reverse primer): CGggatccATTGCTAAGGCGAATCCGGTTG
Amplified fragments include sequence, the sequence of gene interval 1,890bp and the downstream of upstream region of gene non-translational region 2,019bp
The sequence of non-translational region 1,711bp.Amplified fragments plastic recovery kit (be purchased from Promega company) recycling, with EcoR I and
Target fragment is recycled after BamH I double digestion, is connected on the expression vector pFGC5941 through EcoR I and BamH I double digestion
(Fig. 5), connection product convert coli strain DH5 α, and conversion is screened on the LB culture medium containing 50ug/ml kanamycins
Son, picking individual colonies extract plasmid, and determine that core former times acid sequence is completely correct with detecting by sequencing, successfully construct conversion and plant
The carrier (Fig. 5) of strain.Correct fusion plasmid pFGC-Rfn is transferred in GV3101 agrobacterium strains (this by the method for electrotransformation
The bacterial strain of laboratory long-term preservation), it is chosen on the solid medium containing 50 μ g/ml kanamycins and 50 μ g/ml gentamicins
Take monoclonal, and carry out PCR detection confirmation positive colony after, which is saved in -80 DEG C, be used for cabbage type rape
Genetic transformation.
The conventional Agrobacterium-mediated Transformation method of rape genetic transformation use (Chen Wei etc., 2006；Cardoza and Stewart,
2003).The alcohol of Seed sterilization 70% impregnates seed 15min, and 0.1% mercuric chloride sterilizes 15min, sterile water wash 3 times, every time between
Every 5min.The seed of sterilizing is sowed at 0 culture medium of Medium (formula is shown in Table 3), in 25 DEG C of dark culture 5d.In superclean bench
The interior segment that the hypocotyl of seedling is cut into 0.5-0.8cm is containing Agrobacterium (suspending overnight to logarithmic growth phase)
On Dilution Medium after (formula is shown in Table 3) dip dyeing 25-30min, liquid is blotted, co-cultures 2d under 25 DEG C of dark conditions.
Explant is transferred on callus inducing medium Medium 1 (formula is shown in Table 3), in 25 DEG C of illumination cultivation 7-10d.Again
Explant is transferred on differential medium Medium 2 and is cultivated, every 2-3 weeks subculture 1 time, until differentiation budding.The bud that will be differentiated
Lower end cutting, which is inserted on screening and culturing medium Medium3, screens 2 weeks, then the bud of survival is transferred to root media Medium 4
To after taking root, plantation keeps 70% relative humidity in being mixed in nutritive cube humous for upper culture, transplants after root development is stablized
To crop field.
Extract resistant plant blade total DNA (preparation method is shown in: Stewart et al., 1993), with primer Rfn-F and
Rfn-R further identifies transformed plant by PCR.Transgenosis T0The performance of generation observation fertility, verifies the candidate gene of importing
Function.As the result is shown in 19 plants of transgenosis T0It is extended in plant, there is 9 plants to show as filigree, fertility restorer (Fig. 6).By T0Dai Zhi
Strain self progeny is sowed at big Tanaka, and Post flowering investigates plant fertility, and extracts blade total DNA (Stewart et al., 1993),
It is identified with primer Rfn-F and Rfn-R through PCR, it may be determined that gene insert and plant fertility isolate (Fig. 7).For turning base
Because the primer sequence of positive plant detection is respectively as follows:
Rfn-F:GTTCTTGCTGTAAAGCGTTGT
Rfn-R:GTTGCGTTTTCATTGCTTGTC
The various culture medium prescriptions used in genetic transformation step of table 3
SEQUENCE LISTING
<110>Hua Zhong Agriculture University；Wuhan Liannong Seeds Technology Co., Ltd
<120>clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 1890
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 1
atgttgtgtc ggagattggt gcttgtgtct cgtatccccc tgagtcctgt tggtactctt 60
gcaactcctt tgctctcttt tatcagatcc tcatgcgaac gaggctactc tggtctcggc 120
agcgatagaa atctctcatc ttacaaagag agactgagaa gtggtctggt cgatatcaag 180
aagaaggatg ctgtagctct gtttcagtcc atgattaggt ctcgtcctct tcctacggtc 240
atggatttca ataaactgtt tagtgcagta gccagaacga aacagtatga tctcgtgttg 300
gatctctgca agcaaatgga actgcaaggg attgcacata gcatttacac gctgagtatt 360
atgatcaatt gcttctgccg cctccagaaa ctcggttttg ctttttctgt gatgggaaag 420
atgttgaagc ttgggtatga gcccgacaca atcacattct caactttgat caacggttta 480
tgtctggtgg gtagagtttc caaagctgtg gagttagttg atcatatggt agatatgaag 540
gttattccaa atctcatcat acttaacact attgtcaatg ggctttgtct ccaagataga 600
ctctctgaag caatgtcttt gatacatcga atgttggcta atgggtgcca acccgacgca 660
gttacatatg gtccggtttt gaacagaatg tgtaagtcag ggaacactgc ctcggccttg 720
gatctcctcg gaaagatgga acttagaaag atcaagcctc aagtagtcac atacaatatc 780
atcattgaca gtctttgcaa ggatgggagc ctcgaagatg cactctgcct tttcaatgaa 840
atggaaacca aaggaatcaa agcaaatgtc attacctaca cctctctcat aggaggcttt 900
tgtagtgccg gaagatggga tgatggtgca cagttgctga gggatatgat tacaagggga 960
gtcaccccta acgttgtcac tttcaatgct ttgattgata gttttgtgaa agaaggacag 1020
cttaccgagg ctaaaaaatt gtacaatgag atgatcacaa gaggcacaga tccaaatatc 1080
attacatata actctttgat atatgggatg tgcatggaca actgcctaga tgaggccaac 1140
cagatgctgg atatgatggt tagcaaggga ttctatcctg atattgtgac gtttaatatc 1200
cttatcaacg gatactgtaa ggctaaacag gtcgatgaag gtacgagact tttccgcaat 1260
atgtgtttaa gaggagtggt tgctgataca gtcacttata acactctcat ccaagggttt 1320
tgtcaatcgg gaaaacttaa tgttgccaaa gaactcttcc aggagatggt ctttgttggt 1380
gtgccaccca gtgttgtgac ttatagtatt ttgctggatg ggttgtgtga caatggggaa 1440
ctagaaaagg ctttggaaat acttgatcaa atgctcaaga gtaagatgga acttgacatt 1500
ggtatatata gtatcatcat tcacgggatg tgcaatgcta gtaagatcga tgatgcttgg 1560
gatctattct gtagcctccc tctcaaagga gtgaagcctg aagtcagaac atataatata 1620
atgattggag gattatgtaa gaaaggctcg ctgcctgaag cggtcttgtt gtttagaaag 1680
atgggagagg ctggggttgc gccaagcagt ggtacataca acacactaat acgagctcat 1740
ctcagaggtg gtgacttaac aaaatcagct gaacttatcg aagaaatgaa gaggtgtggg 1800
ttctctgcag atgcttcaac cataaagatt gttatggata tgttattgga tggtagaatg 1860
aagaaaagct ttctggatat gctttcttag 1890
<210> 2
<211> 629
<212> PRT
<213>cabbage type rape (Brassica napus)
<400> 2
Met Leu Cys Arg Arg Leu Val Leu Val Ser Arg Ile Pro Leu Ser Pro
1 5 10 15
Val Gly Thr Leu Ala Thr Pro Leu Leu Ser Phe Ile Arg Ser Ser Cys
20 25 30
Glu Arg Gly Tyr Ser Gly Leu Gly Ser Asp Arg Asn Leu Ser Ser Tyr
35 40 45
Lys Glu Arg Leu Arg Ser Gly Leu Val Asp Ile Lys Lys Lys Asp Ala
50 55 60
Val Ala Leu Phe Gln Ser Met Ile Arg Ser Arg Pro Leu Pro Thr Val
65 70 75 80
Met Asp Phe Asn Lys Leu Phe Ser Ala Val Ala Arg Thr Lys Gln Tyr
85 90 95
Asp Leu Val Leu Asp Leu Cys Lys Gln Met Glu Leu Gln Gly Ile Ala
100 105 110
His Ser Ile Tyr Thr Leu Ser Ile Met Ile Asn Cys Phe Cys Arg Leu
115 120 125
Gln Lys Leu Gly Phe Ala Phe Ser Val Met Gly Lys Met Leu Lys Leu
130 135 140
Gly Tyr Glu Pro Asp Thr Ile Thr Phe Ser Thr Leu Ile Asn Gly Leu
145 150 155 160
Cys Leu Val Gly Arg Val Ser Lys Ala Val Glu Leu Val Asp His Met
165 170 175
Val Asp Met Lys Val Ile Pro Asn Leu Ile Ile Leu Asn Thr Ile Val
180 185 190
Asn Gly Leu Cys Leu Gln Asp Arg Leu Ser Glu Ala Met Ser Leu Ile
195 200 205
His Arg Met Leu Ala Asn Gly Cys Gln Pro Asp Ala Val Thr Tyr Gly
210 215 220
Pro Val Leu Asn Arg Met Cys Lys Ser Gly Asn Thr Ala Ser Ala Leu
225 230 235 240
Asp Leu Leu Gly Lys Met Glu Leu Arg Lys Ile Lys Pro Gln Val Val
245 250 255
Thr Tyr Asn Ile Ile Ile Asp Ser Leu Cys Lys Asp Gly Ser Leu Glu
260 265 270
Asp Ala Leu Cys Leu Phe Asn Glu Met Glu Thr Lys Gly Ile Lys Ala
275 280 285
Asn Val Ile Thr Tyr Thr Ser Leu Ile Gly Gly Phe Cys Ser Ala Gly
290 295 300
Arg Trp Asp Asp Gly Ala Gln Leu Leu Arg Asp Met Ile Thr Arg Gly
305 310 315 320
Val Thr Pro Asn Val Val Thr Phe Asn Ala Leu Ile Asp Ser Phe Val
325 330 335
Lys Glu Gly Gln Leu Thr Glu Ala Lys Lys Leu Tyr Asn Glu Met Ile
340 345 350
Thr Arg Gly Thr Asp Pro Asn Ile Ile Thr Tyr Asn Ser Leu Ile Tyr
355 360 365
Gly Met Cys Met Asp Asn Cys Leu Asp Glu Ala Asn Gln Met Leu Asp
370 375 380
Met Met Val Ser Lys Gly Phe Tyr Pro Asp Ile Val Thr Phe Asn Ile
385 390 395 400
Leu Ile Asn Gly Tyr Cys Lys Ala Lys Gln Val Asp Glu Gly Thr Arg
405 410 415
Leu Phe Arg Asn Met Cys Leu Arg Gly Val Val Ala Asp Thr Val Thr
420 425 430
Tyr Asn Thr Leu Ile Gln Gly Phe Cys Gln Ser Gly Lys Leu Asn Val
435 440 445
Ala Lys Glu Leu Phe Gln Glu Met Val Phe Val Gly Val Pro Pro Ser
450 455 460
Val Val Thr Tyr Ser Ile Leu Leu Asp Gly Leu Cys Asp Asn Gly Glu
465 470 475 480
Leu Glu Lys Ala Leu Glu Ile Leu Asp Gln Met Leu Lys Ser Lys Met
485 490 495
Glu Leu Asp Ile Gly Ile Tyr Ser Ile Ile Ile His Gly Met Cys Asn
500 505 510
Ala Ser Lys Ile Asp Asp Ala Trp Asp Leu Phe Cys Ser Leu Pro Leu
515 520 525
Lys Gly Val Lys Pro Glu Val Arg Thr Tyr Asn Ile Met Ile Gly Gly
530 535 540
Leu Cys Lys Lys Gly Ser Leu Pro Glu Ala Val Leu Leu Phe Arg Lys
545 550 555 560
Met Gly Glu Ala Gly Val Ala Pro Ser Ser Gly Thr Tyr Asn Thr Leu
565 570 575
Ile Arg Ala His Leu Arg Gly Gly Asp Leu Thr Lys Ser Ala Glu Leu
580 585 590
Ile Glu Glu Met Lys Arg Cys Gly Phe Ser Ala Asp Ala Ser Thr Ile
595 600 605
Lys Ile Val Met Asp Met Leu Leu Asp Gly Arg Met Lys Lys Ser Phe
610 615 620
Leu Asp Met Leu Ser
625
<210> 3
<211> 1890
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 3
atgttgtgtc ggagattggt gcttgtgtct cgtatccccc tgagtcctgt tggtactctt 60
gcaactcctt tgctctcttt tatcagatcc tcatgcgaac gaggctactc tggtctcggc 120
agcgatagaa atctctcatc ttacaaagag agactgagaa gtggtctggt cgatatcaag 180
aagaaggatg ctgtagctct gtttcagtcc atgattaggt ctcgtcctct tcctacggtc 240
atggatttca ataaactgtt tagtgcagta gccagaacga aacagtatga tctcgtgttg 300
gatctctgca agcaaatgga actgcaaggg attgcacata gcatttacac gctgagtatt 360
atgatcaatt gcttctgccg tctgcgggaa ctcggttttg ctttttctgt gatgggtaag 420
atgttgaggc ttgggtatga gcctgacaca atcacattct caactttgat caacggttta 480
tgtctggtgg gtagagtttc cgaagctgtg gagttagttg atcgtatggt ggaaatggag 540
gttataccaa atctcatcac gctcaacact attgtcaatg gactttgtct ccaaggtgaa 600
gtgtctgagg caatggcttt gatcgatcga atgatggata atggatgcca acccaatgaa 660
cgtacctatg gtccggtttt gaacagaatg tgcaagtcag gtaacactgc cttggccttg 720
gatctgctca gaaagatgga acacagaaag atcaagctcg atgcagtcac atacaatttc 780
atcattgaca gtctttgcaa agatgggagc ctcgaagatg cactcagcct tttcaatgaa 840
atggaaacca aaggtatcaa accaaatgtc tttacctaca actctctcat tagaggcttc 900
tgtagtgctg gaagatggga tgatggtgca ccgttgctga gggatatgat cacaagggga 960
atcaccccca ccgtcatcac tttcaattct ttgattgata gttttgtgaa agtgggaaag 1020
cttactgagg ctcaagattt gtacaacgag atgatcacaa gaggcacata tcctgatatc 1080
attacatata actctatgat aaatgggctg tgcaatgaaa aacgcttaga tgaagccaac 1140
cagatgctgg atctgatggt tagcaaggaa tgcgatcctg atatcgtgac ttataatacc 1200
cttataaatg gatactgtaa ggctaaacga gttgatgaag gtatgagaca tttccgcaaa 1260
atgtctgtca aaggagtggt tgccaataca gtcacttata acactctcat ccaagggttt 1320
tgtcaatcag gaaaacttaa tgttgccaaa gaactcttcc aggagatggt ctctcaaggt 1380
gttcatcctg atattataac ctacaaaatt ttgctggatg gattgtgtga caatggagaa 1440
gtagaagagg ctttgggaat acttgatcaa atgcacaaga gtaacatgga acttgatatt 1500
ggtttatata atatcatcat tcacgggatg tgcaatgcaa ataaggtcga tgatgcttgg 1560
agtttgttct gtagcctacg ttcgaaagga gtgaaaccag acgtcaagac atatactaca 1620
atgattggag gattgtgtaa gaaaggatcg ctgtctgaag cgggcatgtt atgtaagaag 1680
atggaagagg atgggattgc gccaaatgat tgtacataca acactcttat cagggcacat 1740
ctccgagatg gtgacttaac aaaatcagca aaacttatcg aagaaatgaa gaggtgtggg 1800
ttctctgcag atgcttcaac cataaagatt gttatggata tgttatcgga tggtagaatg 1860
aagaaaagct ttctggatat gctttcttag 1890
Claims (1)
1. cabbage type rape cytoplasmic male sterility restoring geneRfnAnswering in the fertility for restoring cabbage type rape nap CMS
With the cabbage type rape cytoplasmic male sterility restoring geneRfnFor nucleotide shown in SEQ ID NO.1 in sequence table
Sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030300.8A CN106754964B (en) | 2017-01-17 | 2017-01-17 | The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710030300.8A CN106754964B (en) | 2017-01-17 | 2017-01-17 | The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754964A CN106754964A (en) | 2017-05-31 |
| CN106754964B true CN106754964B (en) | 2019-11-15 |
Family
ID=58946070
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710030300.8A Active CN106754964B (en) | 2017-01-17 | 2017-01-17 | The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754964B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107699631B (en) * | 2017-11-17 | 2021-09-10 | 青海省农林科学院 | Primer and method for screening brassica napus male and female sterile line Bnmfs by using molecular marker |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1425770A (en) * | 2002-11-20 | 2003-06-25 | 华南农业大学 | Plant cytoplasmic male sterile recovering gene and its use |
| CN103865937A (en) * | 2014-03-13 | 2014-06-18 | 华南农业大学 | Cytoplasmic male sterility restorer gene in rice and application thereof |
-
2017
- 2017-01-17 CN CN201710030300.8A patent/CN106754964B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1425770A (en) * | 2002-11-20 | 2003-06-25 | 华南农业大学 | Plant cytoplasmic male sterile recovering gene and its use |
| CN103865937A (en) * | 2014-03-13 | 2014-06-18 | 华南农业大学 | Cytoplasmic male sterility restorer gene in rice and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| A pentatricopeptide repeat protein restores nap cytoplasmic male sterility in Brassica napus;Zhi Liu et al.;《Journal of Experimental Botany》;20170720;第68卷(第15期);第4115-4123页 * |
| PREDICTED: Brassica napus pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC106397421), mRNA，NCBI Reference Sequence: XM_013838003.1;genbank;《genbank》;20150831;第1-2页 * |
| 水稻细胞质雄性不育恢复性的等位基因分化;蔡健等;《核农学报》;20121231;第26卷(第4期);第634-642页 * |
| 甘蓝型油菜 pol CMS育性恢复基因的分子标记;刘平武等;《中国油料作物学报》;20070331;第29卷(第1期);第14-19页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754964A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kubo et al. | Male sterility-inducing mitochondrial genomes: how do they differ? | |
| McGrath et al. | Sugar beet breeding | |
| BR112020006386A2 (en) | use of a corn gene, method for preparing a transgenic corn, use of biological material, mutant gene, protein encoded by the mutant gene, use of the mutant gene, specific promoter of young ears, use of the specific promoter, molecular dna marker, primer , reagent or detection kit, and, use of the DNA molecular marker, primer or reagent or detection kit | |
| CN106754954B (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
| CN111153974A (en) | Corn disease-resistant gene and molecular marker and application thereof | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| CN107190084B (en) | HO/LL brassica resistant to clubroot | |
| US20220295719A1 (en) | Prolific flowering watermelon | |
| CN109295246A (en) | DNA molecular marker relevant to corn male fertility and its application | |
| CN109439667A (en) | Application of the corn gene ZmABCG20 in regulation crop male fertile | |
| Manivong et al. | Marker-assisted selection to improve submergence tolerance, blast resistance and strong fragrance in glutinous rice | |
| US8779233B1 (en) | QTL regulating ear productivity traits in maize | |
| CN107418956B (en) | The separation of rice photaesthesia genic male sterile gene pms1 is cloned and application | |
| Takeuchi | Developing isogenic lines of Japanese rice cultivar ‘Koshihikari’with early and late heading | |
| CN105441456B (en) | A kind of cabbage type rape genic male sterile gene Bnms4bAnd preparation method and application | |
| CN106754964B (en) | The clone of cabbage type rape nap cytoplasmic male sterility restoring gene Rfn and its application | |
| CN108277211B (en) | Corn MS30 gene mutant and molecular identification method and application thereof | |
| US11572573B2 (en) | Method for propagating sterile male plant line | |
| AU2021359680A9 (en) | Parthenocarpic watermelon plants | |
| CN110628783A (en) | Non-transgenic herbicide-resistant rape gene and application thereof | |
| KR20200112853A (en) | Spinach plants that are at least resistant to Ferronospora parinosa races 8, 9, 11, 13 and 16 | |
| Song et al. | Development of clubroot resistant cabbage line through introgressing six CR loci from Chinese cabbage via interspecific hybridization and embryo rescue | |
| RU2792674C2 (en) | Productive flowering watermelon plant | |
| Patil et al. | Molecular characterization of CMS lines in short-day white onions | |
| WO2016084077A1 (en) | Vernalization independent lisianthus plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220914 Address after: Buildings B7 and B8, Bio-industry (Jiufeng) Innovation Base, No. 666 Gaoxin Avenue, Donghu New Technology Development Zone, Wuhan City, Hubei Province 430014 Patentee after: WUHAN LIANNONG SEED TECHNOLOGY Co.,Ltd. Address before: 430070 No. 1 Lion Rock street, Hongshan District, Hubei, Wuhan Patentee before: HUAZHONG AGRICULTURAL University Patentee before: WUHAN LIANNONG SEED TECHNOLOGY Co.,Ltd. |