CN106754901B - A pair of control muskmelon hairiness/hairless character allele GL/gl - Google Patents

A pair of control muskmelon hairiness/hairless character allele GL/gl Download PDF

Info

Publication number
CN106754901B
CN106754901B CN201611159582.3A CN201611159582A CN106754901B CN 106754901 B CN106754901 B CN 106754901B CN 201611159582 A CN201611159582 A CN 201611159582A CN 106754901 B CN106754901 B CN 106754901B
Authority
CN
China
Prior art keywords
gene
muskmelon
hairless
hairiness
character
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201611159582.3A
Other languages
Chinese (zh)
Other versions
CN106754901A (en
Inventor
杨路明
朱华玉
马长生
李严曼
胡建斌
孙守如
朱磊
孙小粉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Agricultural University
Original Assignee
Henan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Agricultural University filed Critical Henan Agricultural University
Priority to CN201611159582.3A priority Critical patent/CN106754901B/en
Publication of CN106754901A publication Critical patent/CN106754901A/en
Application granted granted Critical
Publication of CN106754901B publication Critical patent/CN106754901B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to genetic engineering fields, and in particular to a pair of control muskmelon trichome develops the allele of (hairiness/hairless)GL/gl.Control the gene of the hairless character of muskmelongl, it is recessive homozygosis in no batt material, full length gene 5366bp, specific base sequence is as shown in SEQ ID NO.1；Control the gene of muskmelon hairiness characterGL, it is dominant homogeneous or heterozygosis in having batt material, specific base sequence is as shown in SEQ ID NO.2.The present invention has carried out finely positioning to the hairless character of muskmelon for the first time, and is further realized pair using chromosome walkingGL/glThe final clone of gene is of great significance to understanding muskmelon epidermal hair Forming Mechanism and its regulated and control network；There is batt material according to the gene simultaneously and without the sequence difference in batt material, developing the stable specific dCAPS functional label for the gene, can be applied to molecular mark to simple and effective.

Description

A pair of control muskmelon hairiness/hairless character allele GL/gl
Technical field
The invention belongs to genetic engineering fields, and in particular to a pair of control muskmelon trichome development (hairiness/hairless) etc. Position geneGL/gl。
Background technique
Muskmelon (Cucumis meloL.) be Curcurbitaceae Cucumis annual crop, have extensive genetic diversity and Phenotypic Diversity.China is one of the country for cultivating muskmelon earliest in the world, and melon wilt area maximum, yield in the world Highest country, muskmelon have more than 3000 years cultivation histories in China, and wherein North China, China is the secondary of Melon The centre of origin.
Muskmelon normal plant stem, leaf, calyx, ovary surface are covered with epidermal hair, and are many cells Non-gland body epidermal hair.It plants Object epidermal hair have a series of functions, it can be used as first barrier protect the plants from insect and pathogen infringement and Reduce the biology such as mechanical damage and ultraviolet light harms and abiotic stress.But without batt material also Chang Youqi specific use, such as with Found in the cucumber of its same category, no batt material can both reduce pesticide residue (Wang Guiling etc., the heredity of cucumber fruit tumor and 2007,24 (2): 168-172), and resistance (Han Qiang etc., the nothing to part pest can be enhanced in SSR marker, BULLETIN OF BOTANY Vol. Hair and the identification of hairiness cucumber seedling aphid resistance, Shandong agricultural sciences, 2010,7:74-76)；Hairless character is very suitable to make simultaneously For morphological markers, the character with genetic marks in especially seedling stage in entire growth period can be used as, for melon crop crossbreeding and miscellaneous Hand over seedling stage Rapid identification (Foster RE, Glabrous, a new seedling marker in of generation seed purity Muskmelon, J Hered, 1963,54:113-114).
Muskmelon is reported for the first time entirely without chalaza variant material within American scholar Foster 1963, find the mutant Epidermal cell is all different from orthodox material from size, shape and quantity, but roots development is identical as orthodox material；Further lose Pass analysis the result shows that, which is by a pair of stealthy Dominant gene (Foster RE, Glabrous, a new Seedling marker in muskmelon, J Hered, 1963,54:113-114).Wang Huilin etc. (2003) reports sweet tea Melon vines have carried out Primary Study without bristle mutant character, and to the genetic affinity of the character and normal vines, it was demonstrated that muskmelon stem Climing no bristle character is recessive character (Wang Huilin etc., breeding of the muskmelon vines without bristle mutant controlled by a pair of of karyogene And genetic analysis, Chinese watermelon and muskmelon, 2003, (6): 1- 2).Then, still foundation etc. (2006) compares muskmelon vines light Sliding hairless mutant material and phenotypic character of the vines without bristle mutant material, and genetic affinity between the two is ground Study carefully, it was demonstrated that muskmelon vines are two pairs of non-allelic genes without bristle gene and vines Glabrous gene, and vines Glabrous base Because there is stealthy epistatic action (still foundation etc., something lost of the muskmelon vines without bristle Yu Glabrous character without bristle gene to vines Pass relationship analysis, Chinese melon dish, 2006 (4): 7- 9).
In general, less to the research report of the hairless character of muskmelon both at home and abroad at present, and only rest on to its heredity rule In rule analysis and the research of physiological property, and the molecule machine of the positioning for muskmelon trichome development gene, clone and its formation The research of system still belongs to blank.Therefore, finely positioning is carried out to the hairless character of muskmelon and cloned, further study the molecule of its formation Mechanism has great theoretical and practical significance the basic research and molecular breeding of muskmelon.
Summary of the invention
The object of the present invention is to provide a pair of control muskmelon trichome whether there is or not alleleGL/gl, thus for research sweet tea Molecular mechanism, the Molecular Identification of muskmelon material phenotypic character, muskmelon idioplasm screening, identification and the muskmelon molecule that melon epidermal hair is formed The foundation of marker-assisted breeding system provides application foundation.
Details are as follows for the technical solution that the application is taken.
The gene of one control hairless character of muskmelongl, the gene be in no batt material it is recessive homozygous (gl/gl), it can press down The ciliary development of muskmelon processed, leads to plant surface Glabrous, and gene order overall length 5366bp, specific base sequence is such as Shown in SEQ ID NO.1；
The gene of one control muskmelon hairiness characterGL, with the hairless character gene of muskmelonglAllele each other, the gene In having batt material for dominant homogeneous (GL/GL) or heterozygosis (GL/gl), the trichome development of the muskmelon containing the gene is normal, Plant surface covers trichome, and gene order overall length 5366bp, specific base sequence is as shown in SEQ ID NO.2.
The gene of the control hairless character of muskmelonglApplication in melon variety cultivation, can cultivate nothing using the gene Hair character New melon variety.
For identificationGlWithglDCAPS molecular labeling, be named as dCAPS1, which is based onGlWithglIt is complete Length dna sequence difference is designed and developed, and pcr amplification product of the molecular labeling in no batt material is 124bp, and base sequence is such as Shown in SEQ ID NO.3；The label is 124bp, base sequence such as SEQ ID NO.4 there is the pcr amplification product in batt material It is shown；
Compare the sequence of SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.3 sequence and SEQ ID NO.4 sequence exist There is a base mutation at 21bp；SEQ ID NO.4 has the restriction enzyme site of an EcoRI, digestion products size at 16-21bp 108bp；And SEQ ID NO.3 does not contain the restriction enzyme site, therefore primer size is still 124bp after digestion；Therefore it is produced according to PCR Stripe size after object digestion can be distinguished effectivelygl/gl、GL/GL、GL/glThree kinds of genotype.
It is described to hairless geneglThe detection method of the molecular labeling dCAPS1 of complete linkage, using PCR product digestion Detection method, when PCR amplification, primer sequence design is as follows:
DCAPS1-F:5 '-GGTTGCGGGAGATGGGAATT -3 ',
DCAPS1-R:5 '-TGAAACTCGTGAAGCTTCGGTTC -3 '
To with hairless geneglThe detection method of the molecular labeling dCAPS1 of complete linkage is detected using PCR product digestion Method carries out EcoRI digestion to the pcr amplification product of the label, and obtaining primer size is that 124bp isgl/glGenotype, plant Phenotypic Expression is hairless；Obtaining primer size is that 108bp isGL/GLGenotype, plant phenotype show as hairiness；It obtains simultaneously 124bp and 108bp product isGL/glGenotype, plant phenotype show as hairiness.
Molecular labeling dCAPS1 with hairless gene complete linkage is in muskmelon genotype detection and molecular mark In application facilitate the gene for detecting muskmelon hairiness character using the molecular labelingGLOr the gene of the hairless character of muskmelongl。
With the improvement of living standards, increasingly paying attention to the quality trait of product in breeding research.The hairless character category of muskmelon In organoleptic quality scope, smooth-skined hairless melon variety has and reduces pesticide residue, reduce worm's ovum attachment, pollute less, side It just the advantages that cleaning, sanitary edible, thus is the ideal kind of Pollution-free Fruit development.And muskmelon hairless geneglControl table The formation of fur, thus muskmelon quality breeding process will be pushed effectively to the further investigation of the gene.
On the other hand, with the continuous development of biotechnology level, the method for cloning target gene is also more and more diversified, The method of map based cloning is the genetic linkage analysis using segregating population, by constructing highdensity genetic map, is found and mesh Gene close linkage molecular labeling, the gene and then is cloned in continuous diminution candidate region.Meanwhile molecular labeling is from DNA Level is upper to select objective trait, have many advantages, such as it is efficient, quick, not by environmental influence, thus utilization and purpose Assistant breeding is marked in the molecular labeling of character close linkage, is highly effective breeding method, can be selected in seedling stage, Accelerate breeding process.Therefore, hairless gene is clonedglAnd developing with the molecular labeling of the gene complete linkage will be muskmelon molecule Marker-assisted breeding is laid a solid foundation.
DCAPS1 molecular labeling provided in the application, hairiness homozygosis material (GL/GL) amplified production in have The restriction enzyme site of EcoRI, primer size 108bp after digestion is cut；DCAPS1 hairiness hybrid material (GL/gl) amplified production Middle half has the restriction enzyme site of EcoRI, and primer size 108bp after incision, half does not have the restriction enzyme site of EcoRI, and PCR product is cut Do not open, still keep original size 124bp, i.e. dCAPS1 have simultaneously after the PCR product digestion in hairiness hybrid material 108bp and Two bands of 124bp；DCAPS1 without batt material (gl/gl) amplified production in there is no the restriction enzyme site of EcoRI, product after digestion Size is still 124bp.Since dCAPS1 molecular labeling has the advantages that stability is high, reproducible, thus can be in hairless geneglMolecular mark system building in play a key effect.
In short, the present invention for the first time carries out the hairless character of muskmelon using sequence comparison and molecular markers development technology is resurveyed Finely positioning is further realized pair using chromosome walkingGL/glThe final clone of gene is formed to muskmelon epidermal hair is understood Mechanism and its regulated and control network are of great significance, and lay a solid foundation for research muskmelon trichome development Regulation Mechanism；Together When having batt material according to the gene and without the sequence difference in batt material, developing the stable exceptional function for the gene DCAPS1 is marked, can be applied to molecular mark to simple and effective, for building for muskmelon molecular mark system It is vertical to provide safeguard.
Detailed description of the invention
Fig. 1 is muskmelon hairless geneglThe flow chart of map based cloning, whereinglRepresent hairless gene；
Fig. 2 is the restriction enzyme digestion and electrophoresis figure of dCAPS1 PCR product in natural population, and wherein M represents marker；1 is normally to have Hair plant material M68；2 be hairless plant material NSL73046；Remaining band be from the germplasm materials that this laboratory saves with (since material is more, but result is consistent, therefore corresponds to germplasm materials no longer for band for 23 parts of natural population's materials that machine is chosen It is described in detail), material phenotype is all normal hairiness.
Specific embodiment
It is further explained explanation below with reference to application, before introducing specific embodiment, with regard to biological in following embodiments Material, experiment reagent and related experiment background are briefly discussed below.
Biomaterial:
Muskmelon is maternal without batt material NSL73046(), it is provided by United States Department of Agriculture's USDA germ plasm resource center, vines surface, It is touched with hand very smooth without bristle and fine hair in petiole, blade and ovary；
Muskmelon orthodox material M68 is by the self-mating system of this seminar breeding, vines surface, petiole, blade, ovary surface There are bristle and short down, has difficult to handle sense with hand touch is rougher；Its phenotypic character except trichome normally in addition to, remaining and NSL73046 Phenotype it is almost the same, therefore male parent is done using M68.
In experimentation, muskmelon parent and group's plantation are planted in the heliogreenhouse of the scientific and educational park Agricultural University Of He'nan Mao Zhuan During plant, hole plate seedling growth is carried out after vernalization, using normal melon wilt way to manage, in one heart stage of three leaves to Relevant phenotype Character carries out investigation statistics.
Experiment reagent:
In experimentation, PCR amplification PCR MagicMix 3.0 is purchased from Beijing day bounties Gene Tech. Company Limited；Its Its electrophoresis and silver staining related reagent such as acrylamide, methene acrylamide, AgNO3, the reagents such as NaOH and formaldehyde be purchased from Beijing rope Lai Bao Science and Technology Ltd.；
PCR amplification primer (artificial synthesized) and gene sequencing in experimentation, by Beijing promise match genome research Heart Co., Ltd provides completion.
Experimental facilities:
PCR instrument is Heima Medical Instrument Co., Ltd., Zhuhai City Hema9600 type gene-amplificative instrament；
Electrophoresis apparatus is the universal electrophoresis apparatus of JY300HC, is produced by Beijing east Jun Yi electrophoresis equipment Co., Ltd；
Electrophoresis tank is HT-SCZ04A high throughput Vertial electrophorestic tank, by Beijing Hong Tao Foundation Technology Development Co., Ltd Production.
Embodiment 1
It is building including hereditary segregating population, preliminary fixed for muskmelon hairiness/hairless gene analytic process in the application The processes such as position, finely positioning and map based cloning, positioning result is as shown in Figure 1, related experiment process is briefly discussed below:
One, the building of hereditary segregating population
It (needs to explain using muskmelon orthodox material M68 as male parent as female parent without batt material NSL73046 using muskmelon It is that during experiment, from material is ready availability and easy to operate consideration, inventor is using M68 as male parent, using other homozygous hairiness When material, related experiment can be equally carried out), cross combination is configured with using the two parents, the results showed that, the F of acquisition1Generation The normal hairiness of plant.
From F1For 10 single plants are selected in plant, selfing obtains F2For seed.Then 1160 F are randomly selected2Seed is used In genetic analysis and the assignment of genes gene mapping.To these F2Generation hairiness/hairless phenotype of individual is identified, and is tested with Chi-square test Card.
The result shows that:
When Primary Location, 438 plants of F are randomly selected2Group, wherein 327 plants of hairiness, hairless 111 plants, X2=0.0274 (X2 0.05=3.84), meet the segregation ratio of 3:1；
When finely positioning, 1536 plants of F of group2Group, wherein 1156 plants of hairiness, hairless 380 plants, X2=0.0556 (X2 0.05=3.84) segregation ratio of 3:1, is also corresponded to.
It follows that Muskmelon Plants Glabrous character is controlled by 1 pair of karyogene, it is by the unnamed genegl, have Hair (GL) to it is hairless (gl) it is dominant.
Two, the Primary Location of gene
Primary Location, specific experiment process are carried out using BSA method are as follows:
(1) firstly, preparing gene pool, specifically:
In the F of above-mentioned steps one210 normal hairiness single plants and 10 hairless single plants are randomly selected in group, in three leaves one Heart stage, acquires young leaflet tablet undeployed above each single plant, extracts its genomic DNA using CTAB method, and be mixed Hair gene pond and hairless gene pond (hairiness is mixed with hairiness, hairless to mix with hairless).
(2) polymorphism screening analysis, specifically:
Utilize the inventor's early period of prepared from 384 pairs of SSR primer pair steps (1) that muskmelon full-length genome is developed two Gene pool carries out polymorphism screening, and the label of the different banding patterns obtained in two gene pools is known as polymorphism mark.
Further, by the polymorphism SSR marker filtered out to 438 plants of F2Group (selected when Primary Location in step 1) Genotyping is carried out, banding pattern identical as hairless parent obtained is denoted as 1, obtains the note of banding pattern identical as hairiness parent Make 2, obtain heterozygosis banding pattern is denoted as 3.
In above-mentioned analytic process, when PCR amplification, the design of 10 μ L amplification systems is as follows:
Gene pool sample (genomic DNA, 30ng/ μ L), 1 μ L(about 30ng)；
F, R primer, each 0.5 μ L(primer concentration are 5 μm of ol/L)
PCR MagicMix, 5.0 μ L；
ddH2O, 3.0 μ L；
PCR amplification program are as follows: 94 DEG C, 5min；94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 30s, 35 circulations；72℃ 5min。
It is to be understood that F, R primer in above-mentioned PCR amplification system respectively represent preceding primer in pair of primers and after Primer；384 pairs of SSR primers, since these primers and the application theme to be protected are not directly linked, for the sake of text simplicity, no It is described in detail again.
8% native polyacrylamide gel electrophoresis detection is carried out to pcr amplification product.When electrophoresis detection, polyacrylamide Gel-runing buffer is 0.6 × TBE, 1 ~ 1.5h of 200V constant pressure electrophoresis.Silver staining is carried out after electrophoresis, to observe and to examine It surveys, silver staining method are as follows:
A, the glass plate with glue is put into fixer, the color until indicator is decorporated is gently shaken on shaking table, wherein The group of fixer becomes, glacial acetic acid: dehydrated alcohol: the volume ratio of distilled water is 0.5:10:100；
B, with 1 ~ 3min of ultrapure washing；
C, the offset plate after flushing is put into dyeing liquor and shakes 10 min, dyeing liquor is 0.2% silver nitrate aqueous solution；
D, the offset plate after dyeing is put into ultrapure water and rinses 30s, be put into the plastic casing equipped with developer solution, gently shake Until band is clearly presented, developer solution is that 15g NaOH and 3mL formaldehyde is added in 1L distilled water to be uniformly mixed so as to obtain；
E, tap water is finally putting into rinse repeatedly several times；
F, it dries, then takes pictures at room temperature.
(3) gene Primary Location, specifically:
In conjunction with the genotyping result of SSR marker final in 438 plants of Primary Location group phenotype survey datas and step (2), benefit With JoinMap3.0 software, Primary Location is carried out to muskmelon hairless gene, as a result obtain 2 withglThe SSR of gene close linkage Molecular labeling: CmSSR19480 and CmSSR19495(correlative coding is that inventor voluntarily encodes in research process, and does not have spy Different meaning), the two molecular labelings are located at hairless geneglThe both ends of gene, respectively withglGene is at a distance of 1.3cM and 1.1cM (as shown in Figure 1).
Three, the finely positioning of gene
On the basis of step 2 Primary Location, inventor is further to hairless geneglGene has carried out finely positioning, tool Body process is briefly discussed below.
(1) parent resurveys sequence and genome alignment
Two parent materials are carried out using Illumina Hi-seq2000 high-flux sequence platform to resurvey sequence, control sequencing Depth > 20 times；With the muskmelon whole genome sequence (https: //melonomics.net/genome/) announced in SSR marker The conduct reference sequences of section between CmSSR19480 and CmSSR19495 utilize online disclosed freeware packet BWA (http://bio-bwa.sourceforge.net/) respectively compares the heavy sequencing sequence of two parents and candidate section It is right, two parents are found in the difference site of candidate section.
(2) finely positioning
Compare sequence difference of the two parent's genomes in the candidate section of Primary Location, selects sequence difference compared with as large as 3 Then more than a base insertion or deletion segment utilize online software Primer3(http: //bioinfo.ut.ee/ Primer3-0.4.0/primer3/) design primer develops 7 pairs of Indel labels, is named as Indel1-Indel7.To 438 plants F2Target group carry out genotyping, obtain 2 withgl The label of close linkage, Indel1 and Indel6, respectively withglBase Because at a distance of 0.3cM and 0.1cM.Mapping population is further expanded to 1536 plants of further finely positionings to hairless gene, is looked for To two withglApart from closer label, Indel2 and Indel5 finally willglThe assignment of genes gene mapping in the range of 11.58kb (such as Shown in Fig. 1).
(3) map based cloning
Predictive genes are carried out to the sequence of the 11.58kb section where candidate gene, only predict 1 gene, to it is pre- Cls gene is sequenced, and sequencing result is hairless genegl, overall length 5366bp, as shown in SEQ ID NO.1；Further right Position is answered, sequencing, which obtains its allele, hair geneGLGene, full length gene 5366bp, as shown in SEQ ID NO.2.To having Hair geneGLGene and hairless geneglThe sequence of gene is compared, and finding the gene, there are 10 single bases between two parents Mutation, wherein 6 are located at and include subregion, 4 are located at exon region, first mutation of no batt material Exon be by TCA sports TAA, and the gene is caused to terminate in advance in no batt material.
Embodiment 2
On the basis of 1 sequencing result of embodiment, it is based onGLWithglThe mutational site exon TCA-TAA, one can be designed It is a for identificationGlWithglThe dCAPS molecular labeling of gene, is named as dCAPS1, is carried out using the dCAPS1 molecular labeling When PCR amplification, primer sequence are as follows:
DCAPS1-F:5 ' GGTTGCGGGAGATGGGAATT 3 '
DCAPS1-R:5 ' TGAAACTCGTGAAGCTTCGGTTC 3 '；
Using the primer pair, the pcr amplification product in hairless parent material is 124bp, base sequence such as SEQ ID Shown in NO.3；The long 124bp of PCR amplification sequence in hairiness parent, base sequence is as shown in SEQ ID NO.4；
Compare the sequence of SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.3 sequence and SEQ ID NO.4 sequence exist There is a base mutation at 21bp, therefore SEQ ID NO.4 has the restriction enzyme site of an EcoRI at 16-21bp, that is, the sequence The restriction enzyme site 5 '-GAATTC-3 ' containing restriction enzyme EcoRI is arranged, therefore enzyme is carried out to its digestion products using EcoRI After cutting, primer size 108bp；
And SEQ ID NO.3 is free of the restriction enzyme site of restriction enzyme EcoRI, therefore primer size is still after digestion 124bp；Therefore it according to the stripe size after PCR product digestion, can effectively distinguishgl/gl、GL/GL、GL/glThree kinds of genotype.
In other words, digestion verification carried out to the PCR product of dCAPS1 molecular labeling, hairiness parent (GL/GL) in have EcoRI Restriction enzyme site, the digestion products size after PCR amplification is 108bp；Hairless parent (gl/gl) because occurring in restriction enzyme site region Base mutation is cut not open without the restriction enzyme site of EcoRI, PCR product, still keeps original size 124bp.Based on this principle base Plinth, dCAPS1 molecular labeling can effectively distinguish three kinds of genotypeGL/GL(hairiness),GL/gl(hairiness),gl/gl(hairless).
On above-mentioned experiment basis, in muskmelon idioplasm material all over the world, to be randomly choosed collected by inventor (specific material information is as shown in the table, it is to be understood that the muskmelon idioplasm material is that invention is artificial for 23 parts of materials Gained is collected during making, related germplasm materials also have preservation at home and in the professional Germplasm Bank in external part, in addition following works Make to be only experimental verification, related germplasm materials and the application protect theme and do not have direct correlation property, thus provide only this The essential information of a little germplasm materials), dCAPS1 molecular labeling function is further verified.The muskmelon of these natural populations Germplasm materials are all normal hairiness material:
。
Digestion verification is carried out to PCR product of the dCAPS1 label in two parents and natural population, digestion system designs such as Under:
PCR product, 2 μ L；
10 × Buffer EcoRI, 1 μ L；
EcoRI, 1 μ L；
Nuclease-free water(ddH2O), 6 μ L；
37 DEG C of digestion 10h.
As a result as shown in Figure 2.From figure 2 it can be seen that after to PCR product digestion, in addition to M68 is a band of 124bp, Other all materials are all the only bands of 108bp, illustrate that other materials is allGL/GLGenotype.Based on this result, show DCAPS1 molecular labeling can effectively distinguish batt material and without batt material, at the same also illustrate the gene be strictly control hairiness/ The target gene of hairless character.
SEQUENCE LISTING
<110>Agricultural University Of He'nan
<120>a pair of control muskmelon hairiness/hairless character allele GL/gl
<130> none
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 5366
<212> DNA
<213> Cucumis melo
<400> 1
atgttcgatc cagatatgtt tgatactact caccatcata tgcttgaaga gttggaaaat 60
atgagagacg atgattttga caacaaatca ggtgcagaaa tcttggaatc tgcttgtgga 120
attgaccaac aacaacaacg ttctaaaaag aaacgttaca atcgtcatac acaacatcaa 180
atccaagaaa tggaagcgta agtcgtctgg actacaccta tccttttttt ttttttcctt 240
tttttccttc agttaaacgg ataaaaatct caatgttatt tttttgtttc atttgtcaga 300
ttctttaagg aatgtcctca cccagatgat aagcagagaa tggagctgag tcgtgagctg 360
gggttggagc cattgcaagt caagttttgg tttcaaaaca aacgcacaca aatgaaggtg 420
accatacaaa tctatttaat attttatttt ggaggaatca cacatttttc tatacttcct 480
aaacttttgg atttagtttc taaagattga aaatgttata actttacact tgagatttgt 540
ctcaatttgg tttctaatat agagatctat attttttaat atgagttttt cagtaaacac 600
tcttttttca tcttaaatgt taagtaagcg tctactaatt aagtttcatt cttgttcatt 660
tctattaaaa ttaaattcaa aaattcactc tataattaaa gtaaattaga tgaatcgtga 720
atatttaata aaaatctaag ttttaaaaag taaatgttga aacttaggaa gtaaattaaa 780
agagaaaaaa aaaactcaaa tctgtgacct tatgacccaa aacttggaaa tgggaatgtt 840
taactgtggt tgtgttaatt tgaacgagag aaggctcaac acgagagaca tgaaaacgca 900
atactgaagg ccgaaaatga gaaacttcgt gctgagaata tacgttatag agaagcattc 960
gctcattcaa cttgccctaa ctgcggatct tcctccactg cactcggcga aatgtccttt 1020
gacgaccaac atttacgcat tgagaattcc cgcttgcgag atgaggtcat actcttatta 1080
ctattactac tatttctctt ttttctttat ttcaatatat atatatatat atacatactt 1140
ttttttttta ataacttaaa ataggttata aatagctata ctgcaagaag taagctaaaa 1200
aagtaacaat ccaccatatt cagattagtg ttcaataact ttctttcttt ctttgtttct 1260
tttttgaaag aaaaagaaaa tgatatggat atctggtttg ggttggtatg tagttcgtag 1320
ttattttatg actgaaccca gacattttta attgtaacag atacttataa gatctttttg 1380
gatagatacg agtggagaaa aaactatagc attgcaagca accacacatt caatactaaa 1440
tttattattc acaattaaca tatacggcga gtttattgtt tggcccattc cagtttcata 1500
tttttctcaa cacatacctc tccaacgact accatattta cgtatttatt ccatttcacc 1560
aaatctattc ttgtaatttt cctttatttc ccttcttttt tttttctttt ttctttttta 1620
aaaaaaagta gtcaagcatt gcattgtgtc tgtataggtg ggtgtgatga gtggtcacaa 1680
ttcaactctt atttcacata ttgttcaaca ataaaataag gaaataatat atatatatat 1740
atatatatat atttgaagtt gataggtttt aggttcggtt tttattttct ctcttgattt 1800
caaaatatta taaaatttag tccttaagct tcattattta tacattttca actcttgatt 1860
agattagttt gcaataatct cctgtgaact tcaattaatt ttttttttta caacgtaatt 1920
atttgaactt agttgacttg aagagtcaaa gttatcatta ttagacagga gatgtgagtg 1980
taaaaatgta gaatattaca acattggtag ttaacataaa aaaagtaaat ttaatattta 2040
aaaaagtaaa attaaagata aggttttgaa tttagggaaa gagaaattag ggttaaaagt 2100
ggatataaaa tataaaattt tttagagaga aagaatgaaa taataattat attaaaatca 2160
gactttctat tttcacaaaa ttaaatgtga taataattgg cagtgaggag tactgcagtg 2220
gctgtgggta agatcataat tacccgaaat taggaaatag agatttttat gattgttgtg 2280
aatttatatc actgtgtcct tttccgcctc ttgtcataaa tttttaattc acattttagt 2340
ccattaaata ttttcgtact ttactttttg cttccaccca aaaaaaacat attaaatttt 2400
gttacactgt caatttattt ttgtaagtgc tataaattac acatcattac aaaaagataa 2460
gagattttct tgaattgttg actctaaatt tttttttttg aagttttgat cattatttgt 2520
tgaagtatga ggatatttaa ttaacacaca tcacaatatc aacatataga tttactttat 2580
ttataatggt taacacaaaa gaatcacctt atgaactaac acatgaaatg attttagatt 2640
taaaacaatt ttagcttagt accaaatacc attgttttaa gaaaaaagtg attttggcaa 2700
agaaaaaagg attttgactg tctcaatttc acttccaaac aatccataaa ccggttggat 2760
caaaatcatg aattctaaaa tcatcaacaa aactacccta atttttgttt gggagtgttt 2820
caatttacat gctcattttg agattccatt gatgataata tacgagacag atcgagcgaa 2880
tgagtggata tggctcaaaa tgcacaaagc catactacca gcttccaaca aatgctccaa 2940
cgcgatcttt agacttgggc atcacaaact tcggtccaca gtcgtcggga ttcgtagggg 3000
aaatgtatgg agcagcggac tttttccggt cgatatcgag gccttcggaa ggtgagaagc 3060
cggtgatcgt ggagctggcg gtatcgggga tggaggaatt gaggagaatg gctcagggag 3120
gggagccatt gtgggttgcg ggagatggga agtaatcagg ggaagtggtt cttaatgaag 3180
cggagtattt gaggagtttc ggagggggaa ttgtgggaaa gcccatgggg tttagaaccg 3240
aagcttcacg agtttcagct gttgtgttca tgaaccatat gaagttggtg gatattttta 3300
tggatgctgt acgtttaatt ccatttttct ttgaataact attagttatg cgtaaattag 3360
tattgatatt aataattttg tttgtgtttg tgttttttag acgcaatggt cgactgtgtt 3420
ttgcggcatt gtttcgagag catccactgt ggaaattctt tcgcctggct tatctggaaa 3480
cttcaatggg gccttgcatg tggtactcaa actaaaccct atctcactcc cccacctatg 3540
gtacataata aataatataa aaatttcaca aaaagattac ttaatcatta caaatctaaa 3600
aacaaaggga gccaattcat cacacattaa acttcaaagg actaaataat tgtaatcaat 3660
gtaaagtata aacacatttt ttacttgtgg gttttttata ttttctatat agacatttga 3720
attcatagtt aatttgaaaa aaaaatatat cttttgaaaa aaattgactt tgatttggtt 3780
gattttgaaa agaattcaaa aacttagacg acgatgtata tgaataaaat aaaaatataa 3840
tcgaaagttt gttataaaaa ttgatgggtt ttgtattaaa cgatcgaaca gatgagcgct 3900
gaatttcaag tcccatcgcc acttgttcca actcgtgaaa actatttcgt aagatactgc 3960
aaacaacaaa ctgatggttc atgggcagtg gctgatgttt ccttagacac cttgcgccct 4020
tctcccatcc caaatacccg aaggaaaccc tctggttgct taattcaaga attacccaat 4080
ggttattcca aggttacaaa actcattctc tctttgacaa ccctttcatt caacatcatc 4140
tcaattctga tctttgttta actttggatt gatttattct tcagatcact tgggtcgaac 4200
atgtagaggt cgacgaaacc ggcgtcccca caatgtaccg gactcttgtt aattccggcc 4260
tcgctttcgg ggctaagcga tgggttgcta ccttagatcg ccaatctgag cgtttcgcta 4320
cttcaatcgc caccaccatt cccaccggcg atttacgcgg tactacttta ctttcttcat 4380
tcttctgttt cccccggttt ttcccccatg attcccacta atttgatata atttaaatcc 4440
agtgatctca agtattgaag ggaggaagag tatgctgaag ctagcagaga gaatggtgac 4500
gagcttctgc gccggtgttg gtgcgtccag tgtacacgct tggacggcat tacccgctgc 4560
agctggcgat gaagtacgtg ttgtgacgag gaagagcacc gacgaaccag gacgaccacc 4620
gggtgttgtg ttgagcgccg ccacttcttt ttggattccg gtttcaccta aggttgtttt 4680
tgattttctt cgaaaagaga aatctcggag cgaggtacgt acgtacataa catacatata 4740
aacatcttaa caatcgttaa gtaaacaaag tattaaaata tttgcaatat tttttcagtg 4800
ggatattctg tcaaatggtg gattagttca ggaaatggcg cacatagcca acggccgtca 4860
ctcagggaat tgtgtctcct tgcttcgtgt caatgtcagt aaattattct ttttccaaaa 4920
acatttagta acaattatta gttaacacaa taaattaatg aaaattctaa aatttgatgt 4980
tttttttgta gagtgcgaat tcgagccaga gcaatatgct gatactacaa gaaagctgca 5040
cggactcaac gggatcgtac gttatttatg ctccggtgga caccgtggca atgaacgtcg 5100
tgctaagtgg ttgcgatcct gattacgtgg cgcttctacc gtcgggattc gccatacttc 5160
cagacggacc cggcggagga ggaaacaacg gcggcggaat tctagagctg ggatcgggag 5220
gatcactcat cacggttgca tttcaaatcc tggttgattc agttccaacg gcaagacttt 5280
caattggatc agtagccacc gttaacagtc tcataaaatg cacggttgag agaatcagag 5340
ccgctgtgat gcgtgaaagc ccatga 5366
<210> 2
<211> 5366
<212> DNA
<213> Cucumis melo
<400> 2
atgttcgatc cagatatgtt tgatactact caccatcata tgcttgaaga gttggaaaat 60
atgagagacg atgattttga caacaaatca ggtgcagaaa tcttggaatc tgcttgtgga 120
attgaccaac aacaacaacg ttctaaaaag aaacgttaca atcgtcatac acaacatcaa 180
atccaagaaa tggaagcgta agtcgtctgg actacaccta tccttttttt ttttttcctt 240
tttttccttc agttaaacgg ataaaaatct caatgttatt tttttgtttc atttgtcaga 300
ttctttaagg aatgtcctca cccagatgat aagcagagaa tggagctgag tcgtgagctg 360
gggttggagc cattgcaagt caagttttgg tttcaaaaca aacgcacaca aatgaaggtg 420
accatacaaa tctatttaat attttatttt ggaggaatca cacatttttc tatacttcct 480
aaacttttgg atttagtttc taaagattga aaatgttata actttacact tgagatttgt 540
ctcaatttgg tttctaatat agagatctat attttttaat atgagttttt cagtaaacac 600
tcttttttca tcttaaatgt taagtaagcg tctactaatt aagtttcatt cttgttcatt 660
tctattaaaa ttaaattcaa aaattcactc tataattaaa gtaaattaga tgaatcgtga 720
atatttaata aaaatctaag ttttaaaaag taaatgttga aacttaggaa gtaaattaaa 780
agagaaaaaa aaaactcaaa tctgtgacct tatgacccaa aacttggaaa tgggaatgtt 840
taactgtggt tgtgttaatt tgaacgagag aaggctcaac acgagagaca tgaaaacgca 900
atactgaagg ccgaaaatga gaaacttcgt gctgagaata tacgttatag agaagcattc 960
gctcattcaa cttgccctaa ctgcggatct tcctccactg cactcggcga aatgtccttt 1020
gacgaccaac atttacgcat tgagaattcc cgcttgcgag atgaggtcat actcttatta 1080
ctattactac tatttctctt ttttctttat ttcaatatat atatatatat atacatactt 1140
ttttttttta ataacttaaa ataggttata aatagctata ctgcaagaag taagctaaaa 1200
aagtaacaat ccaccatatt cagattagtg ttcaataact ttctttcttt ctttgtttct 1260
tttttgaaag aaaaagaaaa tgatatggat atctggtttg ggttggtatg tagttcgtag 1320
ttattttatg actgaaccca gacattttta attgtaacag atacttataa gatctttttg 1380
gatagatacg agtggagaaa aaactatagc attgcaagca accacacatt caatactaaa 1440
tttattattc acaattaaca tatacggcga gtttattgtt tggcccattc cagtttcata 1500
tttttctcaa cacatacctc tccaacgact accatattta cgtatttatt ccatttcacc 1560
aaatctattc ttgtaatttt cctttatttc ccttcttttt tttttctttt ttctttttta 1620
aaaaaaagta gtcaagcatt gcattgtgtc tgtataggtg ggtgtgatga gtggtcacaa 1680
ttcaactctt atttcacata ttgttcaaca ataaaataag gaaataatat atatatatat 1740
atatatatat atttgaagtt gataggtttt aggttcggtt tttattttct ctcttgattt 1800
caaaatatta taaaatttag tccttaagct ttattattta tacattttca actcttgatt 1860
agattagttt gcaataatct cctgtgaact tcaattaatt ttttttttta caacgtaatt 1920
atttgaactt agttgacttg aagagtcaaa gttatcatta ttagacagga gatgtgagtg 1980
taaaaatgta gaatattaca acattggtag ttaacataaa aaaagtaaat ttaatattta 2040
aaaaagtaaa attaaagata aggttttgaa tttagggaaa gagaaattag ggttaaaagt 2100
ggatataaaa tataaaattt tttagagaga gagaatgaaa taataattat attaaaatca 2160
gactttctat tttcacagaa ttaaatgtga taataattgg cagtgaggag tactgcagtg 2220
gctgtgggta agatcataat tacccgaaat taggaaatag agatttttat gattgttgtg 2280
aatttatatc actgtgtcct tttccgcctc ttgtcataaa tttttaattc acattttagt 2340
ccattaaata ttttcgtact ttactttttg cttccaccca aaaaaaacat attaaatttt 2400
gttacactgt caatttattt ttgtaagtgc tataaattac acatcattac aaaaagataa 2460
gagattttct tgaattgttg actctaaatt tttttttttg aagttttgat cattatttat 2520
tgaagtatga ggatatttaa ttaacacaca tcacaatttc aacatataga tttactttat 2580
ttataatggt taacacaaaa gaatcacctt atgaactaac acatgaaatg attttagatt 2640
taaaacaatt ttagcttagt accaaatacc attgttttaa gaaaaaagtg attttggcaa 2700
agaaaaaagg attttgactg tctcaatttc acttccaaac aatccataaa ccggttggat 2760
caaaatcatg aattctaaaa tcatcaacaa aactacccta atttttgttt gggagtgttt 2820
caatttacat gctcattttg agattccatt gatgataata tacgagacag atcgagcgaa 2880
tgagtggata tggctcaaaa tgcacaaagc catactacca gcttccaaca aatgctccaa 2940
cgcgatcttt agacttgggc atcacaaact tcggtccaca gtcgtcggga ttcgtagggg 3000
aaatgtatgg agcagcggac tttttccggt cgatatcgag gccttcggaa ggtgagaagc 3060
cggtgatcgt ggagctggcg gtatcgggga tggaggaatt gaggagaatg gctcagggag 3120
gggagccatt gtgggttgcg ggagatggga agtcatcagg ggaagtggtt cttaatgaag 3180
cggagtattt gaggagtttc ggagggggaa ttgtgggaaa gcccatgggg tttagaaccg 3240
aagcttcacg agtttcagct gttgtgttca tgaaccatat gaagttggtg gatattttta 3300
tggatgctgt acgtttaatt ccatttttct ttgaataact attagttatg cgtaaattag 3360
tattgatatt aataattttg tttgtgtttg tgttttttag acgcaatggt cgactgtgtt 3420
ttgcggcatt gtttcgagag catccactgt ggaaattctt tcgcctggct tatctggaaa 3480
cttcaatggg gccttgcatg tggtactcaa actaaaccct atctcactcc cccacctatg 3540
gtacataata aataatataa aaatttcaca aaaagattac ttaatcatta caaatctaaa 3600
aacaaaggga gccaattcat cacacattaa acttcaaagg actaaataat tgtaatcaat 3660
gtaaagtata aacacatttt ttacttgtgg gttttttata ttttctatat agacatttga 3720
attcatagtt aatttgaaaa aaaaatatat cttttgaaaa aaattgactt tgatttggtt 3780
gattttgaaa agaattcaaa aacttagacg acgatgtata tgaataaaat aaaaatataa 3840
tcgaaagttt gttataaaaa ttgatgggtt ttgtattaaa cgatcgaaca gatgagcgct 3900
gaatttcaag tcccatcgcc acttgttcca actcgtgaaa actatttcgt aagatactgc 3960
aaacaacaaa ctgatggttc atgggcagtg gctgatgttt ccttagacac cttgcgccct 4020
tctcccatcc caaatacccg aaggaaaccc tctggttgct taattcaaga attacccaat 4080
ggttattcca aggttacaaa actcattctc tctttgacaa ccctttcatt caacatcatc 4140
tcaattctga tctttgttta actttggatt gatttattct tcagatcact tgggtcgaac 4200
atgtagaggt cgacgaaacc ggcgtcccca caatgtaccg gactcttgtt aattccggcc 4260
tcgctttcgg ggctaagcga tgggttgcta ccttagatcg ccaatctgag cgtttcgcta 4320
cttcaatcgc caccaccatt cccaccggcg atttacgcgg tactacttta ctttcttcat 4380
tcttctgttt cccccggttt ttcccccatg attcccacta atttgatata atttaaatcc 4440
agtgatctca agtattgaag ggaggaagag tatgctgaag ctagcagaga gaatggtgac 4500
gagcttctgc gccggtgttg gtgcgtccag tgtacacgct tggacggcat tacccgctgc 4560
agctggcgat gaagtacgtg ttgtgacgag gaagagcacc gacgaaccag gacgaccacc 4620
gggtgttgtg ttgagcgccg ccacgtcttt ttggattccg gtttcaccta aggttgtttt 4680
tgattttctt cgaaaagaga aatctcggag cgaggtacgt acgtacataa catacatata 4740
aacatcttaa caatcgttaa gtaaacaaag tattgaaata tttgcaatat tttttcagtg 4800
ggatattctg tcaaatggtg gattagttca ggaaatggcg cacatagcca acggccgtca 4860
ctcagggaat tgtgtctcct tgcttcgtgt caatgtcagt aaattattct ttttccaaaa 4920
acatttagta acaattatta gttaacacaa taaattaatg aaaattctaa aatttgatgt 4980
tttttttgta gagtgcgaat tcgagccaga gcaatatgct gatactacaa gaaagctgca 5040
cggactcaac gggatcgtac gttatttatg ctccggtgga caccgtggca atgaacgtcg 5100
tgctaagtgg ttgcgatcct gattacgtgg cgcttctacc gtcgggattc gccatacttc 5160
cagacggacc cggcggagga ggaaacaacg gcggcggaat tctagagctg ggatcgggag 5220
ggtcactcat cacggttgca tttcaaatcc tggttgattc agttccaacg gcaagacttt 5280
caattggatc agtagccacc gttaacagtc tcatcaaatg cacggttgag agaatcagag 5340
ccgctgtgat gcgtgaaagc ccatga 5366
<210> 3
<211> 124
<212> DNA
<213> Cucumis melo
<400> 3
ggttgcggga gatgggaatt aatcagggga agtggttctt aatgaagcgg agtatttgag 60
gagtttcgga gggggaattg tgggaaagcc catggggttt agaaccgaag cttcacgagt 120
ttca 124
<210> 4
<211> 124
<212> DNA
<213> Cucumis melo
<400> 4
ggttgcggga gatgggaatt catcagggga agtggttctt aatgaagcgg agtatttgag 60
gagtttcgga gggggaattg tgggaaagcc catggggttt agaaccgaag cttcacgagt 120
ttca 124

Claims (5)

1. a pair of control muskmelon hairiness/hairless character alleleGL/gl, which is characterized in that the control hairless character of muskmelon Genegl, which is recessive homozygous, the control ciliary development of muskmelon, full length gene 5366bp, tool in no batt material Body base sequence is as shown in SEQ ID NO.1；
With the gene of the hairless character of muskmelonglThe gene of the control muskmelon hairiness character of equipotentialGL, it is dominant pure in having batt material Conjunction or heterozygosis control the ciliary development of muskmelon, and full length gene 5366bp, specific base sequence is as shown in SEQ ID NO.2.
2. the gene of hairless character for identificationglOr the gene of hairiness characterGLMolecular labeling dCAPS1, which is characterized in that Pcr amplification product of the molecular labeling in no batt material is 124bp, and base sequence is as shown in SEQ ID NO.3；There is rough lumber Pcr amplification product in material is 124bp, and base sequence is as shown in SEQ ID NO.4.
3. using molecular labeling dCAPS1 described in claim 2 to hairless character geneglOr hairiness character geneGLDetection side Method, which is characterized in that use PCR product digestion detection method, when PCR amplification, primer sequence design is as follows:
DCAPS1-F:5 '-GGTTGCGGGAGATGGGAATT -3 ',
DCAPS1-R:5 '-TGAAACTCGTGAAGCTTCGGTTC -3 '；
Using the primer pair, the pcr amplification product in hairless parent material is 124bp, base sequence such as SEQ ID NO .3 It is shown；The long 124bp of PCR amplification sequence in hairiness parent, base sequence is as shown in SEQ ID NO .4.
4. as claimed in claim 3 to hairless character geneglOr hairiness geneGLDetection method, which is characterized in that use PCR product digestion detection method carries out EcoRI digestion to the amplified production of the molecular labeling, and obtaining primer size is that 124bp isgl/glGenotype, plant phenotype show as hairless；Obtaining primer size is that 108bp isGL/GLGenotype, plant phenotype table It is now hairiness；Obtaining 124bp and 108bp product simultaneously isGL/glGenotype, plant phenotype show as hairiness.
5. application of the molecular labeling dCAPS1 in muskmelon genotype detection and molecular mark described in claim 2.
CN201611159582.3A 2016-12-15 2016-12-15 A pair of control muskmelon hairiness/hairless character allele GL/gl Expired - Fee Related CN106754901B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611159582.3A CN106754901B (en) 2016-12-15 2016-12-15 A pair of control muskmelon hairiness/hairless character allele GL/gl

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611159582.3A CN106754901B (en) 2016-12-15 2016-12-15 A pair of control muskmelon hairiness/hairless character allele GL/gl

Publications (2)

Publication Number Publication Date
CN106754901A CN106754901A (en) 2017-05-31
CN106754901B true CN106754901B (en) 2019-05-24

Family

ID=58889155

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611159582.3A Expired - Fee Related CN106754901B (en) 2016-12-15 2016-12-15 A pair of control muskmelon hairiness/hairless character allele GL/gl

Country Status (1)

Country Link
CN (1) CN106754901B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107868847B (en) * 2017-12-28 2020-12-04 河南农业大学 Molecular marker closely linked with melon yellow-green leaf color gene ygl

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101250523A (en) * 2008-04-03 2008-08-27 上海交通大学 Molecule marker tightly linked with cucumber pubescence gene G1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101250523A (en) * 2008-04-03 2008-08-27 上海交通大学 Molecule marker tightly linked with cucumber pubescence gene G1

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Huayu Zhu 等.GLABROUS (CmGL) encodes a HD‑ZIP IV transcription factor playing roles in multicellular trichome initiation in melon.《Theoretical and Applied Genetics》.2017,(第131期),第569-579页.

Also Published As

Publication number Publication date
CN106754901A (en) 2017-05-31

Similar Documents

Publication Publication Date Title
Tar’an et al. Genetic mapping of ascochyta blight resistance in chickpea (Cicer arietinum L.) using a simple sequence repeat linkage map
US10301687B2 (en) Sidt 1 gene controlling determinate growth habit in sesame and SNP molecular marker thereof
CN107164533B (en) SNP (Single nucleotide polymorphism) marker of watermelon peel stripe, detection method and application
Zalewska-Gałosz et al. Hybridization in Batrachium group: Controversial delimitation between heterophyllous Ranunculus penicillatus and the hybrid Ranunculus fluitans× R. peltatus
CN107868847B (en) Molecular marker closely linked with melon yellow-green leaf color gene ygl
CN109652412B (en) SNP molecular marker, method for detecting melon flower type and application
CN110157831B (en) Molecular marker coseparated with watermelon short vine gene Cldw1
Andolfo et al. Genome-wide identification and analysis of candidate genes for disease resistance in tomato
CN110938706B (en) Molecular marker closely linked with watermelon plant non-tendril gene Clnt and application thereof
CN107475210A (en) A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application
CN116656867B (en) SNP locus for detecting watermelon holofilment and application thereof
CN108754006B (en) Molecular marker closely linked with muskmelon vine stem length character gene SI/SI
WO2015143867A1 (en) Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof
CN110698550B (en) Molecular detection method for rapidly identifying real plum/apricot plum strain
CN113186200B (en) A pair of genes ClTFL/Cltfl1 for controlling existence and lateral branch of watermelon tendril and application thereof
CN106754901B (en) A pair of control muskmelon hairiness/hairless character allele GL/gl
CN116200528B (en) SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof
CN104928299B (en) Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application
CN111334597A (en) SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof
CN109706154A (en) CsPR3 gene and its application in cucumber anti-blight
NL2026261B1 (en) Molecular Marker Closely Linked to Chinese Cabbage Turnip Mosaic Virus Resistance Gene retrcs03 and Application Thereof
CN114875168A (en) InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof
Van et al. Molecular evidence for soybean domestication
Konzen et al. Molecular markers in bamboos: understanding reproductive biology, genetic structure, interspecies diversity, and clonal fidelity for conservation and breeding
CN105543218A (en) Dominance molecular marker for controlling coseparation of cucumber genes Tril with or without fruit thorns

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190524

CF01 Termination of patent right due to non-payment of annual fee