A kind of saltant type Tn5 transposase and its preparation method and application
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of saltant type Tn5 transposase and its preparation method and application.
Background technique
Transposase is the albumen of a major class bacterial origin, is moved to gene by combining transposon sequence end and being catalyzed it
Random site realizes the effect of the DNA insertion of " shearing-stickup " or " copy-paste " type in group.There are many type of transposase, most
First it is found that the Tn3 transposons that corn can be made to change color at random.Natural transposons in biology activity it is very low, into
The random important function for changing inhereditary material and pushing evolution is played during changing.Transposase can introduce at random in the genome
The critical nature of mutation is also applied to build library process in the two generation sequencing technologies rapidly developed recently, can be in the genome
The random known array connector that is added is used for sequencing analysis.
Tn5 transposase is one kind of transposase, and the realization that Tn5 transposase carries out swivel base function needs three parts to make jointly
With: transposon sequence, transposase, target DNA position.The activity of wild type Tn5 transposase be also it is very low, with reduce to host produce
The risk of raw lethal mutation.
The very low partly cause of Tn5 transposase activity is N-terminal and C-terminal the phase mutual connection on three-dimensional conformation of its albumen
Closely, and the effect mutually inhibited is played.The mutant form transposase of high activity form available for the mutation of N-terminal or C-terminal, such as
L372P, normal 372 leucines are in a α spiral, are destroyed αhelix after being replaced with alanine, to produce
The change for having given birth to C-terminal conformation is spatially separated with N-terminal, to obtain the mutain that activity greatly increases.Simultaneously
Tn5 albumen contains a center catalyst structure domain DDE, i.e. tri- residues of the D/D/E of different location form one on three-dimensional conformation
The acidic-group at a center, constituting can be that albumen is promoted to exist in conjunction with bivalent ions annular location, the known function of the structural domain
Traveling on DNA is mutated the mutation that available catalytic increases, traveling is promoted to the exchange respectively of these three acidic residues
Albumen.
Mainstream technology is to carry out rite-directed mutagenesis to transposase expressed sequence at present, is generated by prokaryotic expression active prominent
A kink of preserved egg is white, carries out Validation in vitro to its function.Thus it is as mentioned above to obtain most well-known mutation, N-terminal and C-terminal space away from
From obtaining highly active protein and change the obtained increased mutain of catalytic activity of residue in catalytic group DDE group.
Although saltant type Tn5 transposase swivel base insertion activity and all obtained to the compatibility of DNA that present mainstream uses
Effectively enhancing, but still there is target DNA sequence Preference on the basis of the activity and stability of current enzyme are promoted, Preference is
Transposase is applied to build a short slab in library, and the Preference of adjunction head will lead to the inhomogenous and scarce of result during building library
It loses, causes the coverage of result problematic.
Summary of the invention
The purpose of the invention is to provide a kind of saltant type Tn5 transposases and its preparation method and application, reduce Tn5 and turn
Seat enzyme makes sequencing DNA build library distribution more uniform DNA target sequence insertion point selectivity, and has better coverage, adapts to
High-flux sequence builds the demand in library.
In order to achieve the above objectives, technical scheme is as follows:
A kind of saltant type Tn5 transposase, the amino acid sequence of the saltant type Tn5 transposase are EK/LPTn5 transposase
Obtained by amino acid sequence rite-directed mutagenesis, the rite-directed mutagenesis refers to D97E, at least two in D188E, E326D;Wherein, it is mutated
Site 1:D97E, i.e., the 97th alanine mutation is glutamic acid in EK/LP Tn5 transposase base acid sequence;Mutational site 2:
D188E, i.e., the 188th alanine mutation is glutamic acid in EK/LP Tn5 transposase base acid sequence;Mutational site 3:E326D,
The 326th glutamic acid mutation is alanine i.e. in EK/LP Tn5 transposase base acid sequence.
Preferably, a kind of saltant type Tn5 transposase includes 3 rite-directed mutagenesis: D97E, D188E, E326D, the saltant type
The amino acid sequence of Tn5 transposase is as shown in SEQ NO.2.
The gene of the present invention also provides the encoding amino acid sequences saltant type Tn5 transposase as shown in SEQ NO.2.
It is furthermore preferred that also provide encoding amino acid sequence saltant type Tn5 transposase as shown in SEQ NO.2 such as SEQ
Nucleotide sequence shown in NO.3.It should be noted that since same monoamino-acid may there are many different codons determines,
So the nucleotide sequence for encoding above-mentioned saltant type Tn5 transposase is not limited to sequence shown in SEQ NO.3, be also possible to by
Same sense mutation, which is formed, with one or several nucleotide of nucleotide sequence mutation shown in SEQ NO.3 obtains codified same amino acid
The nucleotide sequence of sequence.
Preferably, a kind of saltant type Tn5 transposase, include 2 rite-directed mutagenesis: D97E, D188E encode saltant type Tn5
The nucleotide sequence of transposase is as shown in SEQ NO.4.
Preferably, a kind of saltant type Tn5 transposase, include 2 rite-directed mutagenesis: D188E, E326D encode the saltant type
The nucleotide sequence of Tn5 transposase is as shown in SEQ NO.5.
Preferably, a kind of saltant type Tn5 transposase, include 2 rite-directed mutagenesis: D97E, E326D encode saltant type Tn5
The nucleotide sequence of transposase is as shown in SEQ NO.6.
The preparation method of saltant type Tn5 transposase of the present invention, includes the following steps:
1) carrier containing the nucleotide sequence for encoding the saltant type Tn5 transposase is constructed
Using the primer containing mutational site information, PCR expansion is carried out to the plasmid containing EK/LP Tn5 transposase gene
Increase;PCR amplification obtains gel extraction after purpose band, utilizes Dpn1 enzymic digestion primary template plasmid;It is transformed into after product purification
In competent cell, coated plate, which chooses monoclonal identification, can be obtained the carrier of the transposase gene of Tn5 containing saltant type;
2) recombinant cell is obtained
The carrier that step 1) is obtained is transformed into B121 host cell, the weight correctly converted using antibiotic-screening
Group cell, and choose monoclonal;
3) it cultivates and collects recombinant cell, extraction purification saltant type Tn5 transposase.
Further, the primer containing mutational site information described in step 1), which contains, needs the site being mutated and replaced
Base, particular sequence is as follows: comprising introducing three mutational site D97E, the primer sequence of D188E, E326D, comprising:
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc;
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc;
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg;
Or, introducing the primer sequence of two mutational sites D97E, D188E, comprising:
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc;
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc;
Or, introducing the primer sequence of two mutational sites D188E, E326D, comprising:
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc;
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg;
Or, introducing the primer sequence of two mutational sites D97E, E326D, comprising:
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg;
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc.
The above-mentioned saltant type Tn5 transposase of the present invention can be applied to DNA and build in library.
Genomic DNA piece is carried out during DNA builds library using the saltant type Tn5 transposase the present invention also provides a kind of
The reaction system of sectionization: 10~25mM HEPES buffer solution, pH 7.2~7.6;0.1~5mM beta- mercaptoethanol;10~80
μ g/ml bovine serum albumin(BSA);0.1~0.2M potassium glutamate;0.2~0.5mM MnSO4;0.2~1mM KCl;100~500nM
The saltant type Tn5 transposase;50~100ng genomic DNA;0.1~1ng contains the adapter-primer of 19bp transposon sequence;
Response procedures: 37 DEG C, 10min~1h.
Further, the adapter-primer containing 19bp transposon sequence includes: transposase recognition sequence:
AGATGTGTATAAGAGACAG, the first joint sequence: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC;
Second joint sequence: CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG.
After tested, compared with EK/LP Tn5 transposase, using the improved saltant type Tn5 transposase of the present invention into
The sequencing library homogeneity of row adjunction head significantly improves.
Beneficial effects of the present invention:
The present invention reduce to the existing EK/LP Tn5 transposase being transformed the directional transformation of DNA Preference, specifically
Change its center catalysis element core residue D97, D188, E326, to improve Tn5 swivel base zymoprotein sequence by rite-directed mutagenesis
Column and conformation, improve Tn5 transposase to the binding affinity of pairs of terminal complex, the DNA binding affinity based on raising
And catalytic capability, to eliminate the base Preference to DNA fragmentation cutting.Center of the present invention to EK/LP Tn5 transposase
Double mutation of catalysis element residue, change to DNA base dependence in conjunction with and improve the base Preference of the effect of interrupting.
Saltant type Tn5 transposase provided by the present invention improves the Preference that Tn5 transposase is inserted into DNA target sequence,
It significantly improves DNA and builds library homogeneity, and make to build library result with better coverage, what is significantly improved builds library homogeneity, can
Suitably to reduce numerical quantities, sequencing and analysis cost are saved.
The traveling of saltant type Tn5 transposase designed by the present invention increases, and is applied to when DNA builds library and devises phase
Corresponding DNA fragmentation reaction system, all adjusts wherein salt ionic concentration and buffer, keeps reaction more controllable, more
It is easy to control the clip size interrupted according to the time.
Detailed description of the invention
Fig. 1 is the GC Preference analysis result figure that existing EK/LP Tn5 transposase constructs library.
Fig. 2 is that the GC Preference that saltant type Tn5 transposase constructs library in the embodiment of the present invention 4 analyzes result figure.
Fig. 3 is the GC Preference analysis result figure that the saltant type Tn5 transposase that the embodiment of the present invention 7 synthesizes constructs library.
Specific embodiment
Technical solution of the present invention is described in further detail below in conjunction with specific embodiment.
The preparation method of 1 amino acid sequence of embodiment Tn5 transposase as shown in SEQ ID NO.2, includes the following steps:
1) carrier containing the nucleotide sequence for encoding the saltant type Tn5 transposase is constructed
Using the method for gene chemical synthesis, synthesis, which contains, needs the primer sequence of the site being mutated and the base replaced such as
Under:
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc;
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc;
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg;
Expanded using EK/LP Tn5 transposase gene (its gene order as shown in SEQ ID NO.1) of the PCR to transformation
Increase, respectively with primer A97-f and B188-r, B188-f and C326-r, C326-f and A97-r are primer, in 50 μ l reaction systems
In, using the plasmid containing EK/LP Tn5 transposase gene as template, 2 μ l are respectively added in 10 μM of primer, with Phanta Max
Super-Fidelity DNA Polymerase (is produced, Vazyme, article No. by Nanjing Vazyme Biotechnology Co., Ltd.
It P505) is archaeal dna polymerase.Amplification condition is 95 DEG C of 30s;95℃ 15s;60℃ 15s;72℃ 30s-3min;72℃
5min;Totally 30 circulations.
After amplification, be directly added into 1 μ l DpnI in 50 μ l reaction systems, 37 DEG C constant-temperature incubation 2 hours, digestion is former
Beginning plasmid template.With 1%-1.5% (W/V) agarose gel electrophoresis, gel extraction after purpose band is obtained.By recovery product benefit
Use MutMultiS Fast Mutagenesis KitV2 (is given birth to by Nanjing Vazyme Biotechnology Co., Ltd.
Produce, Vazyme, article No. C215) carry out recombining reaction, 37 DEG C constant-temperature incubation 0.5 hour.
The cooling reaction solution of 20 μ l is taken, is added in 100 μ l B121 competent cells, is flicked and mixed under tube wall number, on ice
Place 30min.42 DEG C heat shock 90 seconds, ice-water bath be incubated for 2min.500 μ l LB culture mediums are added, 37 DEG C of incubation 10min are sufficiently multiple
Soviet Union.37 DEG C are shaken bacterium 45min.100 μ l bacterium solutions are taken to be uniformly coated on the plate containing ampicillin.Plate is inverted, in 37
It DEG C is incubated overnight.Second day picking monoclonal, sequence verification.Sequencing result shows: the saltant type Tn5 transposase that the present invention synthesizes
Nucleotide sequence as shown in SEQ NO.3, amino acid sequence is as shown in SEQ NO.2.
Carrier conversion host cell is obtained recombinant cell by embodiment 2:
By the errorless carrier of sequence verification, 10ng is taken to be transformed into BL21 competent cell with same method for transformation, is coated with
On the LB plate containing ampicillin, 37 DEG C are incubated overnight.Second day picking monoclonal.
Embodiment 3 cultivates and collects recombinant cell, extraction purification saltant type Tn5 enzyme
Specific step is as follows:
Monoclonal recombinant cell is chosen in 3ml LB liquid medium, shakes training 6-8h, then switching expands culture extremely
In 300ml LB liquid medium, after shaking training 4-6h, continue to shake training overnight after IPTG to final concentration of 50mmol/L is added, induction
Destination protein expression.300ml bacterium solution is dispensed into 50ml centrifuge tube, thallus is collected with 5000rpm centrifugation 10min.Every 100ml
10ml elution buffer (50mmol/L Tris-HCl pH7.9 is added after bacterium solution centrifugation;50mmol/L dextrose;1mmol/L
EDTA it) is resuspended, places 1h on ice;3500rpm centrifugation 3min collects thallus again, and the pre- lysis buffer of 50ml is added, and (elution is slow
Fliud flushing adds 4g/L lysozyme), it is placed at room temperature for 15min;50ml lysis buffer (10mmol/L Tris-HCl pH7.9 is added;
50mmol/L KCl;1mmol/L EDTA;1mmol/L PMSF;0.5%Tween-20 (V/V);0.5%NP-40 (V/V)), it is acute
Strong oscillation mixes, and 75 DEG C of incubations 1h vibrate frequently, then will crack mixed liquor and be transferred to 50ml centrifuge tube, 4 DEG C of 5000rpm from
Heart 15min shifts supernatant into new centrifuge tube, 30g ammonium sulfate is added, and room temperature mixes rapidly.15000rpm centrifugation
Albumen precipitation object is suspended into 20ml elution buffer by 15min again, in store buffer liquid (50mmol/L Tris-HCl
pH7.9;50mmol/L KCl;0.1mmol/L EDTA;0.5mmol/L PMSF;1mmol/L DTT;50%glycerol (V/
V dialyse at least 12h in).After dialysis, is diluted with store buffer liquid 1: 1, be stored in -80 DEG C.
The library homogeneity of building of 4 saltant type Tn5 transposase of embodiment and EK/LP Tn5 transposase compares
It prepares using genomic DNA as the system for handling of template, reaction system is as follows: 25mM HEPES buffer solution, pH 7.4;
1mM beta- mercaptoethanol;50ug/ml bovine serum albumin(BSA);0.1M potassium glutamate;0.5mM MnSO4;0.5mM KCl;
The resulting saltant type Tn5 transposase of 200nM embodiment 3;50ng genomic DNA;The connector that 1ng contains 19bp transposon sequence draws
Object.Response procedures: 37 DEG C of 30min.Adapter-primer containing 19bp transposon sequence includes: transposase recognition sequence:
AGATGTGTATAAGAGACAG, the first joint sequence: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCG
GCAGCGTC;Second joint sequence: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG;Wherein,
XXXXXXXX is Index sequence.
The reaction system that EK/LP Tn5 transposase as a comparison case carries out DNA fragmentation is popular response system are as follows:
100mM potassium glutamate, 25mM HEPES buffer solution (pH 7.4), 50ug/ml bovine serum albumin(BSA), 1mM MgCl2, 1mM
Beta- mercaptoethanol, 200nM Tn5 transposase, 25nM DNA profiling.
The obtained mutation transposase of 2 parts of 100ng starting EK/LP Tn5 transposases and embodiment 1-3 is interrupted processed
DNA profiling is utilized respectively VAHTS Nano DNA Library Prep Kit for(Vazyme, ND601) into
Row end is repaired and is connected with adjunction head, then carries out amplified library with the amplification module in kit, obtains library.Concrete operations
See kit specification.
Library concentration measurement is carried out using fluorescent dye Qubit, the reading of 60M data is carried out using two generation sequenators, it is existing
The GC Preference analysis result difference in the saltant type Tn5 transposase building library for thering is EK/LP Tn5 transposase, embodiment 1 to synthesize
Referring to Fig. 1, Fig. 2, the homogeneity of data in the genome is analyzed.
As shown in Figure 1, there is obvious G/C content fluctuation, table in Data Frontend in the library of EK/LP Tn5 transposase building
Bright EK/LP Tn5 transposase has certain Preference to certain bases in fragmentation site.As shown in Figure 2, the present invention is implemented
The G/C content fluctuation of the library front end data of the provided saltant type Tn5 transposase of example 1 building is little, illustrates mutation of the present invention
Type Tn5 transposase fragments site is substantially without Preference.As the result is shown using the DNA fragmentation reaction system that designs of the present invention and
The experimental group library homogeneity that embodiment 1-3 saltant type Tn5 transposase obtained carries out adjunction head relatively uses EK/LP Tn5 to turn
Seat enzyme significantly improves.
Embodiment 5 includes mutant nucleotide sequence saltant type Tn5 transposase as shown in SEQ NO.4 of D97E, D188E mutation
Preparation and performance test
Mutation transformation is carried out using following two pairs of primer pairs EK/LP Tn5 transposase, specific implementation method is the same as embodiment 1-
3:
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc;
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc.
The nucleotide sequence of gained saltant type Tn5 transposase is as shown in SEQ NO.4, saltant type Tn5 transposase and EK/
LP Tn5 transposase carries out DNA fragmentation processing and carries out library construction simultaneously, specifically with embodiment 4, the test of GC Preference
Statistics indicate that: the G/C content fluctuation of the library front end data of the building of saltant type Tn5 transposase provided by embodiment 5 is little, says
Substantially without Preference, the experimental group library homogeneity for carrying out adjunction head is relatively used in bright saltant type Tn5 transposase fragments site
EK/LPTn5 transposase significantly improves.
Embodiment 6 includes mutant nucleotide sequence saltant type Tn5 transposase as shown in SEQ NO.5 of D188E, E326D mutation
Preparation and performance test
Mutation transformation is carried out using following two pairs of primer pairs EK/LP Tn5 transposase, specific implementation method is the same as embodiment 1-
4。
B188-f:gcggtctgtgaacgcgaagc;
B188-r:gcttcgcgttcacagaccgc;
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg.
The nucleotide sequence of gained saltant type Tn5 transposase is as shown in SEQ NO.5, saltant type Tn5 transposase and EK/
LP Tn5 transposase carries out DNA fragmentation processing and carries out library construction simultaneously, specifically with embodiment 4, the test of GC Preference
Statistics indicate that: the G/C content fluctuation of the library front end data of the building of saltant type Tn5 transposase provided by embodiment 6 is little, says
Substantially without Preference, the experimental group library homogeneity for carrying out adjunction head is relatively used in bright saltant type Tn5 transposase fragments site
EK/LP Tn5 transposase significantly improves.
Embodiment 7 includes mutant nucleotide sequence saltant type Tn5 transposase as shown in SEQ NO.6 of D97E, E326D mutation
Preparation and performance test
Mutation transformation is carried out using following two pairs of primer pairs EK/LP Tn5 transposase, specific implementation method is the same as same embodiment
1-4。
A97-f:gccattgaggaaaccacct;
A97-r:aggtggtttcctcaatggc;
C326-f:cggatcgacgagttccata;
C326-r:tatggaactcgtcgatccg.
The nucleotide sequence of gained saltant type Tn5 transposase is as shown in SEQ NO.6, saltant type Tn5 transposase and EK/
LP Tn5 transposase carries out DNA fragmentation processing and carries out library construction simultaneously, specifically with embodiment 4, GC Preference such as Fig. 3
It is shown.
As Fig. 1, Fig. 3 it is found that the GC of the library front end data of the building of saltant type Tn5 transposase provided by embodiment 7 contains
Amount fluctuation is little, illustrates that saltant type Tn5 transposase fragments site without Preference, carries out the experimental group library of adjunction head substantially
Homogeneity is compared with using significantly improving for EK/LP Tn5 transposase.
Finally it should be noted that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng
It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to invention
Technical solution is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered
In scope of the presently claimed invention.
Sequence table
<110>Nanjing Vazyme Biotechnology Co., Ltd.
<120>a kind of saltant type Tn5 transposase and its preparation method and application
<160> 6
<210>SEQ ID NO. 1
<211>1429
<212>DNA
<213>artificial synthesized
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60
gcgctgggtg atcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagta aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga caccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaag 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaccgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgagga gttccataag gcatggaaaa ccggagcagg agccgagagg
1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg
1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg
1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat
1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt
1260
agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga
1320
accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg
1380
gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429
<210>SEQ ID NO. 2
<211>476
<212>PRT
<213>artificial synthesized
10 20 30 40 50
MITSALHRAA DWAKSVFSSA ALGDPRRTAR LVNVAAQLAK YSGKSITISS
60 70 80 90 100
EGSKAMQEGA YRFIRNPNVS AEAIRKAGAM QTVKLAQDFP ELLAIEETTS
110 120 130 140 150
LSYRHQVAEE LGKLGSIQDK SRGWWVHSVL LLEATTFRTV GLLHQEWWMR
160 170 180 190 200
PDDPADADEK ESGKWLAAAA TSRLRMGSMM SNVIAVCERE ADIHAYLQDK
210 220 230 240 250
LAHNERFVVR SKHPRKDVES GLYLYDHLKN QPELGGYQIS IPQKGVVDKR
260 270 280 290 300
GKRKNRPARK ASLSLRSGRI TLKQGNITLN AVLAEEINPP KGETPLKWLL
310 320 330 340 350
LTSEPVESLA QALRVIDIYT HRWRIDEFHK AWKTGAGAER QRMEEPDNLE
360 370 380 390 400
RMVSILSFVA VRLLQLRESF TPPQALRAQG LLKEAEHVES QSAETVLTPD
410 420 430 440 450
ECQLLGYLDK GKRKRKEKAG SLQWAYMAIA RLGGFMDSKR TGIASWGALW
460 470
EGWEALQSKL DGFLAAKDLM AQGIKI
<210>SEQ ID NO. 3
<211>1429
<212>DNA
<213>artificial synthesized
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60
gcgctgggtg atcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga aaccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaag 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaacgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgacga gttccataag gcatggaaaa ccggagcagg agccgagagg
1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg
1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg
1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat
1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt
1260
agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga
1320
accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg
1380
gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429
<210>SEQ ID NO. 4
<211>1249
<212>DNA
<213>artificial synthesized
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60
gcgctgggtg atcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga aaccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaag 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaacgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgagga gttccataag gcatggaaaa ccggagcagg agccgagagg
1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg
1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg
1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat
1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt
1260
agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga
1320
accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg
1380
gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429
<210>SEQ ID NO. 5
<211>1249
<212>DNA
<213>artificial synthesized
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60
gcgctgggtg atcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga caccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaag 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaacgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgacga gttccataag gcatggaaaa ccggagcagg agccgagagg
1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg
1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg
1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat
1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt
1260
agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga
1320
accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg
1380
gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429
<210>SEQ ID NO. 6
<211>1249
<212>DNA
<213>artificial synthesized
atgataactt ctgctcttca tcgtgcggcc gactgggcta aatctgtgtt ctcttcggcg 60
gcgctgggtg atcctcgccg tactgcccgc ttggttaacg tcgccgccca attggcaaaa 120
tattctggta aatcaataac catctcatca gagggtagtg aagccatgca ggaaggcgct 180
taccgatttt accgcaatcc caacgtttct gccgaggcga tcagaaaggc tggcgccatg 240
caaacagtca agttggctca ggagtttccc gaactgctgg ccattgagga aaccacctct 300
ttgagttatc gccaccaggt cgccgaagag cttggcaagc tgggctctat tcaggataaa 360
tcccgcggat ggtgggttca ctccgttctc ttgctcgagg ccaccacatt ccgcaccgta 420
ggattactgc atcaggagtg gtggatgcgc ccggatgacc ctgccgatgc ggatgaaaag 480
gagagtggca aatggctggc agcggccgca actagccggt tacgcatggg cagcatgatg 540
agcaacgtga ttgcggtctg tgaccgcgaa gccgatattc atgcttatct gcaggacagg 600
ctggcgcata acgagcgctt cgtggtgcgc tccaagcacc cacgcaagga cgtagagtct 660
gggttgtatc tgatcgacca tctgaagaac caaccggagt tgggtggcta tcagatcagc 720
attccgcaaa agggcgtggt ggataaacgc ggtaaacgta aaaatcgacc agcccgcaag 780
gcgagcttga gcctgcgcag tgggcgcatc acgctaaaac aggggaatat cacgctcaac 840
gcggtgctgg ccgaggagat taacccgccc aagggtgaga ccccgttgaa atggttgttg 900
ctgaccggcg aaccggtcga gtcgctagcc caagccttgc gcgtcatcga catttatacc 960
catcgctggc ggatcgacga gttccataag gcatggaaaa ccggagcagg agccgagagg
1020
caacgcatgg aggagccgga taatctggag cggatggtct cgatcctctc gtttgttgcg
1080
gtcaggctgt tacagctcag agaaagcttc acgccgccgc aagcactcag ggcgcaaggg
1140
ctgctaaagg aagcggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat
1200
gaatgtcagc tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt
1260
agcttgcagt gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga
1320
accggaattg ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg
1380
gatggctttc ttgccgccaa ggatctgatg gcgcagggga tcaagatct 1429