CN106754952B - 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen - Google Patents
60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen Download PDFInfo
- Publication number
- CN106754952B CN106754952B CN201611045376.XA CN201611045376A CN106754952B CN 106754952 B CN106754952 B CN 106754952B CN 201611045376 A CN201611045376 A CN 201611045376A CN 106754952 B CN106754952 B CN 106754952B
- Authority
- CN
- China
- Prior art keywords
- gene
- bkcpn60
- beta
- white birch
- arabidopsis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Botany (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen, it belongs to field of biotechnology.The nucleotide sequence of Kirghiz Republic white birch BkCPN60 Beta-4 gene is as shown in SEQ ID No:1.The amino acid sequence of its coding albumen is as shown in SEQ ID No:2.The coding section length of Kirghiz Republic white birch BkCPN60 Beta-4 gene is 1248bp in the present invention, encode 415 amino acid, subcellular localization shows that 4 albumen of BkCPN60 β is located in nucleus and cytoplasm, BkCPN60 Beta-4 gene successful conversion arabidopsis, the expression quantity of transgenic line BkCPN60 Beta-4 gene is higher than wild type (WT), 1.5mmol/L and 3.0mmol/L NaHCO3Transgenic arabidopsis and WT strain are handled, shows that the arabidopsis for turning BkCPN60 Beta-4 gene can be improved to NaHCO3Tolerance.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone
And its coding albumen.
Background technique
Chaperone is complicated molecule chaperone protein, and is widely present in the matter of protokaryon and eukaryocyte
In body and mitochondria.Plastid CPN60 contains α subunit and β subunit two types, and there are 2 kinds of α subunit genes and 4 in arabidopsis
Beta subunit gene is planted, α subunit gene and beta subunit gene respectively there are 3 kinds in rice.CPN60 albumen participates in the assembly of protein folding, and
And the substrate very abundant of albumen, the albumen may play an important role in different environment stresses.But CPN60 albumen
The mechanism of the plant vital activity participated in plant is also unclear.
Summary of the invention
It is an object of the present invention to provide 60 subunit β of Kirghiz Republic white birch chloroplaset chaperone, 4 (BkCPN60 β 4) gene and its
Encode albumen.
The nucleotide sequence such as SEQ ID of 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone in the present invention
Shown in No:1.
60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone encodes the amino acid sequence of albumen such as in the present invention
Shown in SEQ ID No:2.
Present invention obtains Kirghiz Republic white birch BkCPN60 Beta-4 gene and its coding albumen, the codings of BkCPN60 Beta-4 gene
Section length is 1248bp, encodes 415 amino acid, and subcellular localization shows that 4 albumen of BkCPN60 β is located in nucleus and cell
The expression quantity of matter, BkCPN60 Beta-4 gene successful conversion arabidopsis, transgenic line BkCPN60 Beta-4 gene is higher than wild type (WT),
1.5mmol/L and 3.0mmol/L NaHCO3Transgenic arabidopsis and WT strain are handled, shows to turn BkCPN60 Beta-4 gene
Arabidopsis can be improved to NaHCO3Tolerance.
Detailed description of the invention
Fig. 1 is Kirghiz Republic white birch blade total serum IgE electrophoretogram in the present invention；
Fig. 2 is the gel electrophoresis figure of the PCR product of BkCPN60 Beta-4 gene cDNA in the present invention, wherein swimming lane M is 2kb
Marker, swimming lane 1 are using cDNA as the pcr amplification product of the BkCPN60 Beta-4 gene of template；
Fig. 3 is the gel electrophoresis figure of the bacterium solution PCR product of pMD18-T-BkCPN60 β 4 in the present invention, wherein swimming lane M is
2kb Marker, swimming lane 1-5 are with 4 single colonie of pMD18-T-BkCPN60 β；
Fig. 4 is the gel electrophoresis figure of the bacterium solution PCR product of pBI121-BkCPN60 β 4-GFP in the present invention, wherein swimming lane M
It is the bacterium solution PCR product of pBI121-BkCPN60 β 4-GFP for 2kb Marker, swimming lane 1-3；
Fig. 5 is the Kana screening figure that the arabidopsis transgenic line of BkCPN60 Beta-4 gene is overexpressed in the present invention；
Fig. 6 is BkCPN60 β in the PCR identification for be overexpressed in the present invention arabidopsis transgenic line of BkCPN60 Beta-4 gene
The gel electrophoresis figure of 4 gene PCR products, wherein swimming lane M is 2kb Marker, and swimming lane CK+ is positive control, and swimming lane CK- is yin
Property control, swimming lane 1-3 be T2For 6#-8# transgenic line；
Fig. 7 is 35S PCR in the PCR identification for be overexpressed in the present invention arabidopsis transgenic line of BkCPN60 Beta-4 gene
The gel electrophoresis figure of product, wherein swimming lane M is 2kb Marker, and swimming lane CK+ is positive control, and swimming lane CK- is negative control,
Swimming lane 1-3 is T2For 6#-8# transgenic line；
Fig. 8 is Kana PCR in the PCR identification for be overexpressed in the present invention arabidopsis transgenic line of BkCPN60 Beta-4 gene
The gel electrophoresis figure of product, wherein swimming lane M is 2kb Marker, and swimming lane CK+ is positive control, and swimming lane CK- is negative control,
Swimming lane 1-3 is T2For 6#-8# transgenic line；
Fig. 9 is the expression analysis figure that the arabidopsis transgenic line of BkCPN60 Beta-4 gene is overexpressed in the present invention；
Figure 10 is the NaHCO that arabidopsis sprouts the later period in the present invention3Without NaHCO in Analysis of Resistance3The figure of processing group；
Figure 11 is the NaHCO that arabidopsis sprouts the later period in the present invention31.5mmol/L NaHCO in Analysis of Resistance3Processing group
Figure；
Figure 12 is the NaHCO that arabidopsis sprouts the later period in the present invention33.0mmol/L NaHCO in Analysis of Resistance3Processing group
Figure.
Specific embodiment
The technical solution of the present invention is not limited to the following list, further includes between each specific embodiment
Any combination.
Specific embodiment 1: the nucleosides of 60 subunit Beta-4 gene of present embodiment Kirghiz Republic white birch chloroplaset chaperone
Acid sequence is as shown in SEQ ID No:1.
60 subunit Beta-4 gene of present embodiment Chloroplast chaperone is abbreviated as BkCPN60 Beta-4 gene.
The code area full length sequence 1248bp of Kirghiz Republic white birch BkCPN60 Beta-4 gene in present embodiment.
Specific embodiment 2: white birch chloroplaset chaperone 60 subunit Beta-4 gene in present embodiment Kirghiz Republic encodes egg
White amino acid sequence is as shown in SEQ ID No:2.
The coding albumen of present embodiment Kirghiz Republic white birch BkCPN60 Beta-4 gene is made of 415 amino acid.
The acquisition process of Kirghiz Republic white birch BkCPN60 Beta-4 gene in present embodiment:
1 experimental material
1.1 vegetable material
Kirghiz Republic Drought stress；Wildtype Arabidopsis thaliana seed.
1.2 bacterial strains and carrier
Trans1-T1 competent escherichia coli cell；PMD18-T carrier；PBI121 expression vector；The expression of II plant of pROK
Carrier.
1.3 main agents and culture medium
DNA digestive ferment, reverse transcriptase, Ex Taq, the recycling of OMEGA glue and plasmid extraction kit are purchased from TaKaRa public affairs
Department,Tip Green qPCR SuperMix fluorescent dye is purchased from Quan Shijin biotech firm, other reagents are state
It is pure to produce analysis.
The related drug that RNA is extracted: CTAB extracting solution, 5mol/L LiCl, 75% ethyl alcohol, the above drug need to use 0.1%
DEPC water is prepared；Beta -mercaptoethanol, chloroform, dehydrated alcohol.
The composition of CTAB extracting solution: 2%CTAB (m/v), 20mmol/L EDTA, l00mmol/L Tris-HCl
(pH8.0)、1.4mol/L NaCl
LB liquid medium (1L): yeast 5g, peptone 10g, NaCl 10g, pure water 1L, it is spare after high pressure sterilization；LB is solid
Body culture medium (1L): yeast 5g, peptone 10g, NaCl 10g, agar 15g, pure water 1L, it is spare after high pressure sterilization.
1.4 laboratory apparatus
It is electronic balance, micropipettor, room temperature centrifuge and refrigerated centrifuge, gel imager, high-pressure sterilizing pot, ultra-clean
Workbench, ice machine, PCR instrument, shaking table, incubator, constant temperature water bath, rotation misfortune oscillator, nucleic acid analyzer, ABI7500 fluorescence
Quantitative PCR apparatus, particle gun, fluorescence microscope.
The synthesis of 1.5 primers and sequencing
The primer used in experiment entrusts Beijing Huada gene company to synthesize, and sequencing wins bodyguard biotechnology by Harbin
Co., Ltd completes.
Used experimental method is conventional method unless otherwise specified.Used material, reagent, enzyme, competence
What plasmid of cell etc., is commercially available unless otherwise specified.
2 experimental methods
The extraction of 2.1 Kirghiz Republic white birch blade total serum IgEs
Preparation: water-bath and CTAB extracting solution preheating, take out in advance with tinfoil wrap up autoclaved mortar and
Pestle is pre-chilled, and (4 DEG C) and the pre-cooling of other drugs are pre-chilled in centrifuge.
(1) 700 μ L dehydrated alcohols are added into the 1.5ml centrifuge tube of sterilizing；
(2) it takes the Kirghiz Republic white birch blade for not doing any processing to be fully ground in liquid nitrogen, adds it at once after ground
Enter in above-mentioned centrifuge tube, vibrate 3min, 4 DEG C of 12000rpm whens are centrifuged 10min；
(3) supernatant after being centrifuged is discarded, 700 μ L CTAB extracting solutions, 100 μ L β-sulfydryl second are added in Xiang Shangshu centrifuge tube
Alcohol vibrates 5min, 65 DEG C of water-bath 5min (shaken several times therebetween), and 4 DEG C of 12000rpm whens are centrifuged 10min；
(4) 400 μ L chloroforms, the 400 μ L water-saturated phenol of pre-cooling are added into new centrifuge tube in the supernatant after drawing centrifugation,
3min is vibrated, 4 DEG C of 12000rpm whens are centrifuged 10min；
(5) it repeats step (4) 1 times；
(6) isometric chloroform of pre-cooling is added into new centrifuge tube in the supernatant after drawing centrifugation, vibrates 3min,
10min is centrifuged at 12000rpm4 DEG C；
(7) dehydrated alcohol, the 0.8 times of volume that 1/2 volume is pre-chilled is added into new centrifuge tube in the supernatant after drawing centrifugation
The 5mol/L LiCl of pre-cooling, oscillation mix, and 4 DEG C of ice bath 10min, 12000rpm whens are centrifuged 10min；
(8) supernatant after discarding centrifugation is added 700 μ L, 75% ethanol washing precipitating, mixes, at 4 DEG C of 12000rpm from
Heart 5min；
(9) 50 μ L 0.1%DEPC water dissolution precipitating is added in the supernatant after discarding centrifugation, drying at room temperature 10min；
(10) 1% agarose gel electrophoresis detect RNA mass, and nucleic acid analyzer detects RNA purity, is stored in -80 DEG C of ice
Case, it is spare.
The clone of 2.2 Kirghiz Republic white birch BkCPN60 Beta-4 genes
Using blade total serum IgE as template, reverse transcription is carried out using M-MLV ReverseTranscriptase, synthesizes the first chain
CDNA, using it as template be used for PCR amplification, primer BkCPN60 β 4-F:5'ATGTCCAGA GAGGTTGAAGAT 3',
BkCPN60 β 4-R:5'GCCAGTCCATCCGCCAAACTAAACG 3', reaction system are said with reference to the Ex Taq enzyme of TaKaRa company
Bright book carries out.
PCR amplification, 50 μ L of reaction system, ingredient are as follows:
Reaction condition: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 51 DEG C of annealing 30s, 72 DEG C of extension 1.5min, totally 30
Circulation, last 72 DEG C of extensions 10min；16 DEG C of terminations.
PCR product agglomerates electrophoresis detection with 1% agarose.Glue recycling is carried out to above-mentioned PCR product, recycling is obtained
BkCPN60 Beta-4 gene DNA fragmentation is connected with pMD18-T carrier, and connection product converts Escherichia coli, the list of random picking white
Bacterium colony shakes bacterium, carries out bacterium solution PCR verifying, and be sequenced.
The subcellular localization of 2.3 Kirghiz Republic white birch BkCPN60 β, 4 albumen
The subcellular localization primer sequence of BkCPN60 Beta-4 gene is pBI121-BkCPN60 β 4-GFP-F:5'
GGGGTACCATGTCCAGAGAGGTTGAAGATC 3', pBI121-BkCPN60 β 4-GFP-R:5'
GGACTAGTAACGCCAATTGGGCTGATACCTG' is sequenced correctly clone with BkCPN60 Beta-4 gene and extracts plasmid, carries out
PCR amplification, through I double digestion of Kpn I and Spe after the recycling of amplified production glue, while pBI121-GFP plasmid also uses Kpn I and Spe I couple
Digestion；
PCR amplification, reaction system ingredient are as follows:
Reaction condition: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation 20s, 63 DEG C of annealing 20s, 72 DEG C of extension 40s, totally 30 are followed
Ring, last 72 DEG C of extensions 5min；4 DEG C of terminations.
PBI121-GFP plasmid double digestion system:
Condition: 37 DEG C of digestion 3h are added 10 × Loading buffer and terminate reaction.
BkCPN60 β 4PCR purified product double digestion system:
37 DEG C of digestion 3h of condition are added 10 × Loading buffer and terminate reaction.
Small fragment and large fragment is separately recovered, is connected with T4DNA ligase, to obtain pBI121-BkCPN60 β 4-GFP
Fusion expression vector is transferred to Trans5 α competent cell, bacterium solution PCR screening positive clone, and carries out sequencing to positive colony and test
Card.Microcarrier is prepared after sequencing is correct, as a control group with pBI121-GFP, onion epidermis cell is transformed into, obtains efficient wink
When express, to determine the position of target protein in the cell by the fluorescence signal of green fluorescent protein, with this method with
Achieve the purpose that the concrete position that determining gene expression product-protein functions in cell.
Acquisition, PCR identification and the homozygote screening of 2.4 turns of BkCPN60 Beta-4 gene arabidopsis
With Xba I and I restriction enzyme of Sac simultaneously to be sequenced correct 4 recombinant plasmid of pMD18-T-BkCPN60 β and
II vector plasmid of pROK carries out double digestion and connects, and utilizes mediated by agriculture bacillus method arabidopsis thaliana transformation.Harvest T0Seed is used
20% drift ice of 1.0mL cleans seed 5-6 times with sterilized water in vibrating 15min in vortex oscillator, and addition is suitable
0.1% (g/mL) agarose of sterilizing, makes seed sufficiently suspend, sets 4 DEG C of refrigerator vernalization 2-4 days.By the good seed sowing of vernalization
In the 1/2MS sterilising medium containing kanamycins (30mg/L), being placed on tissue culture room, (illumination 16h/ dark 8h, light intensity are 100 μ
mol m-2s-1) culture 6-8d, the green seedlings for growing two panels true leaf of anti-kanamycins (Kana) are transplanted, in tissue culture room
In grown, mark convenient for single plant harvest T1For seed, it is respectively designated as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8#.
Take the T of each transgenic line of Kana1Continue Kana screening for seed, each transgenic line takes 12
Anti- Kana plant is transplanted, and T is obtained2In generation, turns the seedling of BkCPN60 Beta-4 gene, and clip 1-2 piece tender leaf is mentioned for genomic DNA
It takes, using 4 Plasmid DNA of 35S:BkCPN60 β as positive control, wildtype Arabidopsis thaliana DNA is negative control, carries out PCR detection.
From T2In generation, starts to count segregation ratio, i.e., the ratio between green seedling and etiolated seedling strain number.Harvest turns the T of BkCPN60 Beta-4 gene strain2For seed
When, 12 plant of each strain independent sowing, the .1#12 that is respectively labeled as 1#1,1#2 ..., 2#1,2#2 ... .2#12,3#1,
3#2 ... .3#12,4#1,4#2 ... .4#12,5#1,5#2 ... .5#12,6#1,6#2 ... .6#12 chooses the strain of segregation ratio close to 3:1
System continues screening and culturing, is sieved to T3-T4In generation, the strain for being all green seedling is homozygous lines.
The homozygous real-time fluorescence quantitative PCR analysis of 2.5 turns of II-BkCPN60 Beta-4 gene arabidopsis of pROK
Respectively to turn the arabidopsis T of BkCPN60 Beta-4 gene3For 6#4, the cDNA of 7#4,8#1 strain blade and WT blade are
Template extracts RNA referring to pBIOZOL RNA extracts kit, and reverse transcription synthesizes cDNA, using arabidopsis AtActin as internal reference
Gene, AtActin primer sequence are AtActin-F:5'GGTAACATTG TGCTCAGTGGTG 3', AtActin-R:5'
The qRT-PCR primer sequence of CTCGGCCTTGGAGATCCACATC 3', BkCPN60 Beta-4 gene are as follows: BkCPN60 β 4-F':
GCAGAGGGTATTGAGCAG, BkCPN60 β 4-R':AACCTTTATTGCCGAGCC；According to SYBR Green qRT-PCR Mix
Kit (Quan Shijin Bioisystech Co., Ltd) kit specification, using ABI PRISM7500 real-time fluorescence quantitative PCR instrument into
Row qRT-PCR analysis, using 2-△△CTMethod analyzes data.Analyze table of the Kirghiz Republic white birch BkCPN60 Beta-4 gene in arabidopsis
Up to situation.
Quantitative fluorescent PCR reaction system and program difference are as follows:
Response procedures:
Melt curve analysis analysis
2.6 turns of II homozygous NaHCO of-BkCPN60 Beta-4 gene arabidopsis of pROK3Analysis of Resistance
By WT and the arabidopsis T for turning BkCPN60 Beta-4 gene2-6#4；7#4；The seed disinfection of 8#1 strain sterilizes, after vernalization
In tissue culture room culture 7d on normal 1/2MS culture medium, the consistent seedling replanting of growing way is chosen to no NaHCO3(control
Group) and NaHCO3Concentration be respectively 1.5mmol/L, 3.0mmol/L 1/2MS culture medium on cultivate each of 10d, each processing
Strain sets 3 repetitions, observes the character mutation of seedling.
3 results and analysis
The extraction of 3.1 total serum IgEs
Using Kirghiz Republic white birch blade as material, total serum IgE is extracted using CTAB method, carries out 1% agarose gel electrophoresis inspection
It surveys.As the result is shown: 28S and 18S RNA band is high-visible, and the content of 28S RNA is approximately twice of 18S rna content
(Fig. 1) illustrates successfully to extract total serum IgE, can be used for the reverse transcription of cDNA.
The Cloning and sequence analysis of 3.2 Kirghiz Republic white birch BkCPN60 Beta-4 genes
CDNA template is diluted 10 times, BkCPN60 Beta-4 gene cloning primer is selected to carry out PCR amplification, obtained band (figure
2)；The bacterium solution PCR of recombinant plasmid has amplified purpose band (Fig. 3), and corresponding bacterium solution send sequencing, learns BkCPN60 Beta-4 gene
Coding section length be 1248bp, 415 amino acid of codified.
The Subcellular Localization of 3.3 Kirghiz Republic white birch BkCPN60 β, 4 albumen
Subcellular localization primer is selected to carry out bacterium solution PCR screening positive clone, as a result amplification obtains purpose band (Fig. 4),
The onion for turning pBI121-BkCPN60 β 4-GFP, the visible green fluorescence in its nucleus and cytoplasm.
Acquisition, PCR identification and the homozygote screening of 3.4 turns of BkCPN60 Beta-4 gene arabidopsis
Take the T harvested after infecting0For seed in carrying out Kana resistance screening on the culture medium that Kana concentration is 30mg/L, tie
Fruit shows: one week or so, most of seed was killed by Kana, cotyledons turn yellow；Minority turns the son of BkCPN60 Beta-4 gene seed
Leaf keeps green, and continued growth of taking root (Fig. 5), grows two panels true leaf to transgenic arabidopsis and is transplanted.
Take the T of WT and each transgenic line (1#-8#)2For tender leaf extract genomic DNA, carry out target gene, 35S and
Kana identification, (Fig. 6,7 and 8) 6#-8# transgenic line, which expands, as the result is shown obtains BkCPN60 Beta-4 gene, 35S and Kana item
Band, and WT does not amplify band, illustrates that the transformation of Arabidopsis thaliana strain for being overexpressed BkCPN60 Beta-4 gene is identified successfully.
Harvest PCR identifies the T of successful transgenic line2Continue Kana screening, knot for seed (single plant sowing)
Fruit finds to turn the arabidopsis T of BkCPN60 Beta-4 gene3For strain (6#4；7#4；8#1) on Kana culture medium cotyledon all green,
Grow true leaf, and continued growth is to taking root；And WT seedling whole yellow on same Kana culture medium and no longer grow, therefore
Turn the T of BkCPN60 Beta-4 gene3For strain (T3-6#4；7#4；8#1) it is homozygous lines, can be used for resistance assay analysis.
The homozygous real-time fluorescence quantitative PCR analysis of 3.5 turns of II-BkCPN60 Beta-4 gene arabidopsis of pROK
In order to detect expression of the BkCPN60 Beta-4 gene in arabidopsis homozygous lines, using WT as control,
AtActin carries out qRT-PCR analysis, the results showed that (Fig. 9), three transgenic line (T as reference gene3-6#4；7#4；
The expression quantity of BkCPN60 Beta-4 gene is higher than in WT in 8#1), and BkCPN60 Beta-4 gene is in 7#4 and 8#1 transgenic line
Expression quantity is changed significantly, and respectively the 24.09 and 38.45 of WT times.
The NaHCO of 3.6 turns of II-BkCPN60 Beta-4 gene arabidopsis of pROK3Analysis of Resistance
Observe phenotype discovery (Figure 10,11 and 12), no NaHCO3When WT and transformant (6#4,7#4 and 8#1) growing way it is equal
Well, and without significant difference；With no NaHCO3It compares, 1.5mmol/L NaHCO3Handle lower WT and transformant (6#4,7#4 and 8#
1) strain shortens, but aerial part ratio WT growth is vigorous, and lateral root increased significantly, and root long is considerably longer than WT；With
1.5mmol/L NaHCO3Processing is compared, 3.0mmol/L NaHCO3The strain for handling lower WT and transformant shortens, but transformant
Growing way it is better than WT growing way.The above description of test 1.5mmol/L and 3.0mmol/L NaHCO3Inhibit the growth of seedling, but
BkCPN60 Beta-4 gene can reduce NaHCO3To the inhibiting effect of transgenic arabidopsis, show that BkCPN60 Beta-4 gene can be improved
Transgenic arabidopsis is to NaHCO3Tolerance.
Sequence table
<110>Northeast Forestry University
<120>60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen
<160> 10
<210> 1
<211> 1248
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of Kirghiz Republic white birch BkCPN60 Beta-4 gene.
<400> 1
atgtccagag aggttgaaga tcatgagctt gtagatgttg ctgcagttag tgcagggaat 60
gattatgtgg tgggaaacat gattgctgat gctcttcgcc aagtgggaag gaagggtgta 120
gtgacaattg aaaaagggaa gtgtaccgag aatagtctac agattgtaga aggaatgcaa 180
tttgatcgtg gatatttgtc tccttacttt gtaactgatc gacaaaagat gacaattgag 240
ttccataatt gcaagttact tttggtcgac aaaaaaatca caaacccaaa ggagatgttt 300
aaaatattgg acagtgcagt taaagagaag tatcccattg tgatagttgc agagggtatt 360
gagcaggaag ctctggctcc agtaattaga aataaactga ggggtgtgct gaaagcagct 420
gctatcaagg ctcctgcctt tggtgagcgc aagagccagt acttggatga catcgccatc 480
ttgactggag gcactgtaat cagagatgag atggggttga gccttgaaaa ggttgggaag 540
gaggtattgg gctcggcaat aaaggtcgtg ataaccaagg gttcaacatt aatagttaca 600
gatgggagca ctcgcaaagc tgttgaagag agggtttctc aaatccggag gcttgtagag 660
aacactgaag aaaaatttca aaaaaagata ctgaatgaga gaatagctag gctgtcagcg 720
ggaattgcca ttcttcaggt aggagcacaa acacaagttg agttgaagga taaacaactc 780
aggcttgaag atgctttgaa tgcaacaaag tcagcaattg aggaaggtgt tgtagttgga 840
gggggctgta cccttttgag gctatctaca acagtagatg gtatcaaaca agtcttggac 900
aatgaagaac agaagattgg agctgagatc ttcaaaagag ctttgagata tcctgtgaga 960
ctgatagcca aaaatgcagg tgtaaatggc aatgtggtta tagaaaaggt tctttctaat 1020
gataatatta attatggata caatgctgca agagaccgtt atgaggattt gatgaaggct 1080
ggaatcatgg atccatcaaa ggtagttaga tgttgtttgg agcatgcagc atctgtagcc 1140
aagacttttc tgacatctga tgctgttgta gttgacatta aggaactaga gcccatcaga 1200
aggagaccac caatgccaac ctcaggtatc agcccaattg gcgtttag 1248
<210> 2
<211> 415
<212> DNA
<213>artificial sequence
<220>
<223>amino acid sequence of Kirghiz Republic white birch BkCPN60 Beta-4 gene coding albumen.
<400> 2
atg tcc aga gag gtt gaa gat cat gag ctt gta gat gtt gct gca 45
Met Ser Arg Glu Val Glu Asp His Glu Leu Val Asp Val Ala Ala
5 10 15
gtt agt gca ggg aat gat tat gtg gtg gga aac atg att gct gat 90
Val Ser Ala Gly Asn Asp Tyr Val Val Gly Asn Me tIle Ala Asp
20 25 30
gct ctt cgc caa gtg gga agg aag ggt gta gtg aca att gaa aaa 135
Ala Leu Arg Gln Val Gly Arg Lys Gly Val Val Thr Ile Glu Lys
35 40 45
ggg aag tgt acc gag aat agt cta cag att gta gaa gga atg caa 180
Gly Lys Cys Thr Glu Asn Ser Leu Gln Ile Val Glu Gly Met Gln
50 55 60
ttt gat cgt gga tat ttg tct cct tac ttt gta act gat cga caa 225
Phe Asp Arg Gly Tyr Leu Ser Pro Tyr Phe Val Thr Asp Arg Gln
65 70 75
aag atg aca att gag ttc cat aat tgc aag tta ctt ttg gtc gac 270
Lys Met Thr Ile Glu Phe His Asn Cys Lys Leu Leu Leu Val Asp
80 85 90
aaa aaa atc aca aac cca aag gag atg ttt aaa ata ttg gac agt 315
Lys Lys Ile Thr Asn Pro Lys Glu Met Phe Lys Ile Leu Asp Ser
95 100 105
gca gtt aaa gag aag tat ccc att gtg ata gtt gca gag ggt att 360
Ala Val Lys Glu Lys Tyr Pro Ile Val Ile Val Ala Glu Gly Ile
110 115 120
gag cag gaa gct ctg gct cca gta att aga aat aaa ctg agg ggt 405
Glu Gln Glu Ala Leu Ala Pro Val Ile Arg Asn Lys Leu Arg Gly
125 130 135
gtg ctg aaa gca gct gct atc aag gct cct gcc ttt ggt gag cgc 450
Val Leu Lys Ala Ala Ala Ile Lys Ala Pro Ala Phe Gly Glu Arg
140 145 150
aag agc cag tac ttg gat gac atc gcc atc ttg act gga ggc act 495
Lys Ser Gln Tyr Leu Asp Asp Ile Ala Ile Leu Thr Gly Gly Thr
155 160 165
gta atc aga gat gag atg ggg ttg agc ctt gaa aag gtt ggg aag 540
Val Ile Arg Asp Glu Met Gly Leu Ser Leu Glu Lys Val Gly Lys
170 175 180
gag gta ttg ggc tcg gca ata aag gtc gtg ata acc aag ggt tca 585
Glu Val Leu Gly Ser Ala Ile Lys Val Val Ile Thr Lys Gly Ser
185 190 195
aca tta ata gtt aca gat ggg agc act cgc aaa gct gtt gaa gag 630
Thr Leu Ile Val Thr Asp Gly Ser Thr Arg Lys Ala Val Glu Glu
200 205 210
agg gtt tct caa atc cgg agg ctt gta gag aac act gaa gaa aaa 675
Arg Val Ser Gln Ile Arg Arg Leu Val Glu Asn Thr Glu Glu Lys
215 220 225
ttt caa aaa aag ata ctg aat gag aga ata gct agg ctg tca gcg 720
Phe Gln Lys Lys Ile Leu Asn Glu Arg Ile Ala Arg Leu Ser Ala
230 235 240
gga att gcc att ctt cag gta gga gca caa aca caa gtt gag ttg 765
Gly Ile Ala Ile Leu Gln Val Gly Ala Gln Thr Gln Val Glu Leu
245 250 255
aag gat aaa caa ctc agg ctt gaa gat gct ttg aat gca aca aag 810
Lys Asp Lys Gln Leu Arg Leu Glu Asp Ala Leu Asn Ala Thr Lys
260 265 270
tca gca att gag gaa ggt gtt gta gtt gga ggg ggc tgt acc ctt 855
Ser Ala Ile Glu Glu Gly Val Val Val Gly Gly Gly Cys Thr Leu
275 280 285
ttg agg cta tct aca aca gta gat ggt atc aaa caa gtc ttg gac 900
Leu Arg Leu Ser Thr Thr Val Asp Gly Ile Lys Gln Val Leu Asp
290 295 300
aat gaa gaa cag aag att gga gct gag atc ttc aaa aga gct ttg 945
Asn Glu Glu Gln Lys Ile Gly Ala Glu Ile Phe Lys Arg Ala Leu
305 310 315
aga tat cct gtg aga ctg ata gcc aaa aat gca ggt gta aat ggc 990
Arg Tyr Pro Val Arg Leu Ile Ala Lys Asn Ala Gly Val Asn Gly
320 325 330
aat gtg gtt ata gaa aag gtt ctt tct aat gat aat att aat tat 1035
Asn Val Val Ile Glu Lys Val Leu Ser Asn Asp Asn Ile Asn Tyr
335 340 345
gga tac aat gct gca aga gac cgt tat gag gat ttg atg aag gct 1080
Gly Tyr Asn Ala Ala Arg Asp Arg Tyr Glu Asp Leu Met Lys Ala
350 355 360
gga atc atg gat cca tca aag gta gtt aga tgt tgt ttg gag cat 1125
Gly Ile Met Asp Pro Ser Lys Val Val Arg Cys Cys Leu Glu His
365 370 375
gca gca tct gta gcc aag act ttt ctg aca tct gat gct gtt gta 1170
Ala Ala Ser Val Ala Lys Thr Phe Leu Thr Ser Asp Ala Val Val
380 385 390
gtt gac att aag gaa cta gag ccc atc aga agg aga cca cca atg 1215
Val Asp Ile Lys Glu Leu Glu Pro Ile Arg Arg Arg Pro Pro Met
395 400 405
cca acc tca ggt atc agc cca att ggc gtt tag 1248
Pro Thr Ser Gly Ile Ser Pro Ile Gly Val
410 415
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer BkCPN60 β 4-F.
<400> 3
atgtccagag aggttgaaga t 21
<210> 4
<211> 25
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer BkCPN60 β 4-R.
<400> 4
gccagtccat ccgccaaact aaacg 25
<210> 5
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer pBI121-BkCPN60 β 4-GFP-F.
<400> 5
ggggtaccat gtccagagag gttgaagatc 30
<210> 6
<211> 31
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer pBI121-BkCPN60 β 4-GFP-R.
<400> 6
ggactagtaa cgccaattgg gctgatacct g 31
<210> 7
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer AtActin-F.
<400> 7
ggtaacattg tgctcagtgg tg 22
<210> 8
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of primer AtActin-R.
<400> 8
ctcggccttg gagatccaca tc
<210> 9
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of the qRT-PCR primer BkCPN60 β 4-F' of BkCPN60 Beta-4 gene.
<400> 9
gcagagggta ttgagcag 18
<210> 10
<211> 18
<212> DNA
<213>artificial sequence
<220>
<223>nucleotide sequence of the qRT-PCR primer BkCPN60 β 4- R' of BkCPN60 Beta-4 gene.
<400> 10
aacctttatt gccgagcc 18
Claims (2)
1. 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone, it is characterised in that the nucleotide sequence of the gene is such as
Shown in SEQ ID No:1.
2. the coding albumen of 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone, it is characterised in that the gene encodes egg
White amino acid sequence is as shown in SEQ ID No:2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611045376.XA CN106754952B (en) | 2016-11-24 | 2016-11-24 | 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611045376.XA CN106754952B (en) | 2016-11-24 | 2016-11-24 | 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754952A CN106754952A (en) | 2017-05-31 |
| CN106754952B true CN106754952B (en) | 2019-09-10 |
Family
ID=58975326
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611045376.XA Expired - Fee Related CN106754952B (en) | 2016-11-24 | 2016-11-24 | 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754952B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734914B (en) * | 2019-10-28 | 2020-10-27 | 东北林业大学 | Creation method of golden betula forbesii |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2004166504A (en) * | 2002-11-15 | 2004-06-17 | Hackberry Inc | Method for cultivating transgenic plant |
| WO2010105095A1 (en) * | 2009-03-11 | 2010-09-16 | Sapphire Energy, Inc. | Engineering salt tolerance in photosynthetic microorganisms |
-
2016
- 2016-11-24 CN CN201611045376.XA patent/CN106754952B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2004166504A (en) * | 2002-11-15 | 2004-06-17 | Hackberry Inc | Method for cultivating transgenic plant |
| WO2010105095A1 (en) * | 2009-03-11 | 2010-09-16 | Sapphire Energy, Inc. | Engineering salt tolerance in photosynthetic microorganisms |
Non-Patent Citations (3)
| Title |
|---|
| 4 种桦树幼苗耐盐性分析与评价;纳晓莹等;《植物研究》;20151231;第35卷(第6期);第873-882页 |
| A Chaperonin Subunit with Unique Structures Is Essential for Folding of a Specific Substrate;Lianwei Peng et al.;《PLoS Biology》;20111231;第9卷(第4期);第1-13页 |
| 水稻叶绿体伴侣蛋白Cpn60超表达株系农艺性状和抗盐性研究;周丽;《中国优秀硕士学位论文全文数据库农业科技辑》;20160215(第02期);摘要 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754952A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200095600A1 (en) | Corn genes zmspl1 and zmspl2 and uses thereof | |
| CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
| CN111235165B (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
| CN109232725A (en) | Soybean C2H2 type single-zinc finger protein transcription factor and encoding gene and application | |
| CN109266647B (en) | Rice stem borer-killing inducible promoter and application thereof | |
| CN114703226A (en) | Application of rice OsUBC27 gene or protein coded by same in improving rice yield | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN107304422A (en) | Control the application of the OsSBR1 genes and its RNA interference fragments of resisting rice sheath blight | |
| CN106754952B (en) | 60 subunit Beta-4 gene of Kirghiz Republic white birch chloroplaset chaperone and its coding albumen | |
| CN110564740B (en) | A gene AtPIP2 for improving disease resistance of plants; 7 and uses thereof | |
| CN108315335A (en) | The drought-induced transcription factor PbrWRKY53 of pears and its application in terms of improving plant drought ability | |
| CN109206494B (en) | Application of ZmRPH1 gene in regulation and control of plant height and lodging resistance of plant | |
| CN109456969B (en) | Rice brown planthopper-harming inducible promoter and application thereof | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN110468118A (en) | Wax plum SUMO E3 ligase gene C pSIZ1 and its application | |
| CN110204600A (en) | BnSPL14 gene, albumen and its application in control cabbage type rape plant type | |
| CN109776664A (en) | A kind of gene and its application controlling rice class granule and semi-dwarf mutant | |
| CN109355297A (en) | Dendrobium candidum DcWOX4 gene and its application in raising axis tiller | |
| CN105925587B (en) | Early rice chloroplast development gene subjected to low-temperature response and detection method and application thereof | |
| CN112029777B (en) | OsALIS4 gene for reducing rice setting percentage and protein obtained by encoding same and application thereof | |
| CN105132428B (en) | A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application | |
| CN107573411A (en) | Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled | |
| CN110358774B (en) | Gene, protein, gene expression cassette, expression vector, host cell, method and application for controlling rice flowering time | |
| US20170067071A1 (en) | Corn genes zmspl1 and zmspl2 and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190910 Termination date: 20201124 |