CN106749658B

CN106749658B - Inhibit the anitibody type molecular chaperones of Tau albumen aggregation

Info

Publication number: CN106749658B
Application number: CN201611161128.1A
Authority: CN
Inventors: 李森; 杨宇丰
Original assignee: Beijing Normal University
Current assignee: Beijing Normal University
Priority date: 2016-12-15
Filing date: 2016-12-15
Publication date: 2019-11-12
Anticipated expiration: 2036-12-15
Also published as: CN106749658A

Abstract

The invention discloses the anitibody type molecular chaperones for inhibiting the aggregation of Tau albumen.Anitibody type molecular chaperones scFv T1 of the invention can effectively inhibit Tau albumen to assemble, and specificity is strong, high-efficiency low-toxicity, easy-clear in vivo, compared to the monoclonal or polyclonal antibody prepared with conventional method, with humanization, antibody screening is convenient, the advantages that being easy preparation, this single-chain antibody is smaller than common immunoglobulin molecules, more easily expressed in model organism body or in the zooblast of in vitro culture, it can break through blood-brain barrier, toxic side effect is low, it is not easy to cause the immune response of target, it is convenient to carry out cell and the research of animal level and clinical treatment and the application of senile dementia, new direction is provided for the treatment of Alzheimer disease, with the potential using value and good medical application prospect for treating AD.

Description

Inhibit the anitibody type molecular chaperones of Tau albumen aggregation

Technical field

The invention belongs to field of biotechnology, and in particular to inhibit the anitibody type molecular chaperones of Tau albumen aggregation.

Background technique

The research of protein folding is one of study frontier of biology at present, and illustrating for protein folding mechanism will It discloses how one-dimension information in life entity is converted into three-dimensional information, and albumen is determined by the interaction of protein and its ligand The secret of matter function and life process, this is its theory significance.To the research of protein folding, there is also important to answer simultaneously It can trigger disease with value, such as the space structure of protein exception and the misaggregation of protein, these diseases are known as " folding disease ", including the refined Er Shi disease of rabid ox disease, Ke-, senile dementia and parkinsonism etc., understand protein folding and mistake in depth Accidentally fold and aggregation relationship for these disease pathogenesis illustrate and the searching for the treatment of method will be very helpful.

Alzheimer disease (also known as senile dementia) is to threaten a kind of huge disease to the elderly, it is a kind of nerve Degenerative disease and a kind of folding disease, pathological characteristics are mainly shown as extracellular senile plaque and intracellular neurofibrillary Tangle (neurofibrillary tangles, NFT) formation, senile plaque deposition in main component be beta-amyloyd peptide, mind Main component through fibre matting is the Tau albumen (hereinafter referred to as Tau) of abnormal Phosphorylation.Therefore, for Alzheimer disease Treatment site be mainly beta-amyloyd peptide and Tau.Tau is a kind of and the closely related protein of microtubules, and major physiological is made With the aggregation for being promotion micro-pipe and stablize micro-pipe.Under pathological state, the Tau of Tau peroxophosphoric acid, peroxophosphoric acid is solved from micro-pipe From and assemble, be deposited in nerve cell and form aggregation, these aggregations can injured neuron and nerve through a variety of ways Spongiocyte influences cell metabolism, leads to neurotoxicity and nerve retrograde affection.

It mainly include Tau peroxophosphoric acid inhibitor and two class of Tau inhibitors of protein aggregation using Tau as the drug of target spot, it is preceding Person is mainly the inhibitor of related protein kinase, however develop specificity it is strong kinase inhibitor it is extremely difficult, kinase inhibitor Various side effects can be generated, main reason is that a kind of kinase inhibitor can inhibit the activity of a variety of kinases in organism simultaneously. In contrast, exploitation Tau inhibitors of protein aggregation is more more easily, Tau coagulation is prevented using certain means, it is possible to slow Solution or even treatment disease.

In the biomolecule that can be used, antibody is a selection well, its advantage is that specificity is strong, stability Good, immunogenicity and toxicity is controllable, easily prepared or screening, present various therapeutic antibodies are in exploitation in high gear, Prospect is very good.Anitibody type molecular chaperones are that a kind of can have with the antibody of target protein specific bond, the antibody point Sub- chaperone function can inhibit the false folding and coagulation of target protein.The researcher of some foreign countries has found anti-one after another in recent years Body can have the function of molecular chaperones.

Summary of the invention

The technical problem to be solved by the present invention is to how inhibit the aggregation of Tau albumen.

In order to solve the above-mentioned technical problem, present invention firstly provides a kind of single-chain antibodies.

Single-chain antibody provided by the invention includes heavy chain variable region and light chain variable region,

The amino acid sequence of the light chain variable region is following (1) or (2):

(1) amino acid sequence shown in sequence 3 23-133；

(2) by amino acid sequence shown in sequence 3 23-133 by the substitution of one or several amino acid residues and/ Or the amino acid sequence with the same function that deletion and/or addition obtains；

The amino acid sequence of the heavy chain variable region is following (3) or (4):

(3) amino acid sequence shown in sequence 3 155-273；

(4) amino acid sequence shown in sequence 3 155-273 is passed through to the substitution of one or several amino acid residues And/or the amino acid sequence with the same function that deletion and/or addition obtains.

In above-mentioned single-chain antibody,

The amino acid sequence of the single-chain antibody is following (5) or (6):

(5) amino acid sequence shown in sequence 3；

(6) by amino acid sequence shown in sequence 3 by one or several amino acid residues substitution and/or missing and/ Or the amino acid sequence with the same function that addition obtains.

In order to solve the above-mentioned technical problem, invention further provides biomaterial relevant to above-mentioned single-chain antibody,

Biomaterial relevant to above-mentioned single-chain antibody provided by the invention is following A or B or C:

A, following A 1) any one of to A12):

A1 the nucleic acid molecules of above-mentioned light chain variable region) are encoded；

A2) contain A1) expression cassettes of the nucleic acid molecules；

A3) contain A1) recombinant vectors of the nucleic acid molecules；

A4) contain A2) recombinant vector of the expression cassette；

A5) contain A1) recombinant microorganisms of the nucleic acid molecules；

A6) contain A2) recombinant microorganism of the expression cassette；

A7) contain A3) recombinant microorganism of the recombinant vector；

A8) contain A4) recombinant microorganism of the recombinant vector；

A9) contain A1) the transgenic plant cells systems of the nucleic acid molecules；

A10) contain A2) the transgenic plant cells system of the expression cassette；

A11) contain A3) the transgenic plant cells system of the recombinant vector；

A12) contain A4) the transgenic plant cells system of the recombinant vector；

B, following B1) any one of to B12):

B1 the nucleic acid molecules of above-mentioned heavy chain variable region) are encoded；

B2) contain B1) expression cassettes of the nucleic acid molecules；

B3) contain B1) recombinant vectors of the nucleic acid molecules；

B4) contain B2) recombinant vector of the expression cassette；

B5) contain B1) recombinant microorganisms of the nucleic acid molecules；

B6) contain B2) recombinant microorganism of the expression cassette；

B7) contain B3) recombinant microorganism of the recombinant vector；

B8) contain B4) recombinant microorganism of the recombinant vector；

B9) contain B1) the transgenic plant cells systems of the nucleic acid molecules；

B10) contain B2) the transgenic plant cells system of the expression cassette；

B11) contain B3) the transgenic plant cells system of the recombinant vector；

B12) contain B4) the transgenic plant cells system of the recombinant vector；

C, following C1) any one of to C12):

C1 the nucleic acid molecules of above-mentioned single-chain antibody) are encoded；

C2) contain C1) expression cassettes of the nucleic acid molecules；

C3) contain C1) recombinant vectors of the nucleic acid molecules；

C4) contain C2) recombinant vector of the expression cassette；

C5) contain C1) recombinant microorganisms of the nucleic acid molecules；

C6) contain C2) recombinant microorganism of the expression cassette；

C7) contain C3) recombinant microorganism of the recombinant vector；

C8) contain C4) recombinant microorganism of the recombinant vector；

C9) contain C1) the transgenic plant cells systems of the nucleic acid molecules；

C10) contain C2) the transgenic plant cells system of the expression cassette；

C11) contain C3) the transgenic plant cells system of the recombinant vector；

C12) contain C4) the transgenic plant cells system of the recombinant vector.

In above-mentioned biomaterial,

The coded sequence of the light chain variable region be following a1)-a3) and shown in gene:

A1) DNA molecular shown in sequence 2 67-399；

A2 the nucleotide sequence) and a1) limited has 75% or 75% or more identity, and encodes above-mentioned light chain variable region CDNA molecule or genomic DNA molecule；

A3) the nucleotide sequence hybridization limited under strict conditions with a1) or a2), and encode above-mentioned light chain variable region CDNA molecule or genomic DNA molecule；

The coded sequence of the heavy chain variable region be following b1)-b3) and shown in gene:

B1) DNA molecular shown in sequence 2 463-819；

B2 the nucleotide sequence) and b1) limited has 75% or 75% or more identity, and encodes above-mentioned heavy chain variable region CDNA molecule or genomic DNA molecule；

B3) the nucleotide sequence hybridization limited under strict conditions with b1) or b2), and encode above-mentioned heavy chain variable region CDNA molecule or genomic DNA molecule；

The coded sequence of the single-chain antibody be following c1)-c3) and shown in gene:

C1) DNA molecular shown in sequence 2；

C2 the nucleotide sequence) and c1) limited has 75% or 75% or more identity, and encodes above-mentioned single-chain antibody CDNA molecule or genomic DNA molecule；

C3) the nucleotide sequence hybridization limited under strict conditions with c1) or c2), and encode above-mentioned single-chain antibody CDNA molecule or genomic DNA molecule.

In order to solve the above-mentioned technical problem, the present invention also provides the derivatives of above-mentioned single-chain antibody.

The derivative of above-mentioned single-chain antibody provided by the invention be following X) Y) or Z):

X) contain the fusion antibody of above-mentioned single-chain antibody；

Y) contain the Fab of above-mentioned heavy chain variable region and above-mentioned light chain variable region；

Z) contain the complete antibody of above-mentioned heavy chain variable region and above-mentioned light chain variable region.

In order to solve the above-mentioned technical problem, the present invention also provides the new applications of above-mentioned single-chain antibody.

The present invention provides above-mentioned single-chain antibodies as the application in molecular chaperones.

In order to solve the above-mentioned technical problem, the present invention also provides above-mentioned single-chain antibody or above-mentioned biomaterial or above-mentioned spread out The new application of biology.

The present invention provides above-mentioned single-chain antibodies or above-mentioned biomaterial or said derivative to appoint in following (m1)-(m6) A kind of application in:

(m1) inhibit the aggregation of Tau albumen；

(m2) preparation inhibits the product of the aggregation of Tau albumen；

(m3) inhibit or reduce cytotoxicity caused by Tau albumen is assembled；

(m4) product of cytotoxicity caused by preparation inhibits or reduce Tau albumen to assemble；

(m5) treat or assist in the treatment of Alzheimer disease；

(m6) product of preparation treatment or adjuvant treatment Alzheimer disease.

In above-mentioned application, the Tau albumen is the Tau albumen of phosphorylation.

In order to solve the above-mentioned technical problem, the present invention finally provides a kind of product.

The active constituent of product provided by the invention is above-mentioned single-chain antibody or above-mentioned biomaterial or said derivative；

The function of the product is any in following (m1)-(m6):

(m1) inhibit the aggregation of Tau albumen；

(m2) preparation inhibits the product of the aggregation of Tau albumen；

(m3) inhibit or reduce cytotoxicity caused by Tau albumen is assembled；

(m5) treat or assist in the treatment of Alzheimer disease；

(m6) product of preparation treatment or adjuvant treatment Alzheimer disease.

In the said goods, the Tau albumen is the Tau albumen of phosphorylation.

The present invention is using phosphorylated Tau protein as antigen, and using the Large human naive scFv phage library of large capacity, screening is had Chaperone function, inhibit phosphorylation Tau aggregation scFv single-chain antibody, and further by vitro with experiment in vivo study antibody with The interaction and its molecular mechanism of Tau provides new foundation and breach for the treatment of Alzheimer disease.Experiments have shown that: Either in weak solution or crowded environment, phosphorylated Tau protein aggregation is all can be effectively suppressed in scFv T1；Building is total to In the transgenic fly for expressing hTauR406W (a kind of highly toxic Tau mutant) and scFv T1, the list of hTauR406W is found Solely expression can make the coarse deformation of the eyes of drosophila, the coexpression of hTauR406W and scFv T1 can be effectively suppressed hTauR406W pairs The toxicity of drosophila eyes further demonstrates that scFv T1 in vivo and also can be effectively suppressed that Tau albumen is assembled and reduces its poison Property.Show that anitibody type molecular chaperones scFv T1 of the invention can be with by the result of study of above-mentioned experiment in vitro and experiment in vivo Effectively inhibit the aggregation of Tau albumen, and specificity is strong, high-efficiency low-toxicity, in vivo easy-clear, compared to the list prepared with conventional method Clone or polyclonal antibody have many advantages, such as that humanization, antibody screening are convenient, are easy preparation, and this single-chain antibody is than common Immunoglobulin molecules are smaller, are easier express in model organism body or in the zooblast of in vitro culture, can break through blood Brain barrier, toxic side effect are low, are not easy to cause the immune response of target, it is convenient to carry out cell and animal level research and Ah The clinical treatment of Alzheimer's disease and application provide new direction for the treatment of Alzheimer disease, have for treat Ah The potential using value of Alzheimer's disease and good medical application prospect.

Detailed description of the invention

Fig. 1 is that SDS-PAGE detects Tau separation and purification of protein effect.Wherein, 1 swimming lane is protein marker, and 2 swimming lanes are Bacterial protein, 3 swimming lanes are that ultrasonication is centrifuged supernatant, and 4 swimming lanes are that supernatant is centrifuged after albumen boils, and 5 swimming lanes are to penetrate peak, 6 Swimming lane is the miscellaneous liquid eluting peak of washing of the imidazoles containing 10mM, and 7 swimming lanes are the phosphate buffer eluting peak of the imidazoles containing 40mM, 8-10 swimming lane For the phosphate buffer eluting peak of the imidazoles containing 100mM.

Fig. 2 is that Western Blotting identifies Tau phosphorylation events.Wherein, left side (1) is the Tau albumen of phosphorylation, Right side (2) is the Tau albumen of non-phosphorylating.

Fig. 3 is that single-chain antibody scFv T1 isolates and purifies result.Wherein, 1 swimming lane is protein marker, and 2 swimming lanes are scFv T1 culture medium supernatant holoprotein, 3 swimming lanes are to penetrate sample, and 4 swimming lanes are the elution samples of 10mM imidazoles, and 5 swimming lanes are 40mM imidazoles Elution samples, 6-9 swimming lane be 100mM imidazoles elution samples.

Fig. 4 is the combination that Western Blotting method identifies single-chain antibody scFv T1 and phosphorylation Tau.Wherein, left side For Marker, right side is phosphorylation Tau+scFv T1.

Fig. 5 is the influence that three kinds of single-chain antibodies assemble phosphorylation Tau.Wherein, 1:(control group, ■ are organized), organize 2:(scFv T1,), 3:(scFv T2 is organized, ●), 4:(scFv T3 is organized, ▲), the concentration of single-chain antibody and phosphorylation Tau are 5 μM.

The influence that Fig. 6 is the single-chain antibody scFv T1 of various concentration and reference protein assembles phosphorylation Tau.Wherein, The concentration of scFv T1 is 1.25 μM (●), 2.5 μM (▲), 5 μM respectivelyWith 10 μM (◆), Tris-HCl control: (■), BSA control:ScFv A4 control: (Δ), the concentration of phosphorylation Tau, BSA and scFv A4 are 5 μM.

Fig. 7 is to detect the influence that single-chain antibody T1 assembles phosphorylated Tau protein with transmission electron microscope method.Wherein, A: System without single-chain antibody T1；B: the system containing 10 μM of single-chain antibody T1.The concentration of phosphorylated Tau protein is 5 μM.

Fig. 8 is the influence that the scFv T1 for detecting various concentration with SDS-PAGE method assembles phosphorylated Tau protein. Wherein, from left to right, the concentration of scFv T1 is 0 μM (1), 1.25 μM (2), 2.5 μM (3), 5 μM (4) and 10 μM (5) respectively.Phosphorus The concentration for being acidified Tau albumen is 5 μM.

Fig. 9 is the influence that the scFv T1 of various concentration assembles phosphorylation Tau in crowded environment.Wherein, scFv T1 Concentration is 1.25 μM (●), 2.5 μM respectively5μMWith 10 μM (◆), Tris-HCl control be (■), phosphorylation Tau Concentration be 5 μM.

Figure 10 is to be detected in crowded environment with transmission electron microscope method, and scFv T1 makees the influence that phosphorylated Tau protein is assembled With.Wherein, A: the system without scFv T1；B: the system containing 10 μM of scFv T1.The concentration of phosphorylation Tau is 5 μM.

Figure 11 is influence of the single-chain antibody scFv T1 to phosphorylated Tau protein conformation change of various concentration.Its In, the concentration of scFv T1 is 1.25 μM (●), 2.5 μM respectively5μMWith 10 μM (◆), Tris-HCl control is (■), the concentration of phosphorylated Tau protein are 5 μM.

Figure 12 is influence of the coexpression to Tau mutant (hTauR406W) cytotoxicity of single-chain antibody.Wherein, A: the drosophila w of hTauR406W is not expressed^l118(it is purchased from indiana ,US university Bloomington drosophila strains library center, is produced Product catalog number (Cat.No.) 3605)；B: the transgenic drosophila model of single expression hTauR406W；C: the drosophila of coexpression hTauR406W and scFv T1 Model.♀ represents female Drosophila, and ♂ represents Male Drosophila.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.

Embodiment 1, Tau albumen prokaryotic expression with isolate and purify

One, the prokaryotic expression of Tau albumen with isolate and purify

1, pET21a-Tau plasmid is constructed

PCR amplification is carried out by template of pGEX-6p-1-Tau plasmid, obtains PCR product, i.e. Tau genetic fragment；Utilize limit Property restriction endonuclease Nde I and Xho I processed carries out double digestion to PCR product and pET21a plasmid respectively, the Tau base after respectively obtaining digestion Cause and pET21a plasmid backbone carrier；Tau gene and pET21a plasmid backbone carrier after connecting digestion, obtain pET21a-Tau Plasmid simultaneously carries out sequence verification to it.

Sequencing result shows: pET21a-Tau plasmid is (to be purchased from the insertion pET21a plasmid of DNA fragmentation shown in sequence 1 Merck Millipore, catalog number 69740-3CN) Nde I and Xho I restriction enzyme site between, and keep pET21a plasmid The constant obtained plasmid of other sequences.

2, recombinant bacterium is constructed

PET21a-Tau plasmid conversion e. coli bl21 (DE 3) competent cell that step 1 is constructed is (purchased from middle section Rui Tai Biotechnology Co., Ltd, catalog number RTX304-03) in, obtain recombinant bacterium pET21a-Tau/BL21.

3, the inducing expression of recombinant bacterium

In LB liquid medium of the single colonie access containing 50 μ g/mL Amp of picking recombinant bacterium pET21a-Tau/BL21, in 200rpm shaken cultivation at 37 DEG C, until OD₆₀₀Value reaches 0.6 or so, is added IPTG (final concentration 0.5mM), 16 DEG C of inducing expressions 16 A hour.After induction, supernatant is abandoned in centrifugation, collects thallus；By ultrasonic disruption, (ultrasonic 3s is spaced 15s, power 600W, ultrasound 60 times) after, centrifugation, collecting supernatant is the crude extract containing destination protein Tau albumen.

4, the purifying of Tau albumen

The crude extract of Tau albumen is purified, Tau protein solution after purification is obtained.Specific step is as follows:

(1) crude extract of Tau albumen is denaturalized first using following thermal denaturation method: heats 30 points at 100 DEG C Clock, 12000rpm are centrifuged 30 minutes, collect supernatant.

(2) Ni medium affinity chromatography is carried out to supernatant, the chromatographic column used is that HisTrap FF (is purchased from GE Healthcare Life Sciences, catalog number 17-5255-01), concrete operations are as follows:

1. connecting purification system (constant flow pump-Ni affinity column-Ultraviolet Detector-collector)；

2. balance: balancing about 5 column volumes of chromatographic column with the phosphate buffer (pH7.5) of the imidazoles containing 10mM, and will be purple Outer detector registration is set to zero；

3. loading: the supernatant of access albumen containing Tau, and collect and penetrate peak；

4. washing miscellaneous: being washed with the phosphate buffer of the imidazoles containing 10mM miscellaneous to Ultraviolet Detector registration close to zero, collection is washed miscellaneous Liquid；

5. elution: eluting destination protein with the phosphate buffer containing 40mM and 100mM imidazoles respectively, collect eluting peak；

6. carrying out SDS-PAGE electrophoresis detection to penetrating peak, washing the sample in miscellaneous liquid and eluting peak.

The result of electrophoresis detection is as shown in Figure 1: through analyzing it is found that thermal denaturation can remove most of foreign proteins, affinity chromatography In experiment, 5 swimming lanes penetrate the albumen to get off all and are the foreign protein except purpose band, illustrate that medium bearing capacity is preferable.6 swimming lanes have Fewer miscellaneous band occurs, and illustrates that the foreign protein of some doping in the medium can be eluted by the PBS of 10mM imidazoles, 7 swimming The phosphate buffer of the imidazoles containing 40mM can elute part Tau albumen in road, and 8-10 swimming lane is imidazoles containing 100mM Phosphate buffer eluting peak, the phosphate buffer of the imidazoles containing 100mM can get off nearly all Tau albumen wash-out, And purity of protein is relatively high, can be used for subsequent experimental after being concentrated by ultrafiltration.

According to electrophoresis detection as a result, merging the elution samples of the phosphate buffer of the imidazoles containing 100mM, with 10mM Tris- HCl buffer (pH 7.5) dialysed overnight, is concentrated with super filter tube, obtains Tau protein solution after purification.With Coomassie brilliant blue G- The concentration of the Tau protein solution of 250 methods measurement after purification is 26 μM.

Two, Tau protein phosphorylation and its verifying

1, Tau protein phosphorylation

The Tau for selecting GSK-3 β (being purchased from New England BioLabs, catalog number P6040L) to obtain step 1 Albumen carries out phosphorylation, obtains the Tau albumen of phosphorylation.Phosphorylation is as follows: according to GSK-3 β specification, by Tau albumen (the Tau albumen after purification that step 1 obtains), GSK-3 β, ATP, MgCl₂, DTT and Tris-HCl (pH7.5) mix, obtain Phosphorylation system (200 μ l), concentration of each component in phosphorylation system are 20 μM of Tau albumen, 500U GSK-3 β, 10mM Tris-HCl, 2mM ATP, 10mM MgCl₂, 1mM DTT.By phosphorylation system phosphatizing treatment 20 hours under the conditions of 30 DEG C, Then 95 DEG C of processing termination in 5 minutes reactions, obtain the Tau albumen of phosphorylation.

2, phosphorylation state is verified

Thermo Fischer Scientific, product mesh (are purchased from using source of mouse Tau (Phospho-ser396) antibody Record 44-752G) and AP- sheep anti mouse secondary antibody (being purchased from Sigma-aldrich, catalog number A3562) progress Western The phosphorylation of Blotting verifying Tau albumen.Experimental procedure is as follows:

1. electrophoresis: take phosphorylation Tau protein sample and non-phosphorylating Tau albumen (step 1 obtain after purification Tau albumen) carry out SDS-PAGE electrophoresis；

2. balance: the gel cut and filter paper are put into transferring film buffer and balanced 30 minutes, meanwhile, use methyl alcohol process The pvdf membrane big with gel etc. 2 minutes, is immediately transferred in transferring film buffer and balances；

3. transferring film: it is solidifying that dry type membrane-transferring device is followed successively by 3 layers of filter paper-pvdf membrane-albumen of carbon anode plate-from top to bottom 3 layers of filter paper of glue-- cathode carbon plate, constant current 200mA-1.5 hours；

4. closing: cleaning pvdf membrane with 0.01M phosphate buffer, 5 minutes × 4 times, closed with 5% skimmed milk power, 37 It is placed 1 hour in DEG C incubator；

5. being incubated for primary antibody: phosphate buffer cleans 5 minutes × 4 times, and Tau (Phospho- is added in 1:2000 ratio Ser396) antibody, 37 DEG C -60rpm-1 hours；

6. being incubated for secondary antibody: phosphate buffer cleans 5 minutes × 4 times, and AP- sheep anti mouse secondary antibody is added in 1:5000 ratio, 37 DEG C -60rpm-1 hours；

7. colour developing: phosphate buffer cleans pvdf membrane, is put into developing solution and develops the color.

Western Blotting qualification result is as shown in Figure 2: the experimental results showed that, only the Tau albumen of phosphorylation is known Not, the Tau albumen of non-phosphorylating is unrecognized, thus can verify that the Tau albumen in the Tau albumen of phosphorylation is phosphorylation shape State.

Embodiment 2, single-chain antibody preparation with isolate and purify

One, the screening and identification of phage antibody

1, the screening of phage antibody

Using the Tau albumen of the phosphorylation prepared in embodiment 1 as antigen, using the Large human naive scFv phage library of large capacity, Screening obtains the scFv single-chain antibody with chaperone function, the Tau albumen aggregation for inhibiting phosphorylation.Specific step is as follows:

(1) be coated with: with the immune pipe of the Tau albumen of the phosphorylation prepared in embodiment 1 coating, 4 DEG C overnight；

(2) it closes: being closed 1 hour with 30g/L skimmed milk power；

(3) it is incubated for: being washed twice with the phosphate buffer containing 0.05%Tween-20,1mL phage antibody library is added (preparation of commission Navy General Hospital center experiment section, titre are 3 × 10¹³CFU/mL), it is incubated for 2 hours for 37 DEG C；

(4) wash miscellaneous: unbonded phage antibody is removed in washing repeatedly；

(5) it elutes: the XL1-Blue bacterium of fresh cultured is added (purchased from Beijing Hua Yue ocean biology, catalog number GX123- 100) direct infection is carried out, 37 DEG C are incubated for 15 minutes, are transferred to SB culture solution, are added in bacterium infection immune pipe after the recovery 1mL eluent (0.1M HCL, 0.1%BSA, pH2.2), 37 DEG C stand 15 minutes, are neutralized to neutrality with 2M Tris, 2mL is added XL1-Blue bacterium, 37 DEG C are incubated for 15 minutes, are transferred to SB culture solution；

(6) spread cultivation and induce: 37 DEG C spread cultivation 3 hours, and 2ml helper phage VCSM13 is added and (is purchased from Agilent Technologies, catalog number 200251), 30 DEG C of overnight inductions；

(7) collect: supernatant be collected by centrifugation, be added appropriate PEG8000 (purchased from the green skies, catalog number ST483) and NaCl saltouts, centrifugation, removes supernatant, and precipitating, centrifugation removal of impurities is resuspended in the 1%BSA preheated with 37 DEG C；

(8) it screens again: the re-suspension liquid being collected into being rejoined into elutriation again in the immune pipe of coating, carries out 4 in total Wheel is filtered out in conjunction with stronger specific bacteriophage antibody.

From picking 200 clones on the 3rd wheel and the 4th wheel disc, VCSM13 helper phage is added and (is purchased from Agilent Technologies, catalog number 200251), the phage antibody in supernatant is collected in 30 DEG C of overnight incubations, centrifugation, is reflected It is fixed.

2, the identification of phage antibody

(1) ELISA experimental identification

1. coating: the Tau albumen of phosphorylation being diluted to 50 μ g/mL, is coated with elisa plate, 37 DEG C are incubated for 1 hour；

2. closing: PBS washing is closed 1 hour with 5% skimmed milk power；

3. being incubated for: the phage antibody of collection is added, 37 DEG C are incubated for 1 hour, are then incubated for the anti-M13 mouse mAb of HRP- and (are purchased from Sino Biological, catalog number 11973-MM05-50)；

4. colour developing: the colour developing of OPD substrate is added in phosphate buffer washing, and microplate reader reads A490 value.

ELISA testing result shows that the single-chain antibody for having 27 clones to show in 200 clones can specifically bind phosphoric acid The Tau albumen of change.

(2) DNA fingerprint is identified

Being identified in 27 clones using DNA fingerprint whether there is identical gene.Specific step is as follows: it is anti-to select ELISA Answering good sample is template, carries out PCR amplification using primer 1 and primer 2, obtains PCR product.

Primer 1:AATTCTATTTCAAGGAGACAGTCATA；

Primer 2: TAAACAACTTTCAACAGTAGCGGCCGC.

Reaction system (50 μ l) is as follows: 2 μ l of template DNA, 1 0.6 μ l of primer, 0.6 μ l of primer 2,10 × buffer, 3 μ l、Mg²⁺1.8 μ l, 1.8 dNTP μ l, 0.3 μ l of Taq enzyme, ddH₂O 19.9μl.Response procedures are as follows: 94 DEG C of initial denaturations 60 seconds → 94 DEG C denaturation 40 seconds → 56 DEG C annealing 40 seconds → 72 DEG C extend 1 minute → 30 circulation → 72 DEG C 7 minutes → 4 DEG C heat preservation.

Restriction enzyme Mva is added with CL-6B gel micro-column centrifugal purification PCR product, then with the volume ratio of 1:10 I digests 2 hours under the conditions of 37 DEG C, obtains digestion product.It takes 10 μ l digestion products to carry out PAGE electrophoresis, passes through after EB dyeing Comparing banding pattern, to judge whether 27 clones have mutually homogenic, and the identical sample of DNA fingerprint is classified as one kind.

Analysis can respectively correspond 7 kinds of antibody genes, namely sieve the results show that 27 samples have 7 kinds of different maps altogether Select the phage antibody in conjunction with 7 kinds of Tau protein-specifics with phosphorylation.

With above-mentioned 7 kinds of phage antibodies infection HB2151 bacterium with different finger-prints (purchased from general such as spit of fland biotechnology Co., Ltd, catalog number 610036), after as a result having 3 phage-infect HB2151 bacterium, the solubility expression of single-chain antibody It is positive, the single-chain antibody expressed respectively is denoted as scFV T1, scFV T2 and scFV T3.

Two, it the preparation of soluble single-chain antibody and isolates and purifies

1, the preparation of soluble single-chain antibody

(1) respectively by identified single-chain antibody scFV T1, scFV T2 in 20 μ l step 1 and scFV T3 is corresponding bites Thallus and the HB2151 bacterium solution of 1ml fresh cultured mix gently, and 37 DEG C are placed 15 minutes, and scribing line is incubated overnight.

(2) from picking single colonie on LB plate, 37 DEG C of overnight small trainings spread cultivation left to OD value 0.6 in the ratio of 1:100 The right side, adjusting temperature is 30 DEG C, the expression of 1mM IPTG induction of antibodies, induction time 16 hours.Collect bacterium solution, 6000rpm centrifugation 20 Minute, supernatant is taken, contains soluble single-chain antibody scFV T1, scFV T2 and scFV T3 respectively in supernatant.

2, soluble single-chain antibody isolates and purifies

The solution containing soluble single-chain antibody scFV T1, scFV T2 and scFV T3 is purified respectively, respectively Single-chain antibody scFV T3 to single-chain antibody scFV T1 after purification, single-chain antibody scFV T2 after purification and after purification.Tool Steps are as follows for body:

(1) ammonium sulfate precipitation destination protein

It is 60% that supernatant, which is slowly added to ammonium sulfate to saturated concentration, respectively, is sufficiently stirred and makes it dissolve, and 4 DEG C stand 1 Hour, it is centrifuged 20 minutes, retains precipitating.

(2) albumen weighs molten and dialysis desalination

Albumen precipitation is re-dissolved with 10mM Tris-HCl (pH 7.5) buffer, centrifuging and taking supernatant is stayed overnight with bag filter Dialysis removes excessive ammonium sulfate in protein solution.

(3) His-Trap affinity column chromatography

1. connecting protein purification system, and balanced with the 10mM Tris-HCl buffer of the imidazoles containing 10mM, adjusts baseline；

2. the sample after dialysis treatment is accessed protein purification system, washed with equilibrium liquid miscellaneous to baseline, and collects and wash miscellaneous liquid；

3. being eluted respectively with the 10mM Tris-HCl buffer containing 40mM and 100mM imidazoles, corresponding eluting peak is collected, Carry out SDS-PAGE electrophoretic analysis.

Electrophoresis result shows most of foreign proteins not in conjunction with affinity column, by under low concentration imidazoles (being less than 40mM) elution What is come is almost foreign protein entirely, and destination protein can be eluted by 100mM imidazoles, and the purity of elution samples is higher, because This collects 100mM imidazoles elution samples, with 10mM Tris-HCl buffer dialysed overnight, is concentrated by ultrafiltration, respectively obtains after purification Single-chain antibody scFV T1, single-chain antibody scFV T2 after purification and single-chain antibody scFV T3 after purification, be used for subsequent reality It tests.SDS-PAGE electrophoretic analysis result such as Fig. 3 that wherein each sample that the purification process of single-chain antibody scFV T1 obtains is carried out It is shown.

Concentration with the single-chain antibody scFV T1 of Coomassie brilliant G-250 method measurement after purification is 24.3 μM, after purification The concentration of single-chain antibody scFV T2 is 20.1 μM, and the concentration of single-chain antibody scFV T3 after purification is 15.9 μM.

Three, the binding ability of single-chain antibody and the Tau albumen of phosphorylation detects

1, Western Blotting method verifies scFv T1

1. electrophoresis: single-chain antibody scFV T1 solution example after purification being taken to carry out SDS-PAGE electrophoresis；

5. being incubated for antibody: phosphate buffer cleans 5 minutes × 4 times, and the enzyme-linked of anti-V5 label is added in 1:2000 ratio (anti-V5-HRP antibody is purchased from Thermo Fisher Scientific Inc., catalog number to antibody R96125), 37 DEG C -60rpm-1 hours；

6. colour developing: phosphate buffer cleans pvdf membrane, is put into developing solution and develops the color.

Western Blotting testing result shows that single-chain antibody sample prepared by the present invention can be by the anti-of anti-V5 label Body identification, therefore can be used whether the Identification of the antibodies single-chain antibody of anti-V5 label combines the Tau albumen of phosphorylation.

2, with the binding ability of the Tau albumen of phosphorylation

(1) ELISA method

Detect three kinds of single-chain antibody scFv T1, scFv T2 and scFv T3 and phosphorylation after purification respectively with ELISA method Tau albumen binding ability, using anti-V5 label enzyme-linked antibody (anti-V5-HRP antibody) identification can be with phosphoric acid The protein bound single-chain antibody of the Tau of change, and using Ovalbumin, Pepsin and BSA albumen as negative control.

ELISA testing result show step 1 screen and three kinds of single-chain antibody scFv T1, scFv T2 purifying and ScFv T3 can be in conjunction with the Tau albumen of phosphorylation, and wherein the binding ability of scFv T1 and the Tau albumen of phosphorylation is most strong, Three kinds of single-chain antibody scFv T1, scFv T2 and scFv T3 be not combined as Ovalbumin, Pepsin of negative control with BSA albumen illustrates the identification and knot of these three single-chain antibodies scFv T1, scFv T2 and scFv T3 to the Tau albumen of phosphorylation Closing has specificity.

(2) Western Blotting method

1. electrophoresis: the Tau protein sample of phosphorylation being taken to carry out SDS-PAGE electrophoresis；

5. being incubated for scFv T1: phosphate buffer cleans 5 minutes × 4 times, is added in Tau:scFv T1=1:1 ratio pure Single-chain antibody scFV T1 after change, 37 DEG C -60rpm-1 hours；

6. being incubated for anti-V5 tag antibody: phosphate buffer cleans 5 minutes × 4 times, and anti-V5 is added in 1:2000 ratio and marks Label enzyme-linked antibody (anti-V5-HRP antibody), 37 DEG C -60rpm-1 hours；

Western Blotting testing result is as shown in Figure 4.It can be seen from the figure that single-chain antibody scFv T1 can be special The opposite sex combines the Tau albumen of phosphorylation.

Four, the sequence analysis of single-chain antibody scFv T1

Through sequencing analysis, the amino acid sequence of single-chain antibody scFv T1 is sequence 3, and coding gene sequence is sequence 2, Wherein, the amino acid sequence of the light chain variable region of single-chain antibody scFv T1 is sequence 3 23-133, the volume of light chain variable region Code gene order is sequence 2 67-399；The amino acid sequence of the heavy chain variable region of single-chain antibody scFv T1 is sequence 3 the 155-273, the coding gene sequence of heavy chain variable region is sequence 2 463-819.

The influence of embodiment 3, single-chain antibody scFv to the Tau albumen aggregation of phosphorylation

One, effect of the scFv to the Tau albumen aggregation of phosphorylation in weak solution

1, effect of the different scFv to the Tau albumen aggregation of phosphorylation

It is divided into the work of Tau albumen aggregation of the following each group research single-chain antibody to phosphorylation according to the difference of single-chain antibody With:

1 (control) of group: Tau albumen (preparing in embodiment 1, final concentration of 5 μM), the heparin of phosphorylation (are purchased from Sigma-Aldrich, catalog number H3149, final concentration of 1.25 μM), DTT (be purchased from Sigma-Aldrich, catalogue Number D0632, final concentration of 1mM) and Tris-HCl buffer (10mM, pH7.5) mix, 37 DEG C of incubations are used in different moments The aggregation situation of ThT Fluorometric assay phosphorylated Tau protein；

2 (scFv T1) of group: by scFv T1 (sample after purification, 5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubation different times, ThT method detects Tau albumen Aggregation situation；

3 (scFv T2) of group: by scFv T2 (sample after purification, 5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubation different times, ThT method detects Tau albumen Aggregation situation；

4 (scFv T3) of group: by scFv T3 (sample after purification, 5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubation different times, ThT method detects Tau albumen Aggregation situation.

Specific step is as follows for ThT Fluorometric assay: by ThT, (Thioflavin T is purchased from Sigma-Aldrich, product Catalog number (Cat.No.) T3516) solid powder is dissolved in 10mM Tris-HCl (pH 7.5) buffer, prepare 2.5mM liquid storage.Tau aggregation starts Afterwards, 20 μ l Tau samples are taken at regular intervals, 980 μ l thioflavin T solution are added, and are uniformly mixed, are utilized fluorescence spectrophotometry Count fluorescence intensity.Fluorescence detection condition: exciting light 440nm emits light 480nm, gap 5nm.Testing result processing mode: Take fluorescence intensity at fluorescence emission spectrum 480nm m- fluorescence intensity change curve when drawing.

As a result as shown in Figure 5.In three kinds of different single-chain antibodies, single-chain antibody scFv T1 is poly- to the Tau albumen of phosphorylation Collection significantly inhibits.

2, the effect that the ratio of Tau albumen-scFv and other albumen assemble phosphorylated Tau protein

It is divided into following each group research single-chain antibody scFv T1 to phosphorylation according to the ratio difference of Tau albumen and scFv T1 The effect of Tau albumen aggregation:

1 (control) of group: by the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, 37 DEG C of incubation different times, and ThT method detects the aggregation situation of Tau albumen；

2 (1.25 μM) of group: by scFv T1 (sample after purification, 1.25 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubation different times, ThT method detects Tau albumen Aggregation situation；

3 (2.5 μM) of group: by scFv T1 (sample after purification, 2.5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubation different times, ThT method detects Tau albumen Aggregation situation；

4 (5 μM) of group: by scFv T1 (sample after purification, 5 μM), Tau albumen (5 μM), heparin (1.25 μ of phosphorylation M), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, 37 DEG C of incubation different times, and ThT method detects the aggregation of Tau albumen Situation；

5 (10 μM) of group: by scFv T1 (sample after purification, 10 μM), Tau albumen (5 μM), the heparin (1.25 of phosphorylation μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) mix, 37 DEG C of incubations different times, ThT method detects gathering for Tau albumen Collect situation；

6 (BSA) of group: by BSA (5 μM), the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris- HCl (10mM, pH7.5) is mixed, 37 DEG C of incubation different times, and ThT method detects the aggregation situation of Tau albumen；

7 (scFv A4) of group: by scFv A4 (for the single-chain antibody that human-machine coupling filters out, document " Li S, Sun C,Teng N,Yang W,Zhou L,Zhang Y.Chaperone-like effects of a scFv antibody on the folding of human muscle creatine kinase.Protein Eng Des Sel.2013,26 (8): being disclosed in 523-531. ") (5 μM), the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris- HCl (10mM, pH7.5) is mixed, 37 DEG C of incubation different times, and ThT method detects the aggregation situation of Tau albumen.

As a result as shown in Figure 6: single-chain antibody scFv T1 concentration is bigger, and depression effect is more obvious, and in the Tau of phosphorylation Depression effect is most obvious when the molar ratio of albumen and single-chain antibody scFv T1 is 1:2.As control, Tau of the BSA to phosphorylation The inhibiting effect of albumen is unobvious, and the single-chain antibody A4 molecule with structure similar to single-chain antibody scFv T1 is to phosphorylation Tau albumen is assembled equally without influence.Thus infer the specific of depression effect and its antigen-binding site of single-chain antibody scFv T1 Structure is related, single-chain antibody scFv T1 by alleviating the generation of its clustering phenomena in conjunction with the Tau protein-specific of phosphorylation, Illustrate that single-chain antibody of the invention has the function of molecular chaperones.

3, the influence that transmission electron microscope (TEM) method research single-chain antibody scFv T1 assembles Tau albumen

The influence that Tau albumen is assembled using transmission electron microscope (TEM) method research single-chain antibody scFv T1, according to being No addition single-chain antibody scFv T1, is divided into following two groups:

1 (control) of group: by the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, and 37 DEG C are incubated for 2 hours, using the aggregation situation of transmission electron microscope method detection Tau albumen；

2 (scFv T1) of group: by scFv T1 (sample after purification, 10 μM), phosphorylation Tau (5 μM), heparin (1.25 μ M), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, and 37 DEG C are incubated for 2 hours, detects Tau albumen using transmission electron microscope method Aggregation situation.

Transmission electron microscope method includes the following steps: to handle sample using background stain, by appropriate protein sample drop in It on the copper mesh of transmission electron microscope detection, sets and is placed at room temperature for 2 minutes, washed 2 times with water logging, contaminated with the acetic acid uranium that volume fraction is 2% Liquid dyes 2 minutes, dries, is observed with H-7650B transmission electron microscope.

As a result as shown in Figure 7.As can be seen from the figure: when single-chain antibody scFv T1 is not added, the Tau albumen of phosphorylation The fibrosis aggregation that can be observed in Electronic Speculum is formd after 2 hours, and the ratio of 1:2 is by the Tau of phosphorylation in molar ratio After albumen and single-chain antibody scFv T1 are mixed, the Tau albumen aggregation extent of phosphorylation is reduced, and is assembled by single-chain antibody ScFv T1 inhibits.

4, the influence that SDS-PAGE method research single-chain antibody scFv T1 assembles phosphorylated Tau protein

The influence that phosphorylated Tau protein is assembled using SDS-PAGE method research single-chain antibody scFv T1, according to list The difference of chain antibody scFv T1 concentration is divided into following each group:

1 (control) of group: by the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, and 37 DEG C are incubated for 2 hours, centrifuging and taking precipitating, using the aggregation feelings of SDS-PAGE method detection Tau albumen Condition；

2 (1.25 μM) of group: by scFv T1 (sample after purification, 1.25 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C are incubated for 2 hours, centrifuging and taking precipitating, using SDS- The aggregation situation of PAGE method detection Tau albumen；

3 (2.5 μM) of group: by scFv T1 (sample after purification, 2.5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C are incubated for 2 hours, centrifuging and taking precipitating, using SDS- The aggregation situation of PAGE method detection Tau albumen；

4 (5 μM) of group: by scFv T1 (sample after purification, 5 μM), Tau albumen (5 μM), heparin (1.25 μ of phosphorylation M), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, and 37 DEG C are incubated for 2 hours, centrifuging and taking precipitating, using SDS-PAGE method Detect the aggregation situation of Tau albumen.

5 (10 μM) of group: by scFv T1 (sample after purification, 10 μM), Tau albumen (5 μM), the heparin (1.25 of phosphorylation μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) mix, 37 DEG C are incubated for 2 hours, centrifuging and taking precipitating, using SDS-PAGE The aggregation situation of method detection Tau albumen.

As a result as shown in Figure 8.As can be seen from the figure: when single-chain antibody scFv T1 is not added, due to assembling, phosphorus The Tau albumen precipitation of acidification is more, and the presence of single-chain antibody scFv T1 can reduce the quantity of phosphorylated Tau protein precipitating, and And as the ratio of single-chain antibody scFv T1 be added is higher and higher, this effect is more and more obvious, and in the Tau of phosphorylation Effect is most obvious when the molar ratio of albumen and single-chain antibody scFv T1 is 1:2.

Two, the effect that scFv assembles phosphorylated Tau protein in crowded environment

Suitable phosphorylated Tau protein-single-chain antibody ratio is set according to above-mentioned experimental result, is added in the reaction system Macromolecular crowding reagent D extran 70 (be purchased from Sigma-Aldrich, catalog number 1179741) to simulate environment intracellular, The Tau albumen of phosphorylation is assembled with single-chain antibody scFv T1 in ThT fluorescence method and transmission electron microscope method detection crowded environment respectively Influence.It is divided into following each group according to the difference of single-chain antibody scFv T1 concentration:

Group 1 (control, 0 μM): by the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM), Dextran70 (final concentration 100mg/mL) and Tris-HCl (10mM, pH7.5) mix, 37 DEG C be incubated for 2 hours, be respectively adopted ThT fluorescence method with The aggregation situation of transmission electron microscope method detection Tau albumen；

2 (1.25 μM) of group: by scFv T1 (sample after purification, 1.25 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM), Dextran 70 (100mg/mL) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubations 2 are small When, using the aggregation situation of ThT Fluorometric assay Tau albumen；

3 (2.5 μM) of group: by scFv T1 (sample after purification, 2.5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM), Dextran 70 (100mg/mL), Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubations 2 are small When, using the aggregation situation of ThT Fluorometric assay Tau albumen；

4 (5 μM) of group: by scFv T1 (sample after purification, 5 μM), Tau albumen (5 μM), heparin (1.25 μ of phosphorylation M), DTT (1mM), Dextran 70 (100mg/mL) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C are incubated for 2 hours, are used The aggregation situation of ThT Fluorometric assay Tau albumen.

5 (10 μM) of group: by scFv T1 (sample after purification, 10 μM), Tau albumen (5 μM), the heparin (1.25 of phosphorylation μM), DTT (1mM), Dextran 70 (100mg/mL) and Tris-HCl (10mM, pH7.5) mix, 37 DEG C are incubated for 2 hours, point Not Cai Yong ThT fluorescence method and transmission electron microscope method detection Tau albumen aggregation situation.

The testing result of ThT fluorescence method is as shown in figure 9, the testing result of transmission electron microscope is as shown in Figure 10.It can be with from figure Find out: in crowded environment, single-chain antibody scFv T1 also can inhibit the formation of Tau protein masses.The result is single-chain antibody In vivo study provide certain basis and foundation.

Three, influence of the single-chain antibody scFv to Tau conformation change

It is divided into following each group research single-chain antibody scFv T1 to Tau conformation according to the difference of single-chain antibody scFv T1 concentration The influence of variation:

1 (control) of group: by the Tau albumen (5 μM) of phosphorylation, heparin (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, 37 DEG C of incubations, using the aggregation situation of ANS Fluorometric assay Tau albumen；

2 (1.25 μM) of group: by scFv T1 (sample after purification, 1.25 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubations, ANS Fluorometric assay Tau albumen gathers Collect situation；

3 (2.5 μM) of group: by scFv T1 (sample after purification, 2.5 μM), Tau albumen (5 μM), the heparin of phosphorylation (1.25 μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) are mixed, and 37 DEG C of incubations, ANS Fluorometric assay Tau albumen gathers Collect situation；

4 (5 μM) of group: by scFv T1 (sample after purification, 5 μM), Tau albumen (5 μM), heparin (1.25 μ of phosphorylation M), DTT (1mM) and Tris-HCl (10mM, pH7.5) is mixed, 37 DEG C of incubations, the aggregation feelings of ANS Fluorometric assay Tau albumen Condition；

5 (10 μM) of group: by scFv T1 (sample after purification, 10 μM), Tau albumen (5 μM), the heparin (1.25 of phosphorylation μM), DTT (1mM) and Tris-HCl (10mM, pH7.5) mix, 37 DEG C of incubations, the aggregation feelings of ANS Fluorometric assay Tau albumen Condition.

The step of above-mentioned ANS Fluorometric assay is as follows: Tau sample takes a small amount of sample after being incubated for different time, with containing The Tris-HCl buffer of 20 μM of ANS dilutes 10 times, monitors fluorescence intensity, excitation with Fluoromax-4 sepectrophotofluorometer Wavelength is set as 380nm, and launch wavelength is set as 480nm.

As a result as shown in figure 11.For the Tau albumen of phosphorylation in accumulation process, conformation generation can be by ANS fluorescence detection The significant changes arrived have more hydrophobic surface exposure, and single-chain antibody scFv T1 can effectively inhibit the variation of Tau protein conformation, And as the ratio of single-chain antibody scFv T1 be added is higher and higher, this effect is more and more obvious, and in phosphorylation Inhibitory effect is most obvious when Tau albumen and the molar ratio of single-chain antibody scFv T1 are 1:2.

The influence of embodiment 4, single-chain antibody scFv T1 to Tau cytotoxicity

The present embodiment studies whether the scFv single-chain antibody that embodiment 2 filters out influences Tau albumen using transgenic drosophila model Aggregation and neurotoxicity in vivo.HTauR406W is a kind of Tau protein mutant, in certain FTDP-17 It can be sent out in (Frontotemporal dementia with parkinsonism linked to chromosome 17) patient These existing mutant, toxicity are more stronger than wild type Tau albumen.GMR-GAL4 belongs to GAL4/UAS binary gene expression system, Drosophila eye tissue can be made specifically to express hTauR406W, drosophila eyes is made the degeneration phenotype that can be observed occur.Based on this Transgenic drosophila model expresses scFv T1 single-chain antibody and hTauR406W simultaneously in its eye using Drosophila genetics recombinant technique, Then the developmental state of filial generation drosophila eyes is detected.

One, the building of drosophila system

GMR-Gal4 and UAS-TauR406W drosophila system are purchased from indiana ,US university Bloomington drosophila strains Library center.Using molecule clone technology and microinjection technique, UAS-scFvT1-FLAG transgenic fly model is constructed；Benefit With genetic cross method, GMR-Gal4 > UAS-TauR406W filial generation drosophila of building expression hTauR406W expresses scFvT1-FLAG GMR-Gal4 > UAS-scFvT1-FLAG filial generation drosophila, and coexpression hTauR406W and scFvT1-FLAG GMR-Gal4 > UAS-TauR406W, UAS-scFvT1-FLAG filial generation drosophila.Specific step is as follows:

1, the building of UAS-scFvT1-FLAG drosophila strains

1. scFvT1-FLAG DNA fragmentation shown in sequence 4 is cloned into pUAST- using DNA recombinant technique { miniWhite } vector plasmid (is purchased from Drosophila Genomics Resource Center, catalog number 1000), DNA sequencing verifying molecular cloning constructs successfully, obtains pUAST-scFvT1-FLAG plasmid；PUAST-scFvT1-FLAG plasmid table Up to the scFv T1 albumen for having FLAG sequence label, the amino acid sequence of the scFv T1 albumen with FLAG sequence label is sequence Column 5.

2. extracting pUAST-scFvT1-FLAG plasmid using extraction reagent kit in Promega；

3. collecting the w that genetic background is the supercilious look¹¹¹⁸Drosophila strains (are purchased from Bloomington drosophila strains library center, product Catalog number (Cat.No.) 3605) fertilized eggs, microinjection pUAST-scFvT1-FLAG plasmid and expression mediate realize DNA insertion turn The helper plasmid of seat enzyme delta2-3 (is purchased from Drosophila Genomics Resource Center, catalog number 1001)；

4. the filial generation drosophila (F0 is for drosophila) generated after microinjection is collected, with supercilious look w¹¹¹⁸Drosophila backcrossing, is returned Offspring, screening phenotype are the backcross progeny of blood-shot eye illness, are denoted by UAS-scFvT1-FLAG drosophila strains, conservation.

2, the building of GMR-Gal4 > UAS-TauR406W drosophila strains (control drosophila) of hTauR406W is expressed

1. collecting GMR-Gal4 drosophila strains virgin fly 10, UAS-TauR406W drosophila strains drosophila 6 is collected, is carried out Genetic cross；

2. principle is independently distributed and recombinates using science of heredity, according to document " Brand AH, Perrimon N.Targeted gene expression as a means of altering cell fates and generating Method in dominant phenotypes, Development 1993118:401-415. " obtains expression hTauR406W's GMR-Gal4 > UAS-TauR406W drosophila strains are denoted by GMR-Gal4 > UAS-TauR406W drosophila strains.GMR-Gal4> UAS-TauR406W drosophila strains single expression hTauR406W.

3, the building of GMR-Gal4 > UAS-scFvT1-FLAG drosophila strains of scFvT1-FLAG is expressed

1. collecting GMR-Gal4 drosophila strains virgin fly 10, UAS-scFvT1-FLAG drosophila strains drosophila 6 is collected, Carry out genetic cross；

2. principle is independently distributed and recombinates using science of heredity, according to document " Brand AH, Perrimon N.Targeted gene expression as a means of altering cell fates and generating Method in 1993 118:401-415. of dominant phenotypes, Development " obtains expression scFvT1- GMR-Gal4 > UAS-scFvT1-FLAG drosophila strains of FLAG are denoted by GMR-Gal4 > UAS-scFvT1-FLAG drosophila product System.GMR-Gal4 > UAS-scFvT1-FLAG drosophila strains single expression scFvT1-FLAG.

4, the building of hTauR406W and scFvT1-FLAG double expression drosophila strains

1. collecting GMR-Gal4 > UAS-TauR406W drosophila strains virgin fly 15, UAS-scFvT1-FLAG drosophila is collected Strain 8, carry out genetic cross；

2. principle is independently distributed and recombinates using science of heredity, according to document " Brand AH, Perrimon N.Targeted gene expression as a means of altering cell fates and generating Method in 1993 118:401-415. of dominant phenotypes, Development ", obtain hTauR406W and ScFvT1-FLAG double expression drosophila strains, are denoted by GMR-Gal4 > UAS-TauR406W；UAS-scFvT1-FLAG drosophila product System.GMR-Gal4>UAS-TauR406W；UAS-scFvT1-FLAG drosophila strains co-express hTauR406W and scFvT1-FLAG.

Two, the cytotoxicity detection of transgenic drosophila model

Each transgenic drosophila model respectively takes 24 adult drosophilas (male and female respectively take 12), cultivates 7 days for 29 DEG C after emergence, with appropriate dense The CO of degree₂Gas temporarily anaesthetizes drosophila, is placed in observation platform, using stereomicroscope observation drosophila compound eye form and carries out microspur It takes pictures and picture 3D is recombinated, the abnormality degree of drosophila compound eye is assessed.Normal drosophila compound eye is arranged by nearly 750 simple eye rules Cloth, and the pathology that cytotoxicity causes leads to drosophila ocular deformation, crude (rough eye) phenomenon occurs.

Testing result is as shown in figure 12.It can be seen from the figure that and w¹¹¹⁸Drosophila strains are compared, single expression The drosophila ocular deformation of GMR-Gal4 > UAS-TauR406W drosophila strains (control drosophila) of hTauR406W, occurs crude existing As expression of the hTauR406W in drosophila eyes can lead to the cytotoxicity that can be observed；But hTauR406W and scFvT1- FLAG double expression drosophila strains can make the eyes form of transgenic drosophila model back to normal, can effectively inhibit the cell of hTauR406W Toxicity.Existence and eyes of the single expression scFvT1-FLAG (GMR-Gal4 > UAS-scFvT1-FLAG drosophila strains) to drosophila Shape does not have any influence.The anitibody type molecular chaperones scFv T1 that this results show present invention screens is in vivo Tau albumen can be effectively suppressed and assemble and reduce its toxicity, provide new direction for the treatment of Alzheimer disease.

Sequence table

<110>Beijing Normal University

<120>inhibit the anitibody type molecular chaperones of Tau albumen aggregation

<160>4

<210>1

<211>1323bp

<212>DNA

<213>artificial sequence

<220>

<223>

<400>1

atggctgagc cccgccagga gttcgaagtg atggaagatc acgctgggac gtacgggttg 60

ggggacagga aagatcaggg gggctacacc atgcaccaag accaagaggg tgacacggac 120

gctggcctga aagaatctcc cctgcagacc cccactgagg acggatctga ggaaccgggc 180

tctgaaacct ctgatgctaa gagcactcca acagcggaag atgtgacagc acccttagtg 240

gatgagggag ctcccggcaa gcaggctgcc gcgcagcccc acacggagat cccagaagga 300

accacagctg aagaagcagg cattggagac acccccagcc tggaagacga agctgctggt 360

cacgtgaccc aagctcgcat ggtcagtaaa agcaaagacg ggactggaag cgatgacaaa 420

aaagccaagg gggctgatgg taaaacgaag atcgccacac cgcggggagc agcccctcca 480

ggccagaagg gccaggccaa cgccaccagg attccagcaa aaaccccgcc cgctccaaag 540

acaccaccca gctctggtga acctccaaaa tcaggggatc gcagcggcta cagcagcccc 600

ggctccccag gcactcccgg cagccgctcc cgcaccccgt cccttccaac cccacccacc 660

cgggagccca agaaggtggc agtggtccgt actccaccca agtcgccgtc ttccgccaag 720

agccgcctgc agacagcccc cgtgcccatg ccagacctga agaatgtcaa gtccaagatc 780

ggctccactg agaacctgaa gcaccagccg ggaggcggga aggtgcagat aattaataag 840

aagctggatc ttagcaacgt ccagtccaag tgtggctcaa aggataatat caaacacgtc 900

ccgggaggcg gcagtgtgca aatagtctac aaaccagttg acctgagcaa ggtgacctcc 960

aagtgtggct cattaggcaa catccatcat aaaccaggag gtggccaggt ggaagtaaaa 1020

tctgagaagc ttgacttcaa ggacagagtc cagtcgaaga ttgggtccct ggacaatatc 1080

acccacgtcc ctggcggagg aaataaaaag attgaaaccc acaagctgac cttccgcgag 1140

aacgccaaag ccaagacaga ccacggggcg gagatcgtgt acaagtcgcc agtggtgtct 1200

ggggacacgt ctccacggca tctcagcaat gtctcctcca ccggcagcat cgacatggta 1260

gactcgcccc agctcgccac gctagctgac gaggtgtctg cctccctggc caagcagggt 1320

ttg 1323

<210>2

<211>888bp

<212>DNA

<213>artificial sequence

<220>

<223>

<400>2

atgaaatacc tattgcctac ggcagccgct ggattgttat tactcgcagc aagcggcgcg 60

catgcccagt ctgtgctgac gcagccgccc tcagtgtctg cggccccagg acagaaggtc 120

accatctcct gctctggaag cagctccaac attgggaata attatgtatc ctggtaccag 180

cagctcccag gaacagcccc caaactcctc atttatgaca ataataagcg accctcaggg 240

attcctgacc gattctctgg ctccaagtct ggcacgtcag ccaccctggg catcaccgga 300

ctccagactg gggacgaggc cgattattac tgcggaacat gggatagcag cctgagtgct 360

gtggtattcg gcggagggac caagctgacc gtcctagggt ccggagggtc gaccataact 420

tcgtataatg tatactatac gaagttatcc tcgagcggta cccaggtgca gctgttggag 480

tctgggggag gcttggtaca gcctgggggg tccctgagac tctcctgtgc agcctctgga 540

ttcaccttta gcagctatgc catgagctgg gtccgccagg ctccagggaa ggggctggag 600

tgggtctcag ctattagtgg tagtggtggt agcacatact acgcagactc cgtgaagggc 660

cggttcacca tctccagaga caattccaag aacacgctgt atctgcaaat gaacagcctg 720

agagccgagg acacggccgt atattactgt gcgaaagatc ccggccgggg cagtggctgg 780

tactactggg gccagggaac cctggtcact gtctcttcag ctagcggcaa accaatccca 840

aacccactgc tgggcctgga tagtactcac catcaccatc accattag 888

<210>3

<211>295

<212>PRT

<213>artificial sequence

<220>

<223>

<400>3

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala

1 5 10 15

Ala Ser Gly Ala His Ala Gln Ser Val Leu Thr Gln Pro Pro Ser Val

20 25 30

Ser Ala Ala Pro Gly Gln Lys Val Thr Ile Ser Cys Ser Gly Ser Ser

35 40 45

Ser Asn Ile Gly Asn Asn Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly

50 55 60

Thr Ala Pro Lys Leu Leu Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly

65 70 75 80

Ile Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu

85 90 95

Gly Ile Thr Gly Leu Gln Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly

100 105 110

Thr Trp Asp Ser Ser Leu Ser Ala Val Val Phe Gly Gly Gly Thr Lys

115 120 125

Leu Thr Val Leu Gly Ser Gly Gly Ser Thr Ile Thr Ser Tyr Asn Val

130 135 140

Tyr Tyr Thr Lys Leu Ser Ser Ser Gly Thr Gln Val Gln Leu Leu Glu

145 150 155 160

Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys

165 170 175

Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg

180 185 190

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser

195 200 205

Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

210 215 220

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu

225 230 235 240

Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Pro Gly Arg

245 250 255

Gly Ser Gly Trp Tyr Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

260 265 270

Ser Ala Ser Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser

275 280 285

Thr His His His His His His

290 295

<210>4

<211>783bp

<212>DNA

<213>artificial sequence

<220>

<223>

<400>4

atgcagtctg tgctgacgca gccgccctca gtgtctgcgg ccccaggaca gaaggtcacc 60

atctcctgct ctggaagcag ctccaacatt gggaataatt atgtatcctg gtaccagcag 120

ctcccaggaa cagcccccaa actcctcatt tatgacaata ataagcgacc ctcagggatt 180

cctgaccgat tctctggctc caagtctggc acgtcagcca ccctgggcat caccggactc 240

cagactgggg acgaggccga ttattactgc ggaacatggg atagcagcct gagtgctgtg 300

gtattcggcg gagggaccaa gctgaccgtc ctagggtccg gagggtcgac cataacttcg 360

tataatgtat actatacgaa gttatcctcg agcggtaccc aggtgcagct gttggagtct 420

gggggaggct tggtacagcc tggggggtcc ctgagactct cctgtgcagc ctctggattc 480

acctttagca gctatgccat gagctgggtc cgccaggctc cagggaaggg gctggagtgg 540

gtctcagcta ttagtggtag tggtggtagc acatactacg cagactccgt gaagggccgg 600

ttcaccatct ccagagacaa ttccaagaac acgctgtatc tgcaaatgaa cagcctgaga 660

gccgaggaca cggccgtata ttactgtgcg aaagatcccg gccggggcag tggctggtac 720

tactggggcc agggaaccct ggtcactgtc tcttcagact acaaagacga tgacgacaag 780

tga 783

<210>5

<211>260

<212>PRT

<213>artificial sequence

<220>

<223>

<400>5

Met Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Ala Ala Pro Gly

1 5 10 15

Gln Lys Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn

20 25 30

Asn Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu

35 40 45

Leu Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Ile Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Thr Ser Ala Thr Leu Gly Ile Thr Gly Leu

65 70 75 80

Gln Thr Gly Asp Glu Ala Asp Tyr Tyr Cys Gly Thr Trp Asp Ser Ser

85 90 95

Leu Ser Ala Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly

100 105 110

Ser Gly Gly Ser Thr Ile Thr Ser Tyr Asn Val Tyr Tyr Thr Lys Leu

115 120 125

Ser Ser Ser Gly Thr Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

130 135 140

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe

145 150 155 160

Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys

165 170 175

Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr

180 185 190

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

195 200 205

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

210 215 220

Ala Val Tyr Tyr Cys Ala Lys Asp Pro Gly Arg Gly Ser Gly Trp Tyr

225 230 235 240

Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Asp Tyr Lys Asp

245 250 255

Asp Asp Asp Lys

260

Claims

1. a kind of single-chain antibody comprising heavy chain variable region and light chain variable region,

The amino acid sequence of the light chain variable region is amino acid sequence shown in sequence 3 23-133；

The amino acid sequence of the heavy chain variable region is amino acid sequence shown in sequence 3 155-273.

2. single-chain antibody according to claim 1, it is characterised in that:

The amino acid sequence of the single-chain antibody is amino acid sequence shown in sequence 3.

3. biomaterial relevant to single-chain antibody of any of claims 1 or 2 is following A or B or C:

A, following A 1) any one of to A8):

A1 the nucleic acid molecules of light chain variable region described in claim 1) are encoded；

A2) contain A1) expression cassettes of the nucleic acid molecules；

A3) contain A1) recombinant vectors of the nucleic acid molecules；

A4) contain A2) recombinant vector of the expression cassette；

A5) contain A1) recombinant microorganisms of the nucleic acid molecules；

A6) contain A2) recombinant microorganism of the expression cassette；

A7) contain A3) recombinant microorganism of the recombinant vector；

A8) contain A4) recombinant microorganism of the recombinant vector；

B, following B1) any one of to B8):

B1 the nucleic acid molecules of heavy chain variable region described in claim 1) are encoded；

B2) contain B1) expression cassettes of the nucleic acid molecules；

B3) contain B1) recombinant vectors of the nucleic acid molecules；

B4) contain B2) recombinant vector of the expression cassette；

B5) contain B1) recombinant microorganisms of the nucleic acid molecules；

B6) contain B2) recombinant microorganism of the expression cassette；

B7) contain B3) recombinant microorganism of the recombinant vector；

B8) contain B4) recombinant microorganism of the recombinant vector；

C, following C1) any one of to C8):

C1 the nucleic acid molecules of single-chain antibody described in claim 1) are encoded；

C2) contain C1) expression cassettes of the nucleic acid molecules；

C3) contain C1) recombinant vectors of the nucleic acid molecules；

C4) contain C2) recombinant vector of the expression cassette；

C5) contain C1) recombinant microorganisms of the nucleic acid molecules；

C6) contain C2) recombinant microorganism of the expression cassette；

C7) contain C3) recombinant microorganism of the recombinant vector；

C8) contain C4) recombinant microorganism of the recombinant vector.

4. biomaterial according to claim 3, it is characterised in that:

The coded sequence of the light chain variable region is DNA molecular shown in sequence 2 67-399；

The coded sequence of the heavy chain variable region is DNA molecular shown in sequence 2 463-819；

The coded sequence of the single-chain antibody is DNA molecular shown in sequence 2.

5. biomaterial described in single-chain antibody of any of claims 1 or 2 or claim 3 or 4 is in following (m1)-(m3) Application in any:

(m1) preparation inhibits the product of the aggregation of Tau albumen；

(m2) product of cytotoxicity caused by preparation inhibits or reduce Tau albumen to assemble；

(m3) product of preparation treatment or adjuvant treatment Alzheimer disease；

The Tau albumen is the Tau albumen of phosphorylation.

6. a kind of product, active constituent is biology described in single-chain antibody of any of claims 1 or 2 or claim 3 or 4 Material；

The function of the product is any in following (m1)-(m6):

(m1) inhibit the aggregation of Tau albumen；

(m2) preparation inhibits the product of the aggregation of Tau albumen；

(m3) inhibit or reduce cytotoxicity caused by Tau albumen is assembled；

(m5) treat or assist in the treatment of Alzheimer disease；

(m6) product of preparation treatment or adjuvant treatment Alzheimer disease；

The Tau albumen is the Tau albumen of phosphorylation.