CN106754406A - The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis - Google Patents
The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis Download PDFInfo
- Publication number
- CN106754406A CN106754406A CN201611086992.XA CN201611086992A CN106754406A CN 106754406 A CN106754406 A CN 106754406A CN 201611086992 A CN201611086992 A CN 201611086992A CN 106754406 A CN106754406 A CN 106754406A
- Authority
- CN
- China
- Prior art keywords
- host
- cordyceps sinensis
- insect
- separated
- worm summer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of method the invention provides winter worm summer herb thallus are separated in body fluid from host of Cordyceps sinensis, comprises the following steps：The host insect hemolymph that will be infected by aweto is classified by density gradient centrifugation and separated；Winter worm summer herb thallus crude extract is removed the haemocyte not separate using ultrapure water-splitting, winter worm summer herb thallus crude extract redundancy protein is removed by Proteinase K；Using the DNA and RNA of the remaining host insect of nuclease degraded, the Cordyceps sinensis hyphal body for obtaining after purification is separated；Verify that the Cordyceps sinensis hyphal body for obtaining whether there is the pollution of host insect nucleic acid；Using untainted Cordyceps sinensis hyphal body as final product；The method has filled up the blank for being obtained from live body host insect body and infecting state thalline research field in real time.
Description
Technical field
Invention is related to a kind of thalline extracting method, is more specifically related to a kind of from host of Cordyceps sinensis insect body fluid
Separate the method and its detection liquid-phase chip of aweto.
Technical background
Entomogenous fungi is mutual during infecting host insect for the research of aweto Disease-causing gene and aweto at present
Make the research such as mechanism and be nearly at space state.Main reason is that, under condition of living organism, it is difficult to obtain infect state thalline.Winter worm
The grass bacteria growing cycle in summer is long, and it is different to infect pattern from general entomogenous fungi, so using Cordyceps strain, in vitro
The expression of gene there is no method to realize during acquisition est sequence analysis aweto intrusion host insect.
After aweto infects host insect, how to be isolated and purified from host insect hemolymph to thin without host's blood
The aweto of born of the same parents, protein and DNA, RNA pollution, is effectively to extract free of contamination aweto DNA/RNA, build
The key technology of the aspect such as gene expression profile change after host is infected in DNA/RNA libraries, analysis aweto.From host insect
The Cordyceps Militaris thalline of internal direct access real-time status, analyzes its pathogenic molecular mechanism mechanism for infecting host insect, for
Solution fungi-insect Coupling effects, the scientific meaning tool that research aweto infects host insect is of great significance.
The content of the invention
To solve the above problems, the invention provides separation winter worm summer herb thallus in a kind of body fluid from host of Cordyceps sinensis
Method, comprises the following steps：
1) the host insect hemolymph that will be infected by aweto is classified by density gradient centrifugation and separated, and obtains winter worm
Summer grass thalline crude extract；
2) winter worm summer herb thallus crude extract is removed the haemocyte not separate using ultrapure water-splitting, by Proteinase K
Removal winter worm summer herb thallus crude extract redundancy protein；
3) using the DNA and RNA of the remaining host insect of nuclease degraded, the Cordyceps sinensis entomogenous fungi for obtaining after purification is separated
Body；
4) DNA and RNA is extracted from Cordyceps sinensis hyphal body after purification, design host of Cordyceps sinensis insect specificity is drawn
Thing enters performing PCR (polymerase chain reaction) and RT-PCR (reverse transcription polymerase chain reaction), verifies the Cordyceps sinensis entomogenous fungi for obtaining
Pollution of the body with the presence or absence of host insect nucleic acid；Using untainted Cordyceps sinensis hyphal body as final product.
2. the method that winter worm summer herb thallus are separated in the insect body fluid from host of Cordyceps sinensis according to claim 1,
It is characterized in that：Step 1) density gradient is separated into：
1) it is 55% up to sequentially add the concentration of 5 times of volumes of host insect hemolymph in ultracentrifugation Guan Zhongcong bottoms
Centricoll separating liquids, concentration are 45% Centricoll separating liquids, the Centricoll separating liquids that concentration is 35%, dense
Spend the Centricoll separating liquids for 25%；
2) hemolymph of host insect is added in ultracentrifugation pipe, the hemolymph of host insect is located at 25%
Centricoll separating liquids top；
3) 4 DEG C, 10-15min is centrifuged under the conditions of 10000g, remove supernatant, obtain bottom sediment, obtain Cordyceps sinensis
Thalline crude extract.
3. the method that winter worm summer herb thallus are separated in the body fluid from host according to claim 1, it is characterised in that：Institute
Host of Cordyceps sinensis insect is stated for Genus Hepialuss, hook Genus Hepialuss, Wugou Genus Hepialuss or intends the larva of Genus Hepialuss.
One kind detection liquid-phase chip, for detecting the hyphal body being separated to from host of Cordyceps sinensis insect body fluid, if
By host insect pollution of nucleic acid；For host of Cordyceps sinensis insect 18S rDNA, design amplimer is：18sF：5'-
CGAAACTGCGAATGGCTCA-3' and 18sR：5'-CCGAAGTCGGGATTTTTAGC-3'.
The method have the benefit that：The invention provides one kind the winter is extracted from host of Cordyceps sinensis insect body fluid
The method of worm summer grass thalline, the method has filled up the sky for being obtained from live body host insect body and infecting state thalline research field in real time
In vain.The winter worm summer herb thallus that the present invention is provided detect that liquid-phase chip in terms of winter worm summer herb thallus purity is judged, compares other sides
Method has sensitivity high, the characteristics of accuracy is good.
Brief description of the drawings
Fig. 1 not purified hyphal body microscopy figure；
Fig. 2 hyphal body microscopy figures after purification；
Rear hyphal body insect pollution of nucleic acid detects that (1. not purified thalline group has obvious pollution of nucleic acid to Fig. 3 before purification；
2. the seedless acid pollution of thalline group after purification).
Specific embodiment
The preparation of the winter worm summer herb thallus of embodiment 1
1. it is 55% up to sequentially add the concentration of host insect hemolymph 35ml in ultracentrifugation Guan Zhongcong bottoms
Centricoll separating liquids, concentration are 45% Centricoll separating liquids, the Centricoll separating liquids that concentration is 35%, dense
Spend the Centricoll separating liquids for 25%；
2. hemolymph 7ml is extracted from the host of Cordyceps sinensis insect bodies infected by aweto.In ultracentrifugation pipe
Middle addition hemolymph；
3. it is centrifuged 15min under the conditions of 4 DEG C, centrifugal force 10000g, removes supernatant liquid, suction foot sediment, as
Winter worm summer herb thallus crude extract；
4. winter worm summer herb thallus crude extract is removed the haemocyte of residual using ultrapure water-splitting, 5~10 times of precipitations are added
The ultrapure water-splitting of object product, is centrifuged 2~5 minutes；Removal supernatant；
5. winter worm summer herb thallus crude extract redundancy protein is removed by Proteinase K；
6. deoxyribonuclease and ribalgilase are added, and 15~18 DEG C are processed 5 hours after fully mixing；Centrifugation
3 minutes, reject supernatant, milli-Q water was precipitated 2 times, winter worm summer herb thallus extract about 100mg was obtained, wherein before not separating
Before purification as shown in figure 1, by as shown in Figure 2 after purification.
The identification of the winter worm summer herb thallus purity of embodiment 2
The liquid-phase chip of the winter worm summer herb thallus that the detection from host insect body fluid separate includes being directed to Cordyceps sinensis
Host insect 18S rDNA Gene Partial fragments, are designed to amplify the primer pair (being shown in Table 1) of target sequence.
The 18S rDNA gene magnification primers of table 1
| SEQ NO. | Type | Amplimer (5 ' -3 ') |
| 1 | Forward | CGAAACTGCGAATGGCTCA |
| 2 | Reverse | CCGAAGTCGGGATTTTTAGC |
All primer sequences are studied by Chongqing Institute of Chinese Medicine Cordyceps sinensis research institute and obtained.Every primer after synthesis
The storage liquid of 100pmol/mL is configured to 10mmol/L Tris Buffer respectively.
Take a little aweto precipitation and extract DNA and RNA, enter performing PCR with above-mentioned liquid-phase chip and RT-PCR reacts,
With the presence or absence of host insect DNA or RNA pollution (specifically as shown in Figure 3) in checking hyphal body precipitation.The method has sensitive
The characteristics of degree is high, accuracy is good.
SEQUENCE LISTING
<110>Chongqing Institute of Chinese Medicine
<120>The method and its detection liquid-phase chip of winter worm summer herb thallus are separated in a kind of hemolymph from host
<130> 2016
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213>Conservative region primer artificial sequence
<400> 1
cgaaactgcg aatggctca 19
<210> 2
<211> 20
<212> DNA
<213>Conservative region primer artificial sequence
<400> 2
ccgaagtcgg gatttttagc 20
Claims (4)
1. a kind of method that winter worm summer herb thallus are separated in body fluid from host of Cordyceps sinensis, it is characterised in that：Comprise the following steps：
1）The host insect hemolymph that will be infected by aweto is classified by density gradient centrifugation and separated, and obtains Cordyceps sinensis
Thalline crude extract；
2）Winter worm summer herb thallus crude extract is removed the haemocyte not separate using ultrapure water-splitting, is removed by Proteinase K
Winter worm summer herb thallus crude extract redundancy protein；
3）Using the DNA and RNA of the remaining host insect of nuclease degraded, the Cordyceps sinensis hyphal body for obtaining after purification is separated；
4）DNA and RNA is extracted from Cordyceps sinensis hyphal body after purification, design host of Cordyceps sinensis insect specificity primer enters
Performing PCR and RT-PCR, verify that the Cordyceps sinensis hyphal body for obtaining whether there is the pollution of host insect nucleic acid；Will be untainted
Cordyceps sinensis hyphal body is used as final product.
2. the method that winter worm summer herb thallus are separated in the insect body fluid from host of Cordyceps sinensis according to claim 1, it is special
Levy and be：Step 1）The density gradient is separated into：
1）The concentration that 5 times of volumes of host insect hemolymph are up sequentially added in ultracentrifugation Guan Zhongcong bottoms is 55%
Centricoll separating liquids, concentration are 45% Centricoll separating liquids, Centricoll separating liquids, the concentration that concentration is 35%
It is 25% Centricoll separating liquids；
2）The hemolymph of host insect is added in ultracentrifugation pipe, the hemolymph of host insect is located at 25%
Centricoll separating liquids top；
3）4 DEG C, 10-15min is centrifuged under the conditions of 10000g, remove supernatant, obtain bottom sediment, obtain winter worm summer herb thallus
Crude extract.
3. the method that winter worm summer herb thallus are separated in the body fluid from host according to claim 1, it is characterised in that：The winter
Worm summer grass host insect is Genus Hepialuss, hook Genus Hepialuss, Wugou Genus Hepialuss or the larva for intending Genus Hepialuss.
4. it is a kind of to detect liquid-phase chip, for detecting the hyphal body being separated to from host of Cordyceps sinensis insect body fluid, if receive
To host insect pollution of nucleic acid；It is characterized in that：For host of Cordyceps sinensis insect 18S rDNA, design amplimer is：
18sF：5'-CGAAACTGCGAATGGCTCA-3' and 18sR：5'-CCGAAGTCGGGATTTTTAGC-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611086992.XA CN106754406A (en) | 2016-12-01 | 2016-12-01 | The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611086992.XA CN106754406A (en) | 2016-12-01 | 2016-12-01 | The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106754406A true CN106754406A (en) | 2017-05-31 |
Family
ID=58914958
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611086992.XA Pending CN106754406A (en) | 2016-12-01 | 2016-12-01 | The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754406A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807580A (en) * | 2006-01-23 | 2006-07-26 | 重庆大学 | Method for separating and purifying insect pathogenic fungoid thallus from infected insect haemolymph |
-
2016
- 2016-12-01 CN CN201611086992.XA patent/CN106754406A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807580A (en) * | 2006-01-23 | 2006-07-26 | 重庆大学 | Method for separating and purifying insect pathogenic fungoid thallus from infected insect haemolymph |
Non-Patent Citations (1)
| Title |
|---|
| 李春梅等: "从寄主昆虫血淋巴中分离纯化病原真菌菌体的方法", 《重庆大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Perlejewski et al. | Next-generation sequencing (NGS) in the identification of encephalitis-causing viruses: unexpected detection of human herpesvirus 1 while searching for RNA pathogens | |
| Bolch | PCR protocols for genetic identification of dinoflagellates directly from single cysts and plankton cells | |
| Velegraki et al. | Rapid extraction of fungal DNA from clinical samples for PCR amplification | |
| CN112522274A (en) | ssDNA nucleic acid aptamer for identifying iridovirus of micropterus salmoides and application thereof | |
| Sun et al. | Efficient purification and concentration of viruses from a large body of high turbidity seawater | |
| Myrmel et al. | Immunomagnetic separation of a Norwalk-like virus (genogroup I) in artificially contaminated environmental water samples | |
| CN109517806B (en) | Tilapia lake virus virulent strain and RPA detection primer and method thereof | |
| CN104630369B (en) | The PCR detection method of fusarium moniliforme | |
| CN103014152A (en) | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae | |
| CN106754406A (en) | The method and detection liquid-phase chip of aweto are isolated and purified in a kind of body fluid from host of Cordyceps sinensis | |
| CN112853004A (en) | LAMP detection degenerate primer group, kit and method for white spot syndrome virus | |
| CN103952398A (en) | Method for extracting genome deoxyribonucleic acid (DNA) from heparin product | |
| CN1807580B (en) | Method for separating and purifying insect pathogenic fungoid thallus from infected insect haemolymph | |
| CN105255876B (en) | A kind of primer and method quickly detected for Legionella with parting | |
| CN105886643A (en) | PCR (polymerase chain reaction) detection primers and method for Aspergillus fumigatus | |
| CN109536623A (en) | It is a kind of that schistosoma japonicum cercariae method for distinguishing is identified using Multiplex PCR | |
| CN105177138A (en) | Primer and method used for detecting Oidium heveae and application | |
| JP2015139434A5 (en) | ||
| CN102628088B (en) | Polymerase chain reaction (PCR) detection method universal for viruses | |
| CN102304574B (en) | Diagnostic method for rifampicin resistant mycobacterium tuberculosis | |
| CN105886499B (en) | A kind of LAMP kit and its primer special detecting soyabean phytophthora | |
| Jabbar et al. | Saccharomyces Cerevisiae as a human pathogen in renal transplant recipients | |
| CN105524996B (en) | A kind of method of small melonworm in quick detection water body | |
| CN108034716B (en) | Kit for identifying infection and infection type of patient | |
| CN106893680A (en) | A kind of method that filamentous fungi is enriched with from blood sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |