CN106754837B - Proline protease mutant and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and particularly relates to a proline protease mutant and application thereof. The proline protease mutant obtained by screening through the directed evolution technology has the optimal reaction pH value of 4.0 and the optimal reaction temperature of 55 ℃, can keep more than 80% of enzyme activity within the range of 45-60 ℃, and has heat resistance obviously higher than that of a wild type. The mutant can be widely applied to beer production, and can obviously reduce the turbidity of beer.

Description

Proline protease mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to application of prolinase mutants.

Technical Field

Prolinases, also known as prolyl endopeptidases (PEP for short) or prolyl oligopeptidases, belong to a new family of serine proteases which specifically hydrolyse the carboxy-terminal peptide bond of proline residues in polypeptides, contain the highly conserved sequence of G-X-S-X-G/a of the classical serine protease family, but the amino acid residues around the active site Ser are different from other classical serine proteins and have a very low homology in the primary structure compared to the known serine protease families (including trypsin, subtilisin, carboxypeptidase Y).

Prolinases are capable of degrading not only oxytocin but also many oxytocin analogues, and the degradation of antidiuretic hormones is also due to cleavage of the carboxy terminal peptide bond of proline. In addition, many peptide hormones are also inactivated by cleavage of the carboxy-terminal peptide bond of the proline residue in the same manner. In contrast, gastrin, corticotropin and guinea pig collagen in humans are not degraded by these enzymes, nor are prolinases capable of degrading many of the higher molecular weight proteins and polypeptides, such as serum proteins, IgG, elastin, gelatin, casein, adrenocorticotropic hormone releasing hormone, ubiquitin and protease inhibitors. According to analysis of various peptide hormones and artificially synthesized polypeptides degraded by proline protease, the proline protease from different sources can specifically degrade cis-structure Pro-Y ' bonds in Y-Pro-Y ' in a peptide chain, and Y ' can be amino acids, polypeptides, amides, aromatic amines or alcohol compounds except proline.

In the food and fermentation industries, prolyl proteases are valuable enzymes, such as enzymes that increase the non-biological stability of beer by hydrolyzing proline-rich protein polypeptides in beer, preventing them from forming large polymer-turbid precipitates with polyphenols. It has been reported that prolinases demonstrate a debittering effect in protein hydrolysates. In addition, in view of the specificity of prolinases, the prolinases are also possible as a tool enzyme in molecular biology, and are used for protein sequencing, site-specific cleavage, modification and processing of peptide fragments, and the like.

Prolinases, a very important industrial enzyme, are currently used mainly in the food processing industry and in the brewery industry, and are particularly prominent in the beer production and bread making industry. The prolease can degrade proline of turbid sensitive protein in beer to inactivate the proline, and remarkably improves the non-biological stability of the beer on the premise of not influencing the fermentation performance.

In industrial production, the great significance of seeking the enzyme with the maximum expression quantity of the microorganism and improving the specific property of the enzyme is achieved, so that the production cost can be obviously reduced, and the energy consumption and the environmental pollution can be reduced. In general, in addition to the improvement of microbial expression levels by conventional strain mutagenesis methods, the performance and expression levels can be modified by genetic engineering means such as mutation, use of strong promoters, multiple copies of genes, appropriate signal peptides, and the like. Therefore, it is a research hotspot in the field to obtain prolease with excellent performance by screening or modifying methods.

Disclosure of Invention

The invention provides a novel prolease mutant and application thereof for solving the problems of the prior art. The mutant is obtained by screening through directed evolution technology, the heat resistance of the mutant is obviously higher than that of a wild type, and the wide application of prolinase is facilitated.

The invention provides proline protease with an amino acid sequence of SEQ ID NO. 1.

The nucleotide sequence of the prolease coding gene is SEQ ID NO. 2.

In another aspect, the present invention provides a proline protease mutant, which is prolinase having an amino acid sequence of SEQ ID NO. 1, wherein the 101 th amino acid is changed from Gly to Glu, the 146 th amino acid is changed from Val to Ile, and the 441 th amino acid is changed from Arg to Trp.

The amino acid sequence of the prolease mutant is SEQ ID NO. 3, and the nucleic acid sequence of the coding gene is SEQ ID NO: 4.

in another aspect of the present invention, a recombinant plasmid is provided, which carries a nucleic acid sequence having the coding sequence of SEQ ID NO: 4 in the presence of a protease inhibitor.

The present invention also provides a recombinant strain obtained by transforming the above recombinant plasmid into Aspergillus niger.

The invention also provides the application of the prolin mutant in the production of beer or beverage.

The proline protease mutant obtained by screening through the directed evolution technology has the optimal reaction pH value of 4.0 and the optimal reaction temperature of 55 ℃, can keep more than 80% of enzyme activity within the range of 45-60 ℃, and has heat resistance obviously higher than that of a wild type. The mutant can be widely applied to beer production, and can obviously reduce the turbidity of beer. The mutant can be added in the wort preparation process, and the reduction of the wort turbidity is improved by 29.4-48.3% compared with the experiment group 1 in which the wild-type prolease with the same dosage is added; the mutant may also be added during beer fermentation, where the turbidity reduction of the beer is increased by 8.9-15.4% compared to test group 1, where the same amount of wild-type prolinase was added. Therefore, the prolease mutant provided by the invention can better tolerate high temperature in the wort saccharification process, and the enzymolysis effect on sensitive protein in the fermentation process is obviously better than that of wild prolease, so that the prolease mutant is more favorable for reducing turbidity caused by the sensitive protein, and obtains unexpected effect.

Drawings

FIG. 1 is a map of plasmid pSU;

FIG. 2 is a comparison of the optimal reaction temperatures of the prolease F1 and its mutant F2;

FIG. 3 shows pH optimum reaction comparisons of prolease F1 and its mutant F2.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as those described IN MOLECULAR CLONING, ALABORATORY MANUAL,3nd Ed. (Sambrook,2001) and CURRENTPROTORCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

The present invention will be described in detail with reference to specific embodiments.

Example 1 preparation of prolinase Gene

The genome of a strain of Aspergillus niger Su2-1 stored in this laboratory was extracted. PCR amplification was performed using the following primer F and primer R. The reaction conditions are as follows: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 120s, and after 30 cycles, heat preservation at 72 ℃ for 10 min. And (3) carrying out agarose electrophoresis on the amplification product, wherein the result shows that the size of the gene fragment obtained by amplification is 2100 bp.

And (3) primer F: ATGCGTTCCTTCTCCGCTGTCG

And (3) primer R: TCAAGCATAATACTCCTCCACC

The obtained gene fragment is sent to Shanghai biological engineering Co., Ltd to complete sequencing. The sequencing result shows that the nucleotide sequence of the gene fragment is SEQ ID NO:2, the encoded amino acid sequence is SEQ ID NO: 1. the protein coded by the gene is found to be proline protease by NCBIBLAST comparison and is named F1.

Example 2 obtaining of prolinase mutants

In order to improve the thermostability of the prolease F1, the present applicant screened the enzyme for a large number of mutations by directed evolution.

Using F1 gene as a template, using a primer F and a primer R to perform PCR amplification by using a GeneMorph II random mutation PCR kit (Stratagene), recovering PCR products by using gelatin, performing enzyme digestion treatment on EcoRI and NotI, connecting the PCR products with pET21a vectors subjected to the same enzyme digestion, transforming the PCR products into escherichia coli BL21(DE3), coating the escherichia coli BL21 into an LB + Amp plate, performing inversion culture at 37 ℃, selecting transformants one by using toothpicks to a 96-well plate, adding 150ul LB + Amp culture medium containing 0.1mM IPTG into each well, performing culture at 220rpm at 37 ℃ for about 6h, centrifuging, discarding supernatant, using buffer solution with pH5.5 for thalli, repeatedly performing freeze thawing and wall breaking, and obtaining the escherichia coli cell lysate containing prolease F1.

And respectively taking out 30 mu l of lysate to two new 96-well plates, treating one of the lysates at 50 ℃ for 10min, diluting the lysate to a buffer solution with pH5.5, and diluting the lysate to a buffer solution with pH5.5 without treatment to respectively measure the enzyme activity of the lysate.

As a result, it was found that different mutants maintained different enzyme activities after high temperature treatment, some of the mutations had no effect on prolinases activity, and some of the mutations even reduced their activity, and DNA sequencing was performed on mutants still maintaining high activities. Finally, the applicant obtained three point mutants capable of significantly improving the thermotolerance of the prolease F1: G101E, V146I and R441W.

The proline protease mutant containing three point mutations of G101E, V146I and R441W is named as F2, and the amino acid sequence of the proline protease mutant is SEQ ID NO:3, obtaining a coding nucleotide sequence of SEQ ID NO: 4.

the prolease mutant gene was PCR-amplified with primers F, R, EcoRI and Not I sites were introduced at both ends of the primers. The PCR reaction conditions are as follows: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 120s, and after 30 cycles, heat preservation at 72 ℃ for 10 min. The agarose gel electrophoresis result showed that the size of the proline protease mutant F2 was about 2100 bp.

EXAMPLE 3 construction of recombinant expression vectors

Prolidase F1 and mutant F2 genes thereof are connected to an expression vector pSU (shown in figure 1) through XbaI respectively to construct expression vectors pSU-F1 and pSU-F2.

Preparing protoplasts: inoculating host bacterium Aspergillus niger Su2-1 to PDA + U plate, and culturing at 30 deg.C for 5-7 d. The mycelia with the size of 2cm multiplied by 2cm are cut and inoculated into 100ml of liquid PDA + U culture medium, and cultured at 30 ℃ for 24h to grow mycelia for transformation. After the grown mycelia were filtered, it was resuspended in 20ml of 1.2M magnesium sulfate solution, and 0.2g of lysozyme was added. Culturing at 30 deg.C and 100rpm for 2-3 h. Filtering the lysed mycelia with 2 layers of mirror paper, and centrifuging at 3000rpm for 10min to obtain protoplast.

And (3) transformation: the protoplast was washed 2 times with 1.2M sorbitol solution and resuspended in an appropriate amount of sorbitol solution to a protoplast concentration of 10⁸. 200ul protoplast was added with 10ul of the prepared plasmid, 50ul of 25% PEG6000 was added, ice-cooled for 20min, then 2ml of 25% PEG6000 was added, and the mixture was left at room temperature for 5min, and then 4ml of sorbitol solution was added and mixed by inversion. After 50ml of the transformation supernatant medium was poured, the mixture was poured into 4 transformation bottom plates, and after the supernatant medium solidified, the plate was cultured in an incubator at 30 ℃ for 5 days in an inverted manner.

And (3) transformant screening: after 5 days of culture, the grown colonies are picked up, spotted on a transformation lower layer plate for re-screening, and cultured for 2 days at 30 ℃. The transformants which grew normally were inoculated into fresh PDA plates, respectively, and cultured at 30 ℃ for 5-7 days. Each transformant is cut into 2cm multiplied by 2cm fungus blocks, inoculated into 50ml liquid shake flask culture medium respectively for fermentation, cultured for 5 days at 32 ℃, added with proper amount of ammonia water every day, and the pH is controlled to be about 4.5. After culturing for 5 days, centrifuging the thallus to obtain supernatant, namely crude enzyme liquid. And (3) carrying out protein electrophoresis detection on the crude enzyme solution to screen out a transformant with obvious protein band expression.

The applicant named Aspergillus niger Su-F1(Aspergillus niger Su-F1) for one of the screened positive transformants recombinantly expressing prolidase mutant F1 and Aspergillus niger Su-F2(Aspergillus niger Su-F2).

And (3) carrying out prolinase activity detection on fermentation supernatants of the Aspergillus niger Su-F1 and the Aspergillus niger Su-F2, and taking the fermentation supernatant of the Aspergillus niger host bacteria as a control. The results show that: the enzyme activity of the fermentation supernatant of the Aspergillus niger host bacteria is only 3.2U/ml, while the enzyme activities of the fermentation supernatants of the Aspergillus niger Su-F1 and the Aspergillus niger Su-F2 are respectively 30.5U/ml and 35.4U/ml. Therefore, the recombinant bacteria Aspergillus niger Su-F1 and Aspergillus niger Su-F2 constructed by the invention can respectively express prolinase F1 and mutant F2 in a recombinant mode.

Enzyme activity measuring method

(1) Definition of the Prolin enzyme Activity Unit

The enzyme amount of 1. mu. molpNA released by decomposing Z-GLY-Pro-pNA per minute at 37 ℃ and pH5.0 was defined as one enzyme activity unit U.

(2) Enzyme activity measuring method

Reagent: disodium hydrogen phosphate (0.2mol/L) -citric acid (0.1mol/L) buffer solution with pH of 5.0

Z-GLY-Pro-pNA solution (5mmol/L)

1ml of Z-GLY-Pro-pNA solution with the concentration of 5mmol/L is uniformly mixed in 10ml of phosphoric acid-citric acid buffer solution, and the mixture is prepared 10min before the sample measurement and can be used for 4 h.

Adding 1.1ml of the substrate mixture into a test tube;

preheating the test tube in a water bath at 37 deg.C for 15 min;

placing a cuvette (0.5cm) on a cuvette frame, adjusting the temperature of the cuvette frame to 37 ℃, and adjusting a spectrophotometer to 410nm to measure absorbance;

0.1ml of diluted enzyme solution is absorbed and added into a test tube containing substrate mixed solution, timing is started when the enzyme solution is added, and the diluted enzyme solution is poured into a cuvette after vortex mixing;

after the cuvette was placed on the cuvette holder, the data for 30s were read;

when the enzyme solution reacts, if the light absorption value has a trend of descending and ascending, recording the light absorption value and time of descending to the valley bottom, and continuously recording data after 10 min;

if the light absorption value does not decrease, the light absorption values at 410nm before and after the reaction can be directly recorded, and the reaction time is 10 min.

Prolidase activity was calculated by Δ a 410:

U＝(ΔA410×V×1000×1000×N)/(T×γ×ν×β)

wherein: Δ A410: the change of the light absorption value;

t: reaction time (10 min);

v: reaction system volume (1.2 ml);

1000X 1000: converting the mol into mu mol;

γ: molar extinction coefficient (cm)²/mol)8800；

β optical path length of cuvette (0.5 cm);

v: sample size (0.1 ml);

n: dilution times;

example 4 analysis of enzymatic Properties

1. Determination of optimum reaction temperature

The prolinase activities of the crude enzyme solutions fermented by the recombinant strains Aspergillus niger Su-F1 and Aspergillus niger Su-F2 obtained in example 3 were measured at 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃ and pH5.0, respectively, the highest enzyme activity was taken as 100%, the relative enzyme activity was calculated, and a temperature-relative enzyme activity curve was constructed. As shown in figure 2, the optimum reaction temperature of the prolease F1 is 45 ℃, the optimum reaction temperature of the prolease mutant F2 is 55 ℃, the enzyme activity of more than 80 percent can be maintained within the range of 45-60 ℃, and the temperature resistance is obviously improved.

2. pH determination of optimum reaction

The recombinant strains Aspergillus niger Su-F1 and Aspergillus niger Su-F2 fermentation crude enzyme liquid obtained in example 3 are diluted and determined by adopting buffer solutions with pH values of 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5 and 7.0 respectively, prolin activity determination is carried out at 37 ℃, enzyme activity is calculated, relative enzyme activity is calculated by taking the highest enzyme activity as 100%, and a pH-relative enzyme activity curve is made. As shown in FIG. 3, the optimum reaction pH of prolease F1 was 4.0, while the optimum reaction pH of prolease mutant F2 was also 4.0, and was not significantly changed.

Example 5 use of Prolinase in beer production

The application one is as follows: adding prolease protease in wort preparation process

1. Preparing 10 identical saccharifying cups, which are respectively named as No. 1-No. 10; adding 250ml of water with the temperature of 55 ℃ and 70g of crushed malt flour into each saccharification cup, and uniformly mixing and dissolving;

2. no. 1 saccharifying cup is used as a blank group, and no other substances are added;

no. 2-4 saccharification cups as experimental group 1, the wild-type prolinases provided by the present invention were added at a ratio of 10u/l, 20u/l, and 30u/l, respectively;

no. 5-7 saccharifying cups are an experimental group 2, and the proline protease mutant provided by the invention is added according to the proportion of 10u/l, 20u/l and 30u/l respectively;

no. 8-10 sugar cups were set as experiment group 3, and no other substances were added for the time being.

3. And (3) saccharification process: preserving heat of No. 1-10 saccharifying cup at 55 deg.C for 30 min, heating to 65 deg.C at a heating rate of 1 deg.C/min, preserving heat for 55 min, heating to 72 deg.C at a heating rate of 1 deg.C/min, preserving heat for 10min, preserving heat at 77 deg.C for 2 min, and rapidly cooling to room temperature. Water was added to each mash cup to 450g, and the resulting mixture was filtered to obtain wort.

4. The initial turbidity of wort nos. 1-7 was measured, and the results are shown in table 1.

5. PPVP (crosslinked polyvinylpyrrolidone, a compound commonly used in breweries at present for reducing the turbidity of beer) was added to wort 8-10 at a ratio of 0.3g/l, 0.6g/l, and 0.9g/l, respectively, and after 30 minutes, the wort was filtered and the initial turbidity was measured, and the specific results are shown in Table 1.

6. Wort turbidity test:

(1) the principle is as follows:

beer tends to develop haze during cryopreservation, mainly because sensitive proteins (proline-rich proteins) in beer tend to bind to polyphenols and cause flocculation. According to the principle of a tannometer, tannin (belonging to polyphenols) is added to accelerate the turbidity of beer, and then the change trend of the turbidity is measured by a turbidimeter, so that the reduction amount of proline protease or PVPP to the turbidity of the beer is determined.

(2) The method comprises the following specific steps:

adding tannin with concentration of 0.1g/l into No. 1-10 wort respectively to make tannin content in wort reach 7.5mg/l, mixing thoroughly for 5min, pouring into glass bottle, measuring turbidity after wort turbidity test with corrected turbidimeter, calculating turbidity reduction amount of wort, and the specific results are shown in Table 1.

Calculating the formula:

the decrease in turbidity (%) > 1- (turbidity after turbidity test in experimental group-initial turbidity in experimental group)/(turbidity after turbidity test in blank group-initial turbidity in blank group) × 100%

TABLE 1 turbidity meter for wheat juice

From the results in table 1, it can be seen that compared with the blank group, the experimental group can significantly reduce the turbidity of the wort after the turbidity test by adding the prolinase provided by the present invention during the wort saccharification process and adding PVPP after the wort saccharification is finished, which indicates that the prolinase and the PVPP can effectively reduce the content of sensitive proteins in the wort, and further reduce the turbidity during the test process. The wort prepared by the experimental groups 1 and 2 added with prolease has a turbidity reduction amount higher than that of the experimental group 3 added with PVPP with a corresponding dosage, so that the effect of the prolease provided by the invention on reducing wort turbidity is obviously better than that of PVPP commonly used in a brewery, turbidity caused by sensitive protein can be effectively reduced, and stability is improved.

Furthermore, the reduction of the wort turbidity of the experimental group 2 added with the prolease mutant is increased by 29.4-48.3% compared with the experimental group 1 added with the wild type prolease with the same dosage, thereby showing that the prolease mutant provided by the invention can better resist high temperature in the wort saccharification process, has obviously better enzymolysis effect on sensitive protein than the wild type prolease, is more beneficial to reducing turbidity caused by the sensitive protein and obtains unexpected effect.

The application II comprises the following steps: proline protease is added in the beer fermentation process

1. The wort is prepared by saccharifying pure malt, filtering, boiling (adding hops), and rotary precipitating.

2. Firstly, respectively adding prolinase and yeast solution provided by the invention into a fermentation tank according to the addition amounts in the table 2, and simultaneously taking the fermentation tank without adding prolinase as a blank control group; then the wort is cooled and oxygenated by a heat exchange pump and then is filled into a fermentation tank; fermenting for 5 days at 9-10 ℃, then heating to 12 ℃, reducing the sugar degree to 3.8-4.20 Bix, sealing the tank, fermenting for 5 days, then cooling to 0 ℃, and finishing the fermentation to obtain the beer solution. After the beer was filtered, the turbidity was measured and the amount of turbidity reduction was calculated, and the results are shown in Table 2.

3. PPVP was added to the beer prepared in the blank control group at a ratio of 0.3g/l, 0.6g/l, and 0.9g/l, respectively, and after 30 minutes, the beer was filtered, and the turbidity was measured to calculate the amount of decrease in turbidity, and the concrete results are shown in Table 2.

Calculating the formula:

turbidity reduction (%) - (blank beer turbidity-experimental beer turbidity)/blank beer turbidity 100%

TABLE 2 beer turbidity Meter

From the data in table 2, it can be seen that compared with the blank control group, the experimental group can significantly reduce the turbidity of beer by adding the prolinase provided by the present invention during the fermentation process and adding PVPP after the fermentation is finished, thereby demonstrating that the prolinase and PVPP can effectively reduce the content of sensitive proteins in beer, and further reduce the generation of turbidity. The decrease of the turbidity of the beer prepared by the experimental groups 1 and 2 added with prolease is obviously higher than that of the experimental group 3 added with corresponding dose of PVPP, so that the effect of the prolease provided by the invention on reducing the beer turbidity is obviously better than that of the PVPP commonly used in breweries at present, the turbidity caused by sensitive protein can be effectively reduced, and the stability of the beer is improved.

Furthermore, the reduction of the turbidity of the beer added in the experimental group 2 of the prolease mutant is improved by 8.9-15.4% compared with that of the experimental group 1 of the wild-type prolease added with the same amount, so that the enzymatic hydrolysis effect of the prolease mutant provided by the invention on sensitive protein in the fermentation process is obviously better than that of the wild-type prolease, the turbidity caused by the sensitive protein is reduced, and an unexpected effect is obtained.

SEQUENCE LISTING

<110> Islands blue biological group Co Ltd

Weifang kang Di En Biotech Co Ltd

<120> prolin mutant and application thereof

<130>

<160>4

<170>PatentIn version 3.5

<210>1

<211>526

<212>PRT

<213>1

<400>1

Met Arg Ser Phe Ser Ala Val Ala Ala Ala Ala Leu Ala Leu Ser Trp

1 5 10 15

Ala Ser Leu Ala Gln Ala Ala Arg Pro Arg Leu Val Pro Lys Pro Val

20 25 30

Pro Arg ProAla Ser Ser Lys Ser Ala Ala Thr Thr Gly Glu Ala Asn

35 40 45

Phe Glu Gln Leu Leu Asp His His Asn Pro Asp Lys Gly Thr Phe Ser

50 55 60

Gln Arg Tyr Trp Trp Ser Thr Glu Tyr Trp Gly Gly Pro Gly Ser Pro

65 70 75 80

Val Val Leu Phe Thr Pro Gly Glu Val Ser Ala Asp Gly Tyr Glu Gly

85 90 95

Tyr Leu Thr Asn Gly Thr Leu Thr Gly Val Tyr Ala Gln Glu Ile Gln

100 105 110

Gly Ala Val Ile Ile Ile Glu His Arg Tyr Trp Gly Asp Ser Ser Pro

115 120 125

Tyr Glu Val Leu Asn Ala Glu Thr Leu Gln Tyr Leu Thr Leu Asp Gln

130 135 140

Ala Val Leu Asp Leu Thr Tyr Phe Ala Glu Thr Val Lys Leu Gln Phe

145 150 155 160

Asp Asn Ser Thr Arg Ser Asn Ala Gln Asn Ala Pro Trp Val Met Val

165 170 175

Gly Gly Ser Tyr Ser Gly Ala Leu Thr Ala Trp Thr Glu Ser Val Ala

180 185 190

Pro Gly Thr Phe Trp AlaTyr His Ala Thr Ser Ala Pro Val Glu Ala

195 200 205

Ile Tyr Asp Phe Trp Gln Tyr Phe Tyr Pro Ile Gln Gln Gly Met Ala

210 215 220

Gln Asn Cys Ser Lys Asp Val Ser Leu Val Ala Glu Tyr Val Asp Lys

225 230 235 240

Val Gly Lys Asn Gly Thr Ala Lys Glu Gln Gln Ala Leu Lys Glu Leu

245 250 255

Phe Gly Leu Gly Ala Val Glu His Phe Asp Asp Phe Ala Ala Val Leu

260 265 270

Pro Asn Gly Pro Tyr Leu Trp Gln Asp Asn Asp Phe Ala Thr Gly Tyr

275 280 285

Ser Ser Phe Phe Gln Phe Cys Asp Ala Val Glu Gly Val Glu Ala Gly

290 295 300

Ala Ala Val Thr Pro Gly Pro Glu Gly Val Gly Leu Glu Lys Ala Leu

305 310 315 320

Ala Asn Tyr Ala Asn Trp Phe Asn Ser Thr Ile Leu Pro Asp Tyr Cys

325 330 335

Ala Gly Tyr Gly Tyr Trp Thr Asp Glu Trp Ser Val Ala Cys Phe Asp

340 345 350

Ser Tyr Asn Ala Ser Ser Pro IleTyr Thr Asp Thr Ser Val Gly Asn

355 360 365

Pro Val Asp Arg Gln Trp Glu Trp Phe Leu Cys Asn Glu Pro Phe Phe

370 375 380

Tyr Trp Gln Asp Gly Ala Pro Glu Gly Thr Ser Thr Ile Val Pro Arg

385 390 395 400

Leu Val Ser Ala Ser Tyr Trp Gln Arg Gln Cys Ser Leu Tyr Phe Pro

405 410 415

Glu Thr Asn Gly Tyr Thr Tyr Gly Ser Ala Lys Gly Lys Asn Ser Ala

420 425 430

Thr Val Asn Ser Trp Thr Gly Gly Arg Asp Met Thr Arg Asn Thr Thr

435 440 445

Arg Leu Ile Trp Thr Asn Gly Gln Tyr Asp Pro Trp Arg Asp Ser Gly

450 455 460

Val Ser Ser Thr Phe Arg Pro Gly Gly Pro Leu Ala Ser Thr Ala Asn

465 470 475 480

Glu Pro Val Gln Val Ile Pro Gly Gly Phe His Cys Ser Asp Leu Tyr

485 490 495

Met Ala Asp Tyr Tyr Ala Asn Glu Gly Val Lys Lys Val Val Asp Asn

500 505 510

Glu Val Lys Gln Ile Lys Glu Trp Val GluGlu Tyr Tyr Ala

515 520 525

<210>2

<211>1581

<212>DNA

<213>2

<400>2

atgcgttcct tctccgctgt cgctgccgca gccctggcgc tctcttgggc gtctctggct 60

caggctgctc gccctcgtct tgtgcccaag cctgtccctc ggccagcttc gagtaaatcg 120

gctgcgacca caggcgaggc taactttgag cagttgctgg accatcataa tccagacaag 180

ggaacgtttt cccagcggta ctggtggagt actgaatact ggggtggtcc tgggtcaccg 240

gttgtcctct ttactcctgg agaggtctct gccgatggct atgaggggta tctcaccaat 300

gggactctca ctggtgttta tgcgcaggag atccagggtg ccgtcattat cattgagcac 360

cgctactggg gtgattcttc gccttatgag gtactcaatg ccgaaactct tcagtatctt 420

acattggacc aagccgttct ggacctgacc tacttcgccg agacggtgaa actgcaattc 480

gataacagca cccgcagcaa tgcgcagaat gctccctggg tcatggtcgg tggatcatac 540

agcggtgcct tgacggcttg gaccgagtct gtcgcgcctg gaacgttctg ggcttaccat 600

gccactagtg ctcctgtgga ggctatctat gacttttggc aatacttcta ccccatccag 660

caaggtatgg cacagaactg cagcaaggac gtgtctctgg tagccgagta tgtcgacaag 720

gttggaaaga acggaactgc caaggagcag caggcactca aggaattgtt tggcttggga 780

gctgttgagc atttcgatga ctttgccgct gtcctcccca acggaccgta cctctggcag 840

gacaacgact ttgccacagg atactcttcc ttcttccagttctgtgacgc cgtcgagggt 900

gtcgaagccg gcgcggcagt aacccccggc cccgagggtg tcggcctcga aaaggccctg 960

gccaactacg caaactggtt caattcaacc attctccctg attactgcgc aggctacggc 1020

tactggaccg acgaatggag cgtcgcctgc ttcgacagct acaacgcctc gagccctatc 1080

tacaccgata catccgtcgg caatcccgtc gaccgccaat gggaatggtt cctttgcaac 1140

gagcctttct tctactggca agacggtgct cccgagggta cctccaccat tgtgccccgg 1200

ctcgtcagcg cctcctactg gcaacgccaa tgctcgctct acttccccga aacgaacggc 1260

tacacgtacg gtagcgcgaa gggtaagaac tctgccacgg tgaacagctg gaccggtggg 1320

cgggacatga cccgcaacac gacgcggttg atctggacga atgggcaata cgacccctgg 1380

cgcgactccg gtgtgtcgag cactttccgg cctggtggac cgctggcgag cacggcgaat 1440

gaacccgtgc aggttattcc gggcggattc cattgctccg atttgtatat ggcagattat 1500

tatgcgaacg agggggtaaa aaaggtggta gataatgagg tgaagcagat taaggagtgg 1560

gtggaggagt attatgcttg a 1581

<210>3

<211>526

<212>PRT

<213>3

<400>3

Met Arg Ser Phe Ser Ala Val Ala Ala Ala Ala Leu Ala Leu Ser Trp

1 5 10 15

Ala Ser Leu Ala Gln Ala Ala Arg Pro Arg Leu Val Pro Lys Pro Val

20 25 30

Pro Arg Pro Ala Ser Ser Lys Ser Ala Ala Thr Thr Gly Glu Ala Asn

35 40 45

Phe Glu Gln Leu Leu Asp His His Asn Pro Asp Lys Gly Thr Phe Ser

50 55 60

Gln Arg Tyr Trp Trp Ser Thr Glu Tyr Trp Gly Gly Pro Gly Ser Pro

65 70 75 80

Val Val Leu Phe Thr Pro Gly Glu Val Ser Ala Asp Gly Tyr Glu Gly

85 90 95

Tyr Leu Thr Asn Glu Thr Leu Thr Gly Val Tyr Ala Gln Glu Ile Gln

100 105 110

Gly Ala Val Ile Ile Ile Glu His Arg Tyr Trp Gly Asp Ser Ser Pro

115 120 125

Tyr Glu Val Leu Asn Ala Glu Thr Leu Gln Tyr Leu Thr Leu Asp Gln

130 135 140

Ala Ile Leu Asp Leu Thr Tyr Phe Ala Glu Thr Val Lys Leu Gln Phe

145 150 155 160

Asp Asn Ser Thr Arg Ser Asn Ala Gln Asn Ala Pro Trp Val Met Val

165 170 175

Gly Gly Ser Tyr Ser Gly Ala Leu Thr Ala Trp Thr Glu Ser Val Ala

180 185 190

Pro Gly Thr Phe Trp Ala Tyr His Ala Thr Ser Ala Pro Val Glu Ala

195 200 205

Ile Tyr Asp Phe Trp Gln Tyr Phe Tyr Pro Ile Gln Gln Gly Met Ala

210 215 220

Gln Asn Cys Ser Lys Asp Val Ser Leu Val Ala Glu Tyr Val Asp Lys

225 230 235 240

Val Gly Lys Asn Gly Thr Ala Lys Glu Gln Gln Ala Leu Lys Glu Leu

245 250 255

Phe Gly Leu Gly Ala Val Glu His Phe Asp Asp Phe Ala Ala Val Leu

260 265 270

Pro Asn Gly Pro Tyr Leu Trp Gln Asp Asn Asp Phe Ala Thr Gly Tyr

275 280 285

Ser Ser Phe Phe Gln Phe Cys Asp Ala Val Glu Gly Val Glu Ala Gly

290 295 300

Ala Ala Val Thr Pro Gly Pro Glu Gly Val Gly Leu Glu Lys Ala Leu

305 310 315 320

Ala Asn Tyr Ala Asn Trp Phe Asn Ser Thr Ile Leu Pro Asp Tyr Cys

325 330 335

Ala Gly Tyr Gly Tyr Trp Thr Asp Glu Trp Ser Val Ala Cys Phe Asp

340 345 350

Ser Tyr Asn Ala Ser Ser Pro Ile Tyr Thr Asp Thr Ser Val Gly Asn

355 360 365

Pro Val Asp Arg Gln Trp Glu Trp Phe Leu Cys Asn Glu Pro Phe Phe

370 375 380

Tyr Trp Gln Asp Gly Ala Pro Glu Gly Thr Ser Thr Ile Val Pro Arg

385 390 395 400

Leu Val Ser Ala Ser Tyr Trp Gln Arg Gln Cys Ser Leu Tyr Phe Pro

405 410 415

Glu Thr Asn Gly Tyr Thr Tyr Gly Ser Ala Lys Gly Lys Asn Ser Ala

420 425 430

Thr Val Asn Ser Trp Thr Gly Gly Trp Asp Met Thr Arg Asn Thr Thr

435 440 445

Arg Leu Ile Trp Thr Asn Gly Gln Tyr Asp Pro Trp Arg Asp Ser Gly

450 455 460

Val Ser Ser Thr Phe Arg Pro Gly Gly Pro Leu Ala Ser Thr Ala Asn

465 470 475 480

Glu Pro Val Gln Val Ile Pro Gly Gly Phe His Cys Ser Asp Leu Tyr

485 490 495

Met Ala Asp Tyr Tyr Ala Asn Glu Gly Val Lys Lys Val Val Asp Asn

500 505 510

Glu Val Lys Gln Ile Lys Glu Trp Val Glu Glu Tyr Tyr Ala

515 520 525

<210>4

<211>1581

<212>DNA

<213>4

<400>4

atgcgttcct tctccgctgt cgctgccgca gccctggcgc tctcttgggc gtctctggct 60

caggctgctc gccctcgtct tgtgcccaag cctgtccctc ggccagcttc gagtaaatcg 120

gctgcgacca caggcgaggc taactttgag cagttgctgg accatcataa tccagacaag 180

ggaacgtttt cccagcggta ctggtggagt actgaatact ggggtggtcc tgggtcaccg 240

gttgtcctct ttactcctgg agaggtctct gccgatggct atgaggggta tctcaccaat 300

gagactctca ctggtgttta tgcgcaggag atccagggtg ccgtcattat cattgagcac 360

cgctactggg gtgattcttc gccttatgag gtactcaatg ccgaaactct tcagtatctt 420

acattggacc aagccattct ggacctgacc tacttcgccg agacggtgaa actgcaattc 480

gataacagca cccgcagcaa tgcgcagaat gctccctggg tcatggtcgg tggatcatac 540

agcggtgcct tgacggcttg gaccgagtct gtcgcgcctg gaacgttctg ggcttaccat 600

gccactagtg ctcctgtgga ggctatctat gacttttggc aatacttcta ccccatccag 660

caaggtatgg cacagaactg cagcaaggac gtgtctctgg tagccgagta tgtcgacaag 720

gttggaaaga acggaactgc caaggagcag caggcactca aggaattgtt tggcttggga 780

gctgttgagc atttcgatga ctttgccgct gtcctcccca acggaccgta cctctggcag 840

gacaacgact ttgccacagg atactcttcc ttcttccagt tctgtgacgc cgtcgagggt 900

gtcgaagccg gcgcggcagt aacccccggc cccgagggtg tcggcctcga aaaggccctg 960

gccaactacg caaactggtt caattcaacc attctccctg attactgcgc aggctacggc 1020

tactggaccg acgaatggag cgtcgcctgc ttcgacagct acaacgcctc gagccctatc 1080

tacaccgata catccgtcgg caatcccgtc gaccgccaat gggaatggtt cctttgcaac 1140

gagcctttct tctactggca agacggtgct cccgagggta cctccaccat tgtgccccgg 1200

ctcgtcagcg cctcctactg gcaacgccaa tgctcgctct acttccccga aacgaacggc 1260

tacacgtacg gtagcgcgaa gggtaagaac tctgccacgg tgaacagctg gaccggtggg 1320

tgggacatga cccgcaacac gacgcggttg atctggacga atgggcaata cgacccctgg 1380

cgcgactccg gtgtgtcgag cactttccgg cctggtggac cgctggcgag cacggcgaat 1440

gaacccgtgc aggttattcc gggcggattc cattgctccg atttgtatat ggcagattat 1500

tatgcgaacg agggggtaaa aaaggtggta gataatgagg tgaagcagat taaggagtgg 1560

gtggaggagt attatgcttg a 1581

Claims (6)

1. A proline protease mutant characterized in that the 101 th amino acid of prolinase having the amino acid sequence of SEQ ID NO. 1 is changed from Gly to Glu, the 146 th amino acid is changed from Val to Ile, and the 441 th amino acid is changed from Arg to Trp.

2. The mutant of claim 1, wherein the amino acid sequence of said mutant is SEQ ID No. 3.

3. The mutant encoding gene of claim 1, wherein one nucleotide sequence of the encoding gene is SEQ ID NO: 4.

4. a recombinant plasmid carrying the coding gene of claim 3.

5. A recombinant strain carrying the recombinant plasmid of claim 4.

6. Use of the prolease mutant according to claim 1 or 2 for reducing haze in beer or beverage.

Images