CN106754752B - RSV (respiratory syncytial virus) and application thereof - Google Patents

Abstract

The invention discloses an RSV (respiratory syncytial virus) and application thereof, wherein the total genome length of the virus is 15180 bp, and the sequence is shown as SEQ ID NO: 1, and the amino acid sequence is shown as SEQ ID NO: 2, respectively. The genetic engineering vaccine obtained on the basis of the sequence of the RSV A13 virus strain isolated in China has good immunogenicity, wherein the BR 4F protein can induce higher-level antibody immune response, and has excellent clearance rate to RSV A2 and A13 virus strains in mouse lungs.

Description

RSV (respiratory syncytial virus) and application thereof

Technical Field

The invention relates to an RSV (respiratory syncytial virus) and application thereof.

Background

Respiratory Syncytial Virus (RSV) is a pathogenic virus of the Paramyxoviridae, Pneumovirinae, Pneumovirus genera. RSV is widely prevalent throughout the world and is one of the most common pathogenic microorganisms responsible for lower respiratory tract infections in infants, the elderly, and immunocompromised individuals. RSV is a non-segmented negative-strand RNA virus, the genome of which can encode 11 proteins. The RNA genome is closely associated with the virus N protein to form a nucleocapsid which is wrapped in a virus envelope, and the diameter of the virus particle is 150-300 nm. RSV primarily infects epithelial cells of the nasal cavity and large and small airways of the lung, and may also infect alveolar macrophages and other types of cells in the lung, which can cause the cells to fuse together to form syncytia.

The RSV outer membrane has G, F, SH transmembrane glucoprotein, which is commonly involved in fusion of virus outer membrane and host cell membrane and formation of syncytium during cell culture, wherein G, F is two important membrane protein components. The G protein is related to adhesion of viruses and cells, and has great variation among subtypes and in subtypes, so that the G protein is an important means for RSV escape from body immune attack. RSV viruses are divided into subtypes A and B based on differences in the antigenicity of the G glycoprotein. The F protein is related to the entry of virus into cells and the formation of characteristic syncytia, and has the functions of promoting the spread of RSV among infected cells and hemolysis.

The F and G proteins are the most major viral antigens that stimulate the body to produce protective antibodies. However, the G protein has higher subtype specificity and variability, so the G protein is not suitable for being made into vaccines, compared with the F protein, the F protein has more stable antigenicity and less variation, the F protein is a main protein for inducing the organism to generate immune protection, the antibody induced by the F protein can protect the organism from the RSV A and B subtype viruses, and the G protein antibody only provides protection for the same subtype viruses, so the F protein has higher research value.

After the RSV virus infected by clinical RSV infected patients is separated and analyzed, the RSV virus infected by Chinese domestic patients is found to be different from the RSV A2 which is an international epidemic strain. In particular, there is a large difference in F protein on the surface of the virus.

Various forms of RSV vaccines have been developed, such as formalin inactivated vaccine (FI-RSV), subunit vaccines and attenuated vaccines, cold-adapted vaccine, viral vector vaccines, DNA vaccines, etc., but no vaccine is available to date for preventing RSV infection. Among them, formalin inactivated vaccine has been developed in the 60's of the 20 th century, but there was an unexpected case that the disease becomes worse when RSV is naturally infected after the inoculation of human body. The wide spread of RSV infection has made the development of RSV vaccines particularly important.

How to construct highly immunogenic F protein-derived RSV viruses is a key to the development of highly effective RSV vaccines.

Disclosure of Invention

The invention aims to provide an RSV (respiratory syncytial virus) and application thereof.

The technical scheme adopted by the invention is as follows:

an RSV virus, the whole genome length of which is 15180 bp, and the sequence of which is shown in SEQ ID NO: 1 is shown.

The application of the RSV virus in preparing RSV vaccine.

The RSV vaccine is whole virus inactivated vaccine, subunit vaccine, attenuated live vaccine, VLP, genetic engineering vaccine and DNA vaccine.

The RSV is used for preparing in-vitro preventive vaccines, therapeutic vaccines and therapeutic drug efficacy evaluation reagents.

An RSV antigen which is a fragment or all of the above RSV virus F protein and which comprises at least one specific F protein amino acid site.

The sequence of the RSV antigen contains at least one of 103A, 276S. In particular, the sequence of the RSV antigen is its F protein.

The invention has the beneficial effects that:

the genetic engineering vaccine obtained on the basis of the sequence of the RSV A13 virus strain isolated in China has good immunogenicity, wherein the BR 4F protein can induce higher-level antibody immune response, and has excellent clearance rate to RSV A2 and A13 virus strains in mouse lungs.

Drawings

FIG. 1 is a schematic representation of the amplification of RSV A13 virus of the invention on HEP-2 cells;

FIG. 2 SDS-PAGE and WB analysis of BR1, BR2, BR3 and BR 4F proteins;

FIG. 3 is an analysis chart of neutralizing antibodies against murine sera for BR1, BR2, BR3 and BR 4F proteins and RSV A2/A13: a: neutralizing RSV a 2; b: neutralizing RSV a 13;

FIG. 4 graphs of the viral clearance assay of RSV A2/A13 in mouse lung tissue: a: clearing RSV a 2; b: RSVA13 is cleared.

Detailed Description

The technical scheme of the invention is further explained by combining the embodiment.

Principal material

Virus: RSV a 2;

cell: insect cell Sf 9.

Primary reagent

Viral RNA extraction and reverse transcription kits (OMEGA);

KOD FX（TOYOBO）；

bac recombinant baculoplasmide extraction kit (Omiga organism);

kanamycin, gentamicin, tetracycline, X-gal, IPTG (Beijing Dingguo);

1640 medium (Gibco);

fetal bovine serum (Gibco);

cellffectin II liposome (Sigma);

palivizumab monoclonal antibody;

HRP goat anti-human secondary antibody (Invitrogen).

Cell culture

Taking out a frozen cell from liquid nitrogen, rapidly thawing in 37 deg.C warm water, inoculating the cell suspension, and transferring to 75cm²The culture flask of (4) was gradually dropped with 1640 medium (containing 10% fetal calf serum) to 20 ml, 37 ℃ and 5% CO₂Culturing in an incubator. After culturing for 48-72 h, the culture solution is discarded, and D-Hanks is used for washing for three times. Digesting the cells with 0.25% pancreatin, adding the cell 1640 culture medium, and passaging the cells at a seed ratio of 1: 4-1: 5 until a sufficient amount of cells required for seed toxicity are obtained.

Isolation, culture and whole genome sequencing of respiratory syncytial virus RSV

After the HEP-2 cells are digested, the size of each hole is 1.0-2.0 multiplied by 10 in a 24-hole plate⁵1ml of 5% CO at 37 ℃ was added at a density of one/ml₂Culturing in an incubator for 48 h. Taking clinical samples such as secretion in nasopharyngeal cavity from hospital, centrifuging at 5000rpm for 15 min; inoculating the centrifuged supernatant into a 24-pore plate, wherein each pore is 0.5ml, and placing the plate at 37 ℃ for adsorption for 75-120 min; then, 0.5ml of 1640 medium containing 2% fetal bovine serum was added thereto, and 5% CO was added thereto at 37 ℃₂Culturing for 2-4 days in an incubator; continuously carrying out blind passage for 3 generations, continuously carrying out passage for 4 th generation samples with pathological changes, abandoning samples without pathological changes, and screening an RSV strain with syncytium phenomenon and the highest proliferation and pathological change speed.

200. mu.l of the obtained RSV was taken and its genomic RNA was extracted using a viral RNA extraction kit from OMEGA. Then, a reverse transcription system is prepared by taking the RNA as a template, and the following components are added into a 1.5 ml Nuclear-Free centrifugal tube to prepare a mixed solution: mu.l of RNA, 2. mu.l of 50. mu.M Random 6 mers, 2. mu.l of 10 mM dNTP mix, in a total volume of 36. mu.l; mixing, incubating at 65 deg.C for 5min, taking out, and cooling on ice for 2 min; mu.l of cDNA synthesis mixture (10. mu.l of 5 XTT Buffer, 2. mu.l of M-MLV reverse Transcriptase Transcriptase and 2. mu.l of RnaseInhibitor) was added, and the total volume was 50. mu.l, which was the PCR amplification template.

Designing 15 pairs of different primers, and carrying out PCR amplification, wherein the reaction system comprises: mu.l RSV viral cDNA, 25. mu.l 2 XPCR buffer, 1. mu.l KOD FX, 10. mu.l dNTPs, 1.5. mu.l forward primer 1, 1.5. mu.l reverse primer 2, 6. mu.l ddH₂O, 50. mu.l total volume; reaction procedure: 94 ℃ for 3 min; (98 ℃, 10 s; 57 ℃, 30 s; 68 ℃, 2-3 min), 30 cycles; 68 ℃ for 10 min. After the PCR product is sent to Huahua big gene for sequencing, DNA star software is utilized for splicing, the result shows that the virus mRNA is 15180 bp long, and the gene sequence is shown as SEQ ID NO: 1, the amino acid sequence of the analyzed virus strain protein is as follows:

coding nucleic acid region	Encoding proteins	Coding nucleic acid region	Encoding proteins
				99-518	NS1	4678-5571	G
628-1002	NS2	5651-7375	F
				1140-2315	N	7593-8177	M2-1
2347-3072	P	8152-8418	M2-2
				3255-4025	M	8485-14982	L
4293-4487	SH

The spliced full-length sequence is aligned in NCBI through BLAST, the virus is an RSV A virus, the sequence is aligned with a sequence RSV A2 (GenBank accession No. KT 992094.1) in NCBI, the alignment result shows that the sequence has higher similarity, and the amino acid sites and amino acid names which are special for an F protein of a main antigen of an isolated RSV virus are shown in a table, wherein the position 276 of the F protein is different from the position of the A2 strain (Palivizumab is derived from A2, the position is positioned in the Palivizumab antigen site II region, the amino acid site is N), and the virus is named as RSV A13.

Amino acid site and amino acid name table specific for RSV F protein

Amino acid site

Name of amino acid

Amino acid abbreviations

Amino acid site

Name of amino acid

Amino acid abbreviations

4

Proline

P

105

Serine

S

9

Threonine

T

122

Threonine

T

16

Alanine

A

124

Asparagine

N

20

Leucine

L

152

Isoleucine

I

25

Serine

S

276

Serine

S

66

Glutamic acid

E

384

Isoleucine

I

101

Threonine

T

540

Alanine

A

103

Alanine

A

Based on the above sequencing results, those skilled in the art can use the known RSV viruses, synthesize complete genomic sequences or construct cDNA clones, clone plasmids, transfect in vitro and package viruses to construct the RSVA13 virus strain of the present invention.

Virus (RSV A13 strain) amplification, titer determination, and preservation

Passage of HEP-2 cells to 5 flasks 75cm²When the cell density reached 90% or more, the culture supernatant was aspirated off, and 0.5ml of the RSV-A13 virus isolated in example 2 and 3.5 ml of 1640 medium without serum were inoculated, incubated at 37 ℃ and shaken every 15min, and after 2 hours, 16 ml of 1640 medium containing 10% fetal calf serum was added. When the typical lesion of the cells or the cell detachment amount exceeds 70%, the culture can be harvested, as shown in FIG. 1. Blowing down all the residual adherent cells to uniformly suspend the cells or cell fragments by total 100 ml; subpackaging into aseptic screw cap centrifuge tubes with 500 μ l/tube, labeling, and immediately adding into liquid nitrogen for quick freezing; taking out from liquid nitrogen after 5-15min, and storing at-80 deg.C for a long period.

The titer of the amplified RSV A13 virus was determined by plaque assay in 6-well plates after cell digestion3ml of 2.5X 10 are added per well⁵Cell suspension/ml, 5% CO at 37 ℃₂Culturing in an incubator. Infection was initiated after the cells had spread over the culture wells. Diluting the virus to the desired concentration, e.g. 10, with an EP tube^-4～10^-7(ii) a Absorbing and discarding the culture solution in the six-hole plate, washing once with D-Hanks solution, adding 0.2 mL/hole of diluted virus solution, and setting multiple holes; gently shaking to disperse it uniformly in the culture well, and placing in CO₂Incubating for 75min in an incubator, and shaking gently once every 15 min; after 75min, 1% methylcellulose overlay medium was added, 4ml per well; is placed in CO₂Crystallizing the purple stained plate in an incubator for 6 days, counting the spot condition and calculating the virus titer; the virus titer is calculated by the formula:

plaque formation unit (PFU/ml) = (number of plaques averaged x viral dilution)/amount of virus inoculated per well

Log PFU was calculated by taking the Log to obtain RSV a13 viral titer.

The preparation of the vaccine can be carried out according to conventional methods, and for convenience of comparison, a process for preparing the vaccine is provided below. Of course, other methods can be used by those skilled in the art to produce corresponding RSV vaccines.

Preparation of protein gene engineering subunit vaccine

1) The sequence alignment of the F proteins of the RSV Chinese epidemic strain (including RSV A13) and A2 strain shows that two ubiquitous differences exist, and the difference sites are as follows: T103A and N276S, wherein one site is in an antigenic site II region acted by a Palivizumab monoclonal antibody, therefore, an F protein vaccine aiming at an A2 strain is modified to design an F protein vaccine aiming at a Chinese epidemic strain, 4 shuttle vectors aiming at the F protein are constructed by using the existing method, such as the method disclosed by CN106119287A and are respectively named as Rp1, Rp2, Rp3 and Rp4, wherein the Rp1 is constructed according to RSV A2, the expressed target protein is the F protein of RSV A2, and the target proteins expressed by target genes in the other three shuttle vectors are different from the target protein expressed by the Rp1 as follows: rp2, T103A (i.e. T at position 103 of the F protein sequence is replaced by a, the same below); rp3, N276S; rp4, T103A, N276S;

2) respectively transforming three plasmids of Rp1, Rp2, Rp3 and Rp4 into DH10 MultiBac competence prepared in the laboratory for recombination, screening positive colonies, and shaking bacteria to extract bacmids;

3) the bacmid obtained in the previous step was transfected into Sf9 cells to obtain the corresponding first generation recombinant baculovirus which were named: BR1-V1, BR2-V1, BR3-V1 and BR 4-V1. The Sf9 suspension cells were infected with MOI =0.1 to amplify each virus, and the obtained third generation viruses were: BR1-V3, BR2-V3, BR3-V3 and BR 4-V3;

4) infecting Sf9 suspension cells with the prepared third generation virus at MOI =1, taking SF 900-II as a suspension culture medium, inoculating the virus, culturing at 27 ℃ and 95rpm for 96 h on a constant temperature shaking table, centrifuging at 5000rpm for 30min, collecting cell precipitate, and storing at-80 ℃;

5) adding lysis solution (pH 8.0, 25mM Tris-Cl, 50mM NaCl, 0.1% Tergitol NP9, 2mg/ml Leuteptin) into the harvested cell sample according to the proportion of 10ml/g for resuspension, shaking on ice for 2h, centrifuging at high speed, and sequentially using a strong anion column EMD TMAE, a lectin affinity medium GST-Sepharose 4B and a strong cation EMD SO₃Purifying to obtain the target protein (RSV F protein or modified F protein).

Protein SDS-PAGE and Western blot analysis

100 μ l of each of the purified BR1, BR2, BR3 and BR 4F proteins was added to SDS-PAGE LoadingBuffer and boiled for SDS-PAGE and Western blot analysis. Four samples were spotted on a gel, two copies, one of which was electrophoresed by SDS-PAGE and stained directly with Coomassie Brilliant blue and destained in destaining solution. Performing Western blot analysis on the other block, and detecting the primary antibody by using a humanized Palivizumab monoclonal antibody; the secondary antibody was analyzed by using an HRP-labeled anti-human polyclonal antibody and SDS-PAGE and Western blot, and no significant difference was observed among the four F proteins BR1, BR2, BR3 and BR4, as shown in FIG. 2. The F0, F1 and F2 proteins corresponding to the four F proteins are in the same horizontal position, and the purities of the four F proteins are similar. The protein concentrations of the four F proteins were determined simultaneously using the Bradford method.

Protein gene engineering subunit vaccine immunogenicity analysis

The purified BR1, BR2, BR3 and BRThe 4F protein was diluted separately to the appropriate concentration and 1/10 volumes of Al (OH) were added separately₃Adjuvant (1000 mg/ml). And carrying out intraperitoneal injection immunization on the BALB/c mice by using the RSV F protein added with the adjuvant according to the doses of 1 mug, 5 mug and 25 mug. Immunizing once on 0 th and 21 st days, collecting blood in the posterior eye frame on 28 th day, collecting serum, and subpackaging at-80 deg.C for storage. And challenge tests were performed on day 29. Each dose group is divided into three groups for attacking toxin, and the three groups are respectively dripped into the nose 10⁶PFU RSV a2, RSV a13 or PBS, and on day 4 post challenge, mice were sacrificed by cervical dislocation, left and right lungs were aseptically placed in sterile collection tubes and 1ml of pre-cooled 1640 medium (2% FBS, double antibody) was added and stored at-80 ℃. After collection of the anti-mouse serum and lung tissue specimens, the following treatments and tests were carried out:

anti-mouse serum neutralizing antibody titer detection

Serum samples of each group of mice were taken, inactivated at 56 ℃ for 30min, diluted in serum-free RPMI-1640 medium at a fold ratio, and RSV A2 and RSV A13 were diluted to 100 PFU/100. mu.l, respectively, in serum-free 1640 medium. The diluted virus solution and the sample were each 100. mu.l, mixed well, and left in a cell incubator at 37 ℃ for 2 hours. Removing the supernatant of the Hep-2 cell culture, adding 200. mu.l of the mixed solution into the Hep-2 cells in the 6-well plate, adding a negative control, and placing the cell culture medium at 37 ℃ for further culture for 2 hours. 4ml of 1% methylcellulose overlay medium was added to each well and placed in CO₂And (3) removing the culture medium in the incubator for 5 days, carrying out crystal violet staining, counting spots, judging the serum neutralization antibody titer by serum dilution which can reduce the number of the spots by 50%, and calculating the neutralization antibody titer of RSV A2 and RSV A13 which are neutralized by each serum sample respectively.

The experimental result is shown in figure 3A, the proteins 1 mu g, 5 mu g and 25 mu g of the BR 4F prepared by the invention can induce about 1:256 neutralization titer of RSV A2 in the antiserum of BR1, BR2, BR3 and BR 4F, and after the immune dose reaches 1 mu g, the neutralization titer has not changed obviously, which indicates that the induced humoral immunity is saturated when the immune dose reaches 1 mu g; the neutralizing titer of over 1:256 can be induced by the anti-mouse serum neutralizing RSVA13 (figure 3B), wherein the neutralizing titer induced by the BR 4F protein is obviously higher than that induced by the BR1, BR2 and BR 3F proteins, and the difference is very obvious.

Lung tissue virus titer detection

Taking out lung tissue at-80 deg.C, homogenizing under aseptic condition to obtain lung tissue suspension, centrifuging at 4 deg.C and 10000g for 5min, and collecting supernatant. Virus titer was measured by the plaque assay of reference example 3, in 100. mu.l volume, and the clearance of lung tissue virus was calculated. The lung tissue virus clearance rate calculation formula is as follows:

viral clearance = (PBS control group pneumovirus titer-sample group pneumovirus titer)/PBS control group pneumovirus titer × 100%.

The experimental results are shown in figure 4 (A: eliminating RSV A2; B: eliminating RSV A13), and the clearance rates of the BR1, BR2, BR3 and BR 4F protein groups aiming at RSV A2 and RSV A13 are all more than 80%, wherein the clearance rate of three immune doses of the BR 4F protein to RSV A13 is 100%.

The results of F protein antiserum neutralizing antibody titer and lung virus clearance rate are combined to show that the gene engineering vaccines BR2, BR3 and BR 4F protein obtained on the basis of the sequence of the RSV A13 virus strain isolated in China have good immunogenicity, wherein the BR 4F protein has better immunogenicity against the RSV A13 strain isolated in China. Therefore, according to the virus strain sequence of the RSV A13, a vaccine for preventing diseases related to respiratory syncytial virus infection can be constructed.

SEQUENCE LISTING

<110> Guangdong south China Combined vaccine development institute Co., Ltd

<120> novel RSV (respiratory syncytial virus) and application thereof

<130>RSV-A13

<160>1

<170>PatentIn version 3.5

<210>1

<211>15180

<212>DNA

<213>RSV

<400>1

acgcgaaaaa atgcgtacaa caaacttgcg taaaccaaaa aaatggggca aataagaatt 60

tgataagtac cacttaaatt taactccttt ggttagagat gggcagcaac tcattgagta 120

tgataaaagt tagattgcaa aatctgtttg acaatgatga agtagcattg ttaaaaatga 180

catgctatac tgacaaatta atacagttaa ctaatgcttt ggctaaggca gttatacata 240

caatcaaatt gaatggcatt gtatttgtgc atgttattac aagtagtgat atttgcccta 300

ataataatat tgtagtgaaa tccaatttca caacaatgcc agtattacaa aatggaggtt 360

atatatggga aatgatggaa ttaacacact gctctcaacc taatggccta atagatgaca 420

attgtgaaat taaattctcc aaaaaactaa gtgattcgac aatgaccaat tatatgaatc 480

aattatctga attacttgga tttgacctca atccataaat cataataaat atcaactagc 540

aaatcaatgt cactaacacc attagttaat ataaaacttg acagaagata aaaatggggc 600

aaataaatca attcagccga cccaaccatg gacacaacac acaatgatac cacaccacaa 660

agactgatga tcacagacat gagaccatta tcacttgaga ctataataac atctctaacc 720

agagatatca taacacataa atttatatac ttgataaatc atgaatgcat agtgagaaaa 780

cttgatgaaa gacaggccac atttacattt ctggtcaact atgaaatgaa actattgcac 840

aaagtgggaa gcactaaata taaaaaatat actgaataca acacaaaata tggcactttc 900

cctatgccaa tatttatcaa tcatgatggg ttcttagaat gcattggcat taagcctacc 960

aagcacacac ccataatata caagtatgat ctcaatccat gaatatcaaa acaagattca 1020

aacaatccga aataacaact ttatgcataa tcacactcca tagtccaaat ggagcctgaa 1080

aattatagtt atttaaaatt aaggagagac ataagatgaa agatggggca aatacaaaaa 1140

tggctcttag caaagtcaag ttgaatgata cactcaacaa agatcaactt ctatcatcca 1200

gcaaatatac catccaacgg agcacaggag acagcattga cactcctaat tatgatgtgc 1260

agaaacacat taataagtta tgtggcatgt tattaatcac agaagatgct aatcataaat 1320

tcactgggtt aataggtatg ttatatgcta tgtctagatt aggaagagaa gacaccataa 1380

aaatactcaa agatgcggga tatcatgtta aggcaaatgg agtggatgta acaacacatc 1440

gtcaagacat taatgggaaa gaaatgaaat ttgaagtgtt aacattagca agcttaacaa 1500

ctgaaattca aatcaacatt gagatagaat ctagaaaatc ctacaaaaaa atgctaaaag 1560

aaatgggaga ggtggcacca gaatacaggc atgactctcc tgattgtggg atgataatat 1620

tatgtatagc agcattagta ataaccaaat tagcagcagg agatagatca ggtcttacag 1680

ctgtgattag gagagctaat aatgtcctaa aaaatgaaat gaaacgttat aaaggtttat 1740

tacccaagga tatagccaac agcttctatg aagtgtttga aaaatatcct cactttatag 1800

atgtttttgt tcattttggt atagcacaat cttctaccag aggtggcagt agagttgaag 1860

ggatttttgc aggattgttt atgaatgcct atggtgcagg gcaagtgatg ttacggtggg 1920

gggtcttagc aaaatcagtt aaaaacatta tgttaggaca cgctagtgta caagcagaaa 1980

tggaacaagt tgtggaggtg tatgagtatg ctcagaaatt gggtggagaa gcaggattct 2040

accatatatt gaacaaccca aaagcatcac tattatcttt gactcaattt cctcacttct 2100

ctagtgtagt attgggcaat gctgctggcc taggcataat gggagaatac agaggtacac 2160

caaggaatca agatttatat gatgctgcaa aagcatatgc tgaacaactc aaagaaaatg 2220

gtgtgattaa ctacagtgta ttagacttga cagcagaaga actagaggct atcaaacatc 2280

agcttaatcc aaaagataat gatgtagagc tttgagttaa taaaaaagtg gggcaaataa 2340

atcatcatgg aaaagtttgc tcctgaattc catggggaag atgcaaacaa cagagccacc 2400

aaattcctag aatcaataaa gggcaaattc acatcaccca aagatcccaa gaaaaaagat 2460

agtatcatat ctgtcaactc aatagatata gaagtaacca aagaaagccc tataacatca 2520

aattcaacca ttataaaccc aataaatgag acagatgata ctgtagggaa caagcccaat 2580

tatcaaagaa agcctctagt aagtttcaaa gaagacccta tgccaagtga taatcctttt 2640

tcaaaactat acaaagaaac catagaaaca tttgataaca atgaagaaga atctagctat 2700

tcatatgaag aaataaatga tcagacaaac gataatataa cagcaagatt agataggatt 2760

gatgagaaat taagtgaaat actaggaatg cttcacacat tagtagtagc gagtgcagga 2820

cctacatctg ctcgggatgg tataagagat gccatggttg gtttaagaga agaaatgata 2880

gaaaaaatca gaactgaagc attaatgacc aatgacagac tagaagctat ggcaagactc 2940

aggaatgaag aaagtgaaaa gatggcaaaa gacacatcag atgaagtgtc tctcaatcca 3000

acatcagaga aactgaacaa cctgttggaa gggaatgata gtgacaatga tctatcactt 3060

gaagatttct gattagctac caaactgtac atcaaaacac aacaccaata gaaaaccaac 3120

aaacaaacca actcacccat ccaaccaaac atccatccgc tgactagcca accagccaaa 3180

aaacaaccag ccaatccaaa actagccacc cggaaaaaat cgacactata gttacaaaaa 3240

aagatggggc aaatatggaa acatacgtga ataaacttca cgagggctcc acatacacag 3300

ctgctgttca atacaatgtc ctagaaaaag acgatgatcc tgcatcactt acaatatggg 3360

tgcccatgtt ccaatcatcc atgccagcag atctactcat aaaagaacta gccaatgtca 3420

atatactagt gaaacaaatatccacaccca agggaccctc attaagagtc atgataaact 3480

caagaagtgc agtgctagca caaatgccca gcaaatttac catatgtgcc aatgtgtcct 3540

tggatgaaag aagcaagctg gcatatgatg taaccacacc ctgtgaaatt aaggcatgca 3600

gtctaacatg cctaaaatca aaaaatatgt taactacagt taaagatctc actatgaaaa 3660

cactcaaccc aacacatgac atcattgctt tatgtgaatt tgaaaatata gtaacatcaa 3720

aaaaagtcat aataccaaca tacctaagat ctatcagcgt cagaaataaa gatctgaaca 3780

cacttgaaaa tataacaacc actgaattca aaaatgccat tacaaatgca aaaatcatcc 3840

cttactcagg attactgtta gtcatcacag tgactgacaa caaaggagca ttcaaataca 3900

taaagccaca aagtcaattc atagtagatc ttggagctta cctagaaaaa gaaagtatat 3960

attatgttac aacaaattgg aagcacacag ctacacgatt tgcaatcaaa cccatggaag 4020

attaaccttt ttcctctaca tcaatgagta gattcataca aactttctaa ctacattctt 4080

cacttcacaa tcataatcac caaccctctg tggttcaatc aatcaaacga aactcatcag 4140

gagttccaga tcatcccaag tcattgttca tcagatccag tactcaaata agttaataaa 4200

aaccacatgg ggcaaataat cattgaggga aatccaacta atcacaacat ctgtcaacat 4260

agacaagtca acacgctaga taaaatcaac caatggaaaa tacatccata actatagaat 4320

tctcaagcaa attctggcct tactttacac taataaacat gataacaaca ataatctctt 4380

tgataatcat aatctccatc atgattgcaa tactaaacaa actctgcgaa tataatgtat 4440

tccacaacaa aacctttgag ctaccaagag ctcgagtcaa tacatagcat tcaccaatct 4500

gatagctcaa aacagtaacc ttgcatttgt aaatgaacta ccctcacctc ttcacaaaac 4560

cacatcaaca tctcaccatg caagccatca tctataccat aaagtagtta attaaaaata 4620

gtcataacaa tgaactagga tattaagacc aaaaacaacg ctggggcaaa tgcaaacatg 4680

tccaaaacca aggaccaacg caccgccaag acactagaaa ggacctggga cactctcaat 4740

catctattat tcatatcatc gtgcttatac aagttaaatc ttaaatctat agcacaaatc 4800

acattatcta ttttggcaat gataatctca acctcactta taattgcagc catcatattc 4860

atagcctcgg caaaccacaa agtcacacta acaactgcaa tcatacaaga tgcaacgaac 4920

cagatcaaga acacaacccc aacatacctc acccagaatc cccagcttgg aatcagcttc 4980

tccaatctgt ccggaactac atcacaatcc accaccatac tagcttcaac aacaccaagt 5040

gctgagtcaa ccccacaatc cacaacagtc aagatcaaaa acacaacaac aacccaaata 5100

ttacccagca aacccaccac aaaacaacgc caaaataaac cacaaaacaa acccaacaat 5160

gattttcact ttgaagtgtt caattttgta ccctgcagca tatgcagcaa caatccaacc 5220

tgctgggcca tctgcaagag aataccaaac aaaaaacctg gaaagaaaac caccaccaag 5280

cccacaaaaa aaccaaccct caagacaacc aaaaaagatc ccaaacctca aaccacaaaa 5340

ccaaaggaag tactcaccac caagcctaca gaaaagccaa ccatcaacac caccaaaaca 5400

aacatcagaa ctacactgct cacctccaac accacaggaa atccagaaca caccagtcaa 5460

gaggaaaccc tccactcaac cacctccgaa ggctatctaa gcccatcaca agtctataca 5520

acatccgagt acctatcaca atctccatct tcatccaaca caacaaaatg atagtcatta 5580

aaaagcgtat tgttgcaaaa agccatgacc aaatcaaaca gaatcaaaat caactctggg 5640

gcaaataaca atggagttgc caatcctcaa aacaaatgct attaccacaa tccttgctgc 5700

agtcacactc tgtttcgctt ccagtcaaaa catcactgaa gaattttatc aatcaacatg 5760

cagtgcagtt agcaaaggct atctcagtgc tctaagaact ggttggtaca ctagtgttat 5820

aactatagaa ttaagtaata tcaaggaaaa taagtgtaat ggtacagacg ctaaagtaaa 5880

attaataaaa caagaattag ataaatataa aaatgctgta acagaattgc agttgctcat 5940

gcaaagcaca acagcagcca acagtcgagc cagaagagaa ctaccaagat ttatgaatta 6000

tacactcaac aataccaaaa acaccaatgt aacattaagt aagaaaagga aaagaagatt 6060

tcttggattt ttgttaggtg ttggatctgc aatcgccagt ggcattgccg tatccaaggt 6120

cctgcatcta gaaggggaag tgaacaaaat caaaagtgct ctactatcca caaacaaggc 6180

tgtagtcagc ttatctaatg gagtcagtgt cttaaccagc aaagtgttag acctcaaaaa 6240

ctatatagat aaacagttgt tacctattgt taacaagcaa agctgcagca tatcaaacat 6300

tgaaactgtg atagagttcc aacaaaagaa caacagacta ctagagatta ccagagattt 6360

agtgttaatg caggtgtaac tacacctgta agcacttata tgttaactaa tagtgagtta 6420

ttatcattaa tcaatgatat gcctataaca aatgatcaga aaaagttaat gtccagcaat 6480

gttcaaatag ttagacagca aagttactct atcatgtcaa taataaaaga ggaagtctta 6540

gcatatgtag tacaattacc actatatggt gtaatagata ctccttgttg gaaactacac 6600

acatcccctc tatgtacaac caacacaaag gaaggatcca acatctgctt aacaagaacc 6660

gacagaggat ggtactgtga caatgcagga tcggtatcct ttttcccaca agctgaaaca 6720

tgtaaagttc aatcgaatcg ggtattttgt gacacaatga acagtttaac attaccaagt 6780

gaggtaaatc tctgcaacat tgacatattc aaccccaaat atgattgcaa aattatgact 6840

tcaaaaacag atgtaagcag ctccgttatc acatctctag gagccattgt gtcatgctat 6900

ggcaaaacca aatgtacagc atccaataaa aatcgtggga tcataaagac attctctaac 6960

gggtgtgatt atgtatcaaa taagggggtg gatactgtgt ctgtaggtaa tacattatat 7020

tatgtaaata agcaagaagg caaaagtctc tatgtaaaag gtgaaccaat aataaatttc 7080

tatgatccat tagtgttccc ctctgatgaa tttgatgcat caatatctca agtcaatgag 7140

aaaattaatc agagtctagc atttatccgt aaatcagatg aattattaca taatgtaaat 7200

gctggtaaat ccaccacaaa tatcatgata actaccataa ttatagtaat tatagtaata 7260

ttgttagcat taattgcagt tggactgctt ctatactgca aggccagaag cacaccagtc 7320

acattaagta aggatcaact gagtggtata aataatattg catttagtaa ctgaataaaa 7380

atagcaccta atcatattct tacaatggtt cgctatttga ccatagataa cccatctatc 7440

attggattat cctaaaattt gaacttcatc acaactttca tctataaacc atctcactta 7500

cactttttaa gtagattcct attttatagt tatataaaac aattgaatac caaattaact 7560

tactatttgt aaaaatgaga actggggcaa atatgtcacg aaggaatcct tgcaaattcg 7620

aaattcgagg tcattgcttg aatggtaaaa ggtgtcattt tagtcataat tattttgaat 7680

ggccacccca tgcactgctt gtaagacaaa actttatgtt aaacagaata cttaagtcta 7740

tggataaaag catagatact ttgtcagaaa taagtggagc tgcagagttg gacagaacag 7800

aagagtatgc cctcggtgta gttggagtgc tagagagtta tataggatca ataaataata 7860

taactaaaca atcagcatgt gttgccatga gcaaactcct cactgaactc aacagcgatg 7920

acatcaaaaa actaagggac aatgaagagc caaactcacc caaagtaaga gtgtacaata 7980

ctgtcatatc atatattgaa agcaacagga agaacaataa acaaactatc catctgttaa 8040

aaagattgcc agcagacgta ttgaagaaaa ccatcaaaaa cacattggat atccacaaga 8100

gcataaccat caataaccca aaagaatcaa ctgttagtga tacgaacgac catgccgaaa 8160

ataatgatac tacctgacaa atatccttgt agtataaatt ccatactaat aacaagtaat 8220

tgtagagtca ctatgtataa tcaaaaaaac acactatata tcaatcaaaa caaccaaaat 8280

aaccatatat acccaccgga tcaaccattc aatgaaatcc attggacctc tcaagacttg 8340

attgatgcaa ctcaaaattt tctacaacat ctaggtatta ctgatgatat atacacaata 8400

tatatattag tgtcataata ctcaatccta atacttacca catcatcaaa ttattaactc 8460

aaacaattca agctatggga caaaatggat cccattatta gtggaaattc tgctaatgtt 8520

tatctaactg atagttattt aaaaggtgtt atttctttct cagaatgtaa cgccttagga 8580

agttacatat tcaatggtcc ttatctcaaa aatgattata ccaacttaat tagtagacaa 8640

aatccattaa tagaacacat aaatctaaag aaactaaata taacacagtc cttaatatct 8700

aagtatcata aaggtgaaat aaaaatagaa gaacctactt actttcagtc attacttatg 8760

acatacaaga gtatgacctc atcagaacag actactacta ctaatttact taaaaagata 8820

ataagaagag ctatagaaat cagtgatgtc aaagtctatg ctatattgaa taaactgggg 8880

ctcaaagaaa aagacaagat taaatccaat aatggacaag atgaagacaa ctcagttatt 8940

actaccataa tcaaagatga tatactttta gctgtcaagg ataatcaatc tcatcttaaa 9000

gcagacaaaa atcaatccac aaaacaaaaa gatacaatca aaacaacact tttgaagaaa 9060

ttaatgtgtt cgatgcaaca tcctccatca tggttaatac attggtttaa tttatacaca 9120

aaattaaaca gcatattaac acaatatcga tctagtgagg taaaaaacca tggttttata 9180

ttgatagata atcatactct tagtggattc caatttattt tgaatcaata tggttgtata 9240

gtttatcata aggaactcaa aagaattact gtgacaactt ataatcaatt cttgacatgg 9300

aaagatatta gccttagtag attaaatgtt tgtttgatta catggattag taactgtttg 9360

aacacattaa acaaaagctt aggcttaaga tgtggattca ataatgttat cttgacacaa 9420

ttattccttt atggagattg tatattaaaa ctattccaca atgaggggtt ctacataata 9480

aaagaggtag agggatttat tatgtctcta attttaaata taacagaaga agatcaattc 9540

agaaaacggt tttataatag tatgctcaac aacatcacag atgccgctaa taaagctcaa 9600

aaaaatctgc tatcaagagt atgtcataca ttattagata agacaatatc agataatata 9660

ataaatggca gatggataat tctattgagt aagttcctaa aattaattaa gcttgcaggt 9720

gacaataacc tcaacaatct gagtgaatta tattttttgt tcagaatatt tggacaccca 9780

atggtagatg aaagacaagc catggatgct gttaaagtta attgcaacga gaccaaattt 9840

tacttgttaa gtagtttgag tatgttaaga ggagctttta tatatagaat tataaaaggg 9900

tttgtaaata attacaacag atggcctact ttaagaaatg ccattgtttt acccttaaga 9960

tggttaactt actataaact aaacacttat ccttccttgt tggaacttac agaaagagat 10020

ttgattgttc tatcaggact acgtttctat cgagagtttc ggttgcctaa aaaagtggat 10080

cttgaaatga tcataaatga taaggctata tcacctccta aaaatttaat atggactagt 10140

ttccctagaa attatatgcc gtcacacata caaaattata tagaacatga aaaattaaaa 10200

ttctctgata gtgataaatc aagaagagta ttagagtatt atttaagaga taacaaattc 10260

aatgaatgtg atttatacaa ctgtgtagtt aatcaaagtt atcttaacaa cccgaatcat 10320

gtggtatcat tgacaggcaa agaaagagaa ctcagtgtag gtagaatgtt tgcaatgcaa 10380

ccaggaatgt tcagacaagt tcaaatatta gcagagaaaa tgatagcaga aaacatatta 10440

caatttttcc ctgaaagtct tacaagatat ggtgatctag aactacagaa aatattagaa 10500

ttgaaagcag gaataagtaa caaatcaaat cgttacaatg ataattacaa caattacatt 10560

agtaagtgct ctatcatcac agatctcagc aaattcaatc aagcatttcg atatgaaaca 10620

tcatgtattt gtagtgatgt actggatgaa ctgcatggtg tacaatctct attttcctgg 10680

ttacatttaa ctattcctca tgtcacaata atatgcacat ataggcatgc acccccctat 10740

ataaaggatc atattgtaga tcttaacaat gtagatgagc aaagtggatt atatagatat 10800

catatgggtg gtatcgaagg gtggtgtcaa aaactatgga ccatagaagc tatatcacta 10860

ttagatctaa tatctctcaa agggaaattc tcaattactg ctttaattaa tggtgacaat 10920

caatcaatag atataagtaa accagtcaga ctcatggaag gtcaaactca tgctcaagca 10980

gattatttgc tagcattaaa tagtctcaaa ttactgtata aagagtatgc aggaataggc 11040

cacaaattaa aaggaactga gacttatata tcgagagata tgcaatttat gagtaaaacg 11100

atccaacata acggtgtata ttacccagct agtataaaga aagtcctaag agtgggaccg 11160

tggataaaca ctatacttga tgacttcaaa gtgagtctag aatctatagg tagtttgaca 11220

caagaattag aatatagagg tgaaagtcta ttatgcagtt taatatttag aaatgtatgg 11280

ttatataatc aaattgcatt acaacttaaa aatcatgcat tatgtaacaa caaattatat 11340

ttggatatat taaaagttct aaaacactta aaaacctttt ttaatcttga taacattgat 11400

acagcattaa cattgtatat gaatttgccc atgttatttg gtggtggtga tcccaacttg 11460

ttatatcgaa gtttctatag aagaactcct gatttcctca cagaggctat agttcactct 11520

gtgttcatac ttagttatta tacaaaccat gatttaaaag ataaacttca agatctgtca 11580

gatgatagat tgaataagtt cttaacatgc ataatcacgt ttgacaaaaa ccccaatgct 11640

gaattcgtta cattgatgag agatcctcaa gctttaggat ctgagaggca agctaaaatt 11700

actagcgaaa tcaatagact ggcagttacc gaggttttga gcacagctcc aaacaaaata 11760

ttttccaaaa gtgcacaaca ctataccact acagagatag atattaatga tattatgcaa 11820

aatatagaac ctacatatcc tcacgggcta agagttgttt atgaaagttt acccttttat 11880

aaagcagaga aaatagtaaa tcttatatcc ggtacaaaat ctataactaa catactggaa 11940

aagacttctg ccatagactt aacagatatt gatagagcca ctgagatgat gaggaaaaac 12000

ataactttgc ttataaggat attaccatta gattgtaaca gagataaaag agaaatattg 12060

agtatggaaa acctaagtat tactgaatta agcaaatacg ttagagaaag atcttggtct 12120

ttatccaata tagttggtgt tacatcaccc agtatcatgt atacaatgga cataaaatat 12180

acaacaagca ctatagctag tggcataatc atagagaaat ataatgtcaa cagtttaaca 12240

cgtggtgaga gaggacccac taaaccatgg gttggttcat ctacacaaga gaaaaagaca 12300

atgccagttt ataatagaca agttttaacc aaaaaacaga gagatcaaat agatctatta 12360

gcaaaattgg attgggtgta tgcatctata gataacaagg atgaatttat ggaggaactt 12420

agcataggaa ctcttgggtt aacatatgag aaggccaaaa aattattccc acaatattta 12480

agtgttaact atttgcatcg tcttacagtc agtagtagac catgtgaatt ccctgcatct 12540

ataccagctt atagaactac aaattatcac tttgatacta gccctattaa tcgcatatta 12600

acagaaaagt atggtgatga agatattgat atagtattcc aaaactgtat aagctttggc 12660

cttagcttaa tgtcagtagt agaacaattt actaatgtat gtcctaacag aattattctc 12720

atacccaagc ttaatgagat acatttgatg aaacctccca tattcacagg tgatgttgat 12780

attcacaagt taaaacaagt gatacaaaaa caacatatgt ttttaccaga caaaataagt 12840

ttgactcaat atgtggaatt attcttaagt aataaaacac tcaaatctgg atctaatgtt 12900

aattctaatt taatattggc gcataagata tctgactatt ttcataatac ttacatttta 12960

agtactaatt tagctggaca ttggattctt attatacaac ttatgaaaga ttctaagggt 13020

atttttgaaa aagattgggg agagggatat ataactgatc atatgttcat taatttgaaa 13080

gttttcttca atgcttataa gacatatctc ttgtgttttc ataaaggtta cggcagagca 13140

aagctggagt gtgatatgaa tacttcagat ctcctatgtg tattggaatt aatagacagt 13200

agttattgga agtctatgtc taaggtgttt ttagaacaaa aagttatcaa atacattctt 13260

agccaggatg caagtttaca tagagtaaaa ggatgtcata gcttcaaact atggtttctt 13320

aaacgtctta atgtagcaga attcacagtt tgcccttggg ttgttaacat agattatcat 13380

ccaacacata tgaaagcaat attaacttat attgatcttg ttagaatggg attgataaat 13440

atagatagaa tatacattaa aaataaacac aagttcaatg atgagtttta tacttctaat 13500

ctgttttaca ttaattataa cttctcagat aatactcatc tattaactaa acatataagg 13560

attgctaatt ccgaattaga aagtaattac aacaaattat atcatcccac accagaaacc 13620

ctagaaaata tactaaccaa tccggttaaa agtaatgaaa aaaagacact gagtgactat 13680

tgtataggta aaaatgttga ctcaataatg ttaccatcgt tatctaataa gaagcttatt 13740

aaatcgtcta caatgattag aaccaattac agcagacaag atttgtataa tttatttcct 13800

atggttgtga ttgataaaat tatagatcat tcaggtaata cagccaaatc taaccaactt 13860

tacactacta cttctcatca aatatcctta gtgcacaata gcacatcact ttattgcatg 13920

cttccttggc atcatattaa tagattcaat tttgtattta gttctacagg ttgtaaaatt 13980

agtatagagt atattttaaa agatcttaaa attaaggatc ctaattgtat agcattcata 14040

ggtgaaggag cagggaattt attattgcgt acagtagtgg aacttcatcc tgatataaga 14100

tatatttaca gaagtctgaa agattgcaat gatcatagtt taccaattga gtttttaagg 14160

ctgtacaatg gacatatcaa cattgattat ggtgaaaatt tgaccattcc tgctacagat 14220

gcaaccaaca acattcattg gtcttattta catataaagt ttgctgaacc tatcagtctt 14280

tttgtctgtg atgctgaatt gcctgtaaca gtcaactgga gtaagattat aatagagtgg 14340

agcaagcatg taagaaaatg caagtactgt tcttcagtta ataaatgtac attaatagta 14400

aaatatcatg ctcaagatga tatcgatttc aaattagaca acataactat attaaaaact 14460

tatgtatgct taggcagtaa gttaaaggga tctgaagttt acttagtcct tacaataggt 14520

cctgcaaatg tgttcccagt atttaatgta gtacaaaatg ctaaattgat actatcaaga 14580

accaaaaatt tcatcatgcc taaaaaagct gataaagagt ctattgatgc aaatattaag 14640

agtttgatac cctttctttg ttaccctata acaaaaaaag gaattaatac tgcattgtct 14700

aaattaaaga gtgttgttag tggagatata ctatcatatt ctatagctgg acgtaatgaa 14760

gttttcagca ataaacttat aaatcataag catatgaaca tcttaaagtg gttcaatcat 14820

gttttaaatt tcagatcaac agaattaaac tataatcatt tatatatggt agaatctact 14880

tatcctcatc taagtgaatt gttaaacagc ttgacaacca atgaacttaa aaaactgatt 14940

aaaatcacag gtagtttgtt atacaacttt tataatgaat aatgagcaaa aatcttataa 15000

caaaaatagc tacacactaa cattgtattc aattatagtt atttaaaatt aataattata 15060

taatttttta ataacttcta gtgaactaat cctaaaatta tcattttgat ctaggaagaa 15120

taagtttaaa tccaaatcta attggtttat atgtatatta acgaaattac gagatattag 15180

Claims (7)

1. An RSV virus, the whole genome length of which is 15180 bp, and the sequence of which is shown in SEQ ID NO: 1 is shown.

2. Use of the RSV virus of claim 1 in the manufacture of an RSV vaccine.

3. Use according to claim 2, characterized in that: the RSV vaccine is whole virus inactivated vaccine, attenuated live vaccine and genetic engineering vaccine.

4. Use according to claim 3, characterized in that: the genetic engineering vaccine is subunit vaccine and DNA vaccine.

5. Use according to claim 4, characterized in that: the subunit vaccine is a VLP.

6. Use of the RSV virus of claim 1 for the preparation of a prophylactic vaccine, a therapeutic vaccine and a therapeutic drug efficacy evaluation reagent in vitro.

7. An RSV antigen, characterized by: the RSV antigen is the F protein of the RSV virus of claim 1.

Images