CN106749657A - A kind of signal peptide for antibody and its application - Google Patents
A kind of signal peptide for antibody and its application Download PDFInfo
- Publication number
- CN106749657A CN106749657A CN201611146520.9A CN201611146520A CN106749657A CN 106749657 A CN106749657 A CN 106749657A CN 201611146520 A CN201611146520 A CN 201611146520A CN 106749657 A CN106749657 A CN 106749657A
- Authority
- CN
- China
- Prior art keywords
- signal peptide
- mfc
- antibody
- amino acid
- pcdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of new signal peptide for antibody and its application.Signal peptide for antibody of the present invention is that a section identified from one plant of antibody light chain of the anti-pig B7 H3 of mouse includes 18 21 short peptide signal peptide sequences of amino acid, and the sequence can instruct the albumen for lacking signal peptide to obtain secreting function.The amino acid sequence of described signal peptide for antibody is as shown in SEQ ID NO.2 5.It is of the invention to propose to provide a kind of new technological means to lack the secreting, expressing of the albumen of signal peptide.
Description
Technical field
Divided in eukaryotic the present invention relates to a kind of new signal peptide for antibody and its signal peptide albumen is lacked
Secrete the application in expression.The invention belongs to biological technical field.
Background technology
Signal peptide is that there are a class mediating proteins to pass through the albumen short peptide sequence of cytolipin plasma membrane, and it is generally present in secretion
, can be positioned at destination protein on extracellular or cell membrane by the end of type albumen or memebrane protein.The length of signal peptide is general
In 30 amino acid or so, positioned at the end of protein sequence.If the signal peptide of secreted protein or memebrane protein lacked,
The albumen will be stranded in intracellular, it is impossible to pass through cell membrane and reach on extracellular or cell membrane.Therefore, protein is passed through carefully
After birth one complete signal peptide sequence of needs could be completed.This function of signal peptide has in eukaryotic expression widely should
With prospect, after the albumen of cell inner expression such as is added into signal peptide, the albumen can be carried out secreting, expressing, so be conducive to this
The purifying of albumen.Antibody is a class secreted protein of mammal, is secreted by the B cell in immune system, due to antibody tool
There is the polymorphism of height, the sequence of each antibody molecule is different, therefore, the signal peptide sequence of every kind of antibody is also different.
We identify one section in one plant of antibody light chain of the anti-pig B3-H7 of mouse and include the 18-21 short peptide signal peptide sequence of amino acid,
The sequence can instruct the albumen for lacking signal peptide to obtain secreting function.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of new signal peptide for antibody, and the signal peptide can be realized lacking
Secreting, expressing of the albumen of few signal peptide in eukaryotic.
In order to achieve the above object, present invention employs following technological means：
1. the constant region-encoding gene (mFc) of Cloning of mouse's heavy chain, and make the clone gene 5 ' plus ATG initiation codons
Son, 3 ' end take TAA terminator codons, then by the gene be inserted into carrier for expression of eukaryon pcDNA 3.1 (+) BamHI and
Between XhoI, recombinant eukaryotic expression plasmid pcDNA-mFc is constituted.
2. Cloning of mouse mFc (without initiation codon, only band terminator codon), and it is cloned into carrier for expression of eukaryon
Between pcDNA 3.1 (+) BamHI and XhoI, synthesize the encoding gene that anti-pig B7-H3 antibody light chains 5 ' hold 17-21 amino acids
Fragment, between the HindIII that these genetic fragments are connected to before mFc and BamHI, respectively constitutes eucaryon recombination expression and carries
Body pcDNA-S 21-mFc (small peptides comprising 21 amino acid), pcDNA-S 20-mFc (comprising 20 small peptides of amino acid),
PcDNA-S 19-mFc (small peptides comprising 19 amino acid), pcDNA-S 18-mFc (comprising 18 small peptides of amino acid) and
PcDNA-S 17-mFc (comprising 17 small peptides of amino acid).
3. various eucaryon recombinant vectors (including pcDNA-mFc, pcDNA-S 21-mFc, pcDNA-S 20- that will be built
MFc, pcDNA-S 19-mFc, pcDNA-S 18-mFc and pcDNA-S 17-mFc) transfection 293T cells, supernatant is collected after 48h
Or cell, the transfectional cell of collection further cracked, and the cell of supernatant or cracking is purified with protein G, purifying
Product carry out western Blot analyses.
Result shows, identified in one plant of antibody light chain of the anti-pig B7-H3 of mouse one section of the present inventor includes 18-21 ammonia
The short peptide signal peptide sequence of base acid, the sequence can instruct the albumen for lacking signal peptide to obtain secreting function.
Therefore, on the basis of the studies above, the present invention proposes a kind of new signal peptide for antibody, and it is from one plant of mouse
One section identified in the antibody light chain of anti-pig B7-H3 includes the 18-21 short peptide signal peptide sequence of amino acid, its amino acid sequence
Row are as shown in SEQ ID NO.2-5.
The nucleotide sequence of the described signal peptide for antibody of coding is also within protection scope of the present invention.Preferably, it is described
Nucleotide sequence respectively as shown in SEQ ID NO.7-10.
Further, the albumen of signal peptide is being lacked in eukaryotic the invention allows for described signal peptide for antibody
Carry out the application in secreting, expressing.
Wherein, it is preferred that described albumen is single-chain antibody.
Brief description of the drawings
Fig. 1 is the Western blot testing results of mFc albumen；
A) mFc without signal peptide transfects 293T cells, cell is collected after 48h and is cracked, and mFc therein is used
Protein G carry out western Blot analyses after purification:1. protein marker；2. the pyrolysis product of transfectional cell is passed through
Protein G carry out western Blot analyses after purification；3. transfectional cell supernatant is carried out after purification through protein G
Western Blot are analyzed；
B) the mFc genes transfection 293T cells with different length signal peptide, take supernatant after 48h, and the mFc in supernatant is used
Protein G carry out western Blot analyses after purification：1. protein marker；2.N ends are with 21 signal peptides of amino acid
MFc genes transfect 293T cells analysis result；MFc genes transfection 293T with 20 signal peptides of amino acid is thin at 3.N ends
The analysis result of born of the same parents；4.N ends transfect the analysis result of 293T cells with 19 mFc genes of the signal peptide of amino acid；5.N ends band
18 mFc genes of the signal peptide of amino acid transfect the analysis result of 293T cells；6.N ends are with 17 signal peptides of amino acid
MFc genes transfect the analysis result of 293T cells；7. culture medium supernatant control.
Specific embodiment
Further describe the present invention with reference to specific embodiment, advantages of the present invention and feature will be with description and
It is apparent.But these embodiments are only exemplary, do not constitute any limitation to the scope of the present invention.People in the art
Member to the details of technical solution of the present invention and form it should be understood that can enter without departing from the spirit and scope of the invention
Row modification is replaced, but these modifications and replacement are each fallen within protection scope of the present invention.
The signal peptide for antibody of the invention of embodiment 1 and its application in PE expression
1st, the amplification of the constant region-encoding gene (mFc) of murine heavy chain and its structure of expression vector
Constant region-encoding gene (mFc) according to murine heavy chain designs cloning primer to as follows：
mFc-F 1:5’GAGAGGATCCATGGAGCCCAGCGGGCCCATTTC3 ' and
mFc-R:5’GAGACTCGAGCCGGGTAAAGGTAAATGA3’
Wherein B amHI restriction enzyme sites (GGATCC) and initiation codon are added at 5 ' ends of sense primer (mFc-F 1)
(ATG), 5 ' ends of anti-sense primer (mFc-R) add XhoI restriction enzyme sites (CTCGAG).Hybridized from anti-pig B7-H3 with the primer pair
MFc fragments (shown in SEQ ID NO.11) is expanded in cDNA prepared by oncocyte, is entered with B amHI and XhoI after purified pcr product
Row digestion, digestion products further enter row agarose gel electrophoresis purifying and reclaim, and the mFc products of recovery are connected to and use B amHI
On the carrier for expression of eukaryon pcDNA 3.1 (+) of XhoI digestions and purifying, recombinant eukaryotic expression plasmid pcDNA-mFc is obtained, should
Without any signal peptide sequence in recombinant vector.
2nd, the structure of the mouse mFc expression vectors containing signal peptide
Cloning primer is designed to as follows according to Cloning of mouse mFc：
mFc-F 2:5’GAGAGGATCCGAGCCCAGCGGGCCCATTTC3 ' (without initiation codon), with the primer with
MFc-R matches amplification mFc fragments together, and digestion is carried out with B amHI and XhoI after the fragment purification, and digestion products further enter
Row agarose gel electrophoresis purifying is reclaimed, and the mFc products of recovery are connected into the eucaryon with B amHI and XhoI digestion and purifying
On expression vector pcDNA 3.1 (+), (mFc in the recombinant vector is free of to obtain recombinant eukaryotic expression plasmid pcDNA-mFc 2
Initiation codon).Synthesis holds the 17-21 encoding gene segment of amino acid, such as table 1 below containing anti-pig B7-H3 antibody light chains 5 '
It is shown, by these genetic fragments connect respectively and mFc before HindIII and BamHI between, respectively constitute eucaryon recombination expression carry
Body pcDNA-S 21-mFc (small peptides comprising 21 amino acid), pcDNA-S 20-mFc (comprising 20 small peptides of amino acid),
PcDNA-S 19-mFc (small peptides comprising 19 amino acid), pcDNA-S 18-mFc (comprising 18 small peptides of amino acid) and
PcDNA-S 17-mFc (comprising 17 small peptides of amino acid).
Table 1
3rd, western Blot analyses
Will build various eucaryon recombinant vectors (including pcDNA-mFc, pcDNA-S 21-mFc, pcDNA-S 20-mFc,
PcDNA-S 19-mFc, pcDNA-S 18-mFc and pcDNA-S 17-mFc) transfection 293T cells, supernatant or same is collected after 48h
When collect supernatant cell (sample of pcDNA-mFc transfections), the transfectional cell of collection is further cracked, supernatant cracking
Cell purified with protein G, the product of purifying carries out western Blot analyses, as a result as shown in Figure 1.
It will be seen from figure 1 that the present invention identified from one plant of antibody light chain of the anti-pig B7-H3 of mouse comprising 18-21
The short peptide signal peptide sequence of amino acid can instruct the albumen for lacking signal peptide to obtain secreting function.
Sequence table
<110>Harbin Veterinary Medicine Inst., China Academy of Agriculture
<120>A kind of signal peptide for antibody and its application
<130> KLPI161220
<160> 11
<170> PatentIn 3.5
<210> 1
<211> 17
<212> PRT
<213>Signal peptide
<400> 1
1 MET Lys Leu Pro Val Arg Leu Leu Val Leu MET Phe Trp Ile Pro
16 Ala Ser
<210> 2
<211> 18
<212> PRT
<213>Small peptide
1 MET Lys Leu Pro Val Arg Leu Leu Val Leu MET Phe Trp Ile Pro
16 Ala Ser Asn
<400> 3
<210> 1
<211> 19
<212> PRT
<213>Small peptide
<400> 1
1 MET Lys Leu Pro Val Arg Leu Leu Val Leu MET Phe Trp Ile Pro
16 Ala Ser Asn Ser
<210> 4
<211> 20
<212> PRT
<213>Small peptide
<400> 4
1 MET Lys Leu Pro Val Arg Leu Leu Val Leu MET Phe Trp Ile Pro
16 Ala Ser Asn Ser Asp
<210> 5
<211> 21
<212> PRT
<213>Small peptide
<400> 5
1 MET Lys Leu Pro Val Arg Leu Leu Val Leu MET Phe Trp Ile Pro
16 Ala Ser Asn Ser Asp Val
<210> 6
<211> 51
<212> DNA
<213>Small peptide coded sequence
<400> 6
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc c 51
<210> 7
<211> 54
<212> DNA
<213>Small peptide coded sequence
<400> 7
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc caac 54
<210> 8
<211> 57
<212> DNA
<213>Small peptide coded sequence
<400> 8
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc caacagt 57
<210> 9
<211> 60
<212> DNA
<213>Small peptide coded sequence
<400> 9
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc caacagtgat 60
<210> 10
<211> 63
<212> DNA
<213>Small peptide coded sequence
<400> 10
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc caacagtgat 60
gtt 63
<210> 11
<211> 726
<212> DNA
<213> mFc
<400> 11
gagcccagcg ggcccatttc aacaatcaac ccctgtcctc catgcaagga gtgtcacaaa 60
tgcccagctc ctaaccttga gggtggacca tccgtcttca tcttccctcc aaatatcaag 120
gatgtactca tgatctccct gacacccaag gtcacgtgtg tggtggtgga tgtgagcgag 180
gatgacccag acgtccagat cagctggttt gtgaacaacg tggaagtaca cacagctcag 240
acacaaaccc acagagagga ttacaacagt actatccggg tggtcagcac cctccccatc 300
cagcaccagg actggatgag tggcaaggag ttcaaatgca aggtcaacaa caaagacctc 360
ccatcaccca tcgagagaac catctcaaaa attaaagggc tagtcagagc tccacaggta 420
tacatcttgc cgccaccagc agagcagttg tccaggaaag atgtcagtct cacttgcctg 480
gtcgtgggct tcaaccctgg agacatcagt gtggagtgga ccagcaatgg gcatacagag 540
gagaactaca aggacaccgc accagtcctg gactctgacg gttcttactt catatatagc 600
aagctcaata tgaaaacaag caagtgggag aaaacagatt cctactcatg caacgtgaga 660
cacgagggtc tgaaaaatta ctacctgaag aagaccatct cccggtctcc gggtaaaggt 720
aaatga 726
Claims (5)
1. a kind of new signal peptide for antibody, it is characterised in that described signal peptide for antibody is from the anti-of one plant of anti-pig B7-H3 of mouse
One section identified in body light chain includes the 18-21 short peptide signal peptide sequence of amino acid, and its amino acid sequence is respectively such as SEQ
Shown in ID NO.2-5.
2. the nucleotide sequence of the signal peptide for antibody described in claim 1 is encoded.
3. nucleotide sequence as claimed in claim 2, it is characterised in that described nucleotide sequence is respectively such as SEQ ID
Shown in NO.7-10.
4. the signal peptide for antibody described in claim 1 is in the albumen for lacking signal peptide carries out secreting, expressing in eukaryotic
Using.
5. application as claimed in claim 4, it is characterised in that described albumen is single-chain antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611146520.9A CN106749657A (en) | 2016-12-13 | 2016-12-13 | A kind of signal peptide for antibody and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611146520.9A CN106749657A (en) | 2016-12-13 | 2016-12-13 | A kind of signal peptide for antibody and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106749657A true CN106749657A (en) | 2017-05-31 |
Family
ID=58880663
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611146520.9A Pending CN106749657A (en) | 2016-12-13 | 2016-12-13 | A kind of signal peptide for antibody and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106749657A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113402589A (en) * | 2021-06-18 | 2021-09-17 | 苏州工业园区唯可达生物科技有限公司 | Signal peptide for improving antibody yield |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102574915A (en) * | 2009-08-06 | 2012-07-11 | 伊缪纳斯制药株式会社 | Antibodies that specifically bind to A beta oligomers and use thereof |
| WO2016040321A1 (en) * | 2014-09-09 | 2016-03-17 | Board Of Regents, The University Of Texas System | Blocking monoclonal antibodies to agr2 and its receptor c4.4a |
-
2016
- 2016-12-13 CN CN201611146520.9A patent/CN106749657A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102574915A (en) * | 2009-08-06 | 2012-07-11 | 伊缪纳斯制药株式会社 | Antibodies that specifically bind to A beta oligomers and use thereof |
| WO2016040321A1 (en) * | 2014-09-09 | 2016-03-17 | Board Of Regents, The University Of Texas System | Blocking monoclonal antibodies to agr2 and its receptor c4.4a |
Non-Patent Citations (1)
| Title |
|---|
| 陈龙冠: "信号肽优化对重组抗体分泌表达的影响及研究进展", 《中国生物工程杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113402589A (en) * | 2021-06-18 | 2021-09-17 | 苏州工业园区唯可达生物科技有限公司 | Signal peptide for improving antibody yield |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Qu et al. | Characterization of the genome of rice tungro bacilliform virus: comparison with Commelina yellow mottle virus and caulimoviruses | |
| Jones et al. | Isolation of complementary DNA clones encoding the human lymphocyte glycoprotein T1/Leu-1 | |
| Miura et al. | Molecular cloning and characterization of a novel glycoprotein, gp34, that is specifically induced by the human T-cell leukemia virus type I transactivator p40tax | |
| Conley et al. | Molecular characterization and evolution of sequences encoding light-harvesting components in the chromatically adapting cyanobacterium Fremyella diplosiphon | |
| Romanowski et al. | Complete sequence of the S RNA of lymphocytic choriomeningitis virus (WE strain) compared to that of Pichinde arenavirus | |
| Stow | Cloning of a DNA fragment from the left-hand terminus of the adenovirus type 2 genome and its use in site-directed mutagenesis | |
| Shaw et al. | A previously unrecognized influenza B virus glycoprotein from a bicistronic mRNA that also encodes the viral neuraminidase. | |
| AU691980B2 (en) | Expression and export technology of proteins as immunofusins | |
| Thomas et al. | Expression and cell type—Specific processing of human preproenkephalin with a vaccinia recombinant | |
| WO1993025698A1 (en) | Vector particles resistant to inactivation by human serum | |
| CN106674354B (en) | Fusion protein of chicken interferon IFN-lambda and IFN-alpha | |
| CN107177592A (en) | Inhibition tRNA reads over the truncated protein in Premature stop codon disease | |
| Ohno et al. | Nucleotide sequence of a chicken δ-crystallin gene | |
| CN106749657A (en) | A kind of signal peptide for antibody and its application | |
| Galili et al. | Ribosomal protein S12 as a site for streptomycin resistance in Nicotiana chloroplasts | |
| CN114560915A (en) | Modified high-titer SARS-CoV-2 pseudovirus | |
| CN114317606B (en) | Adenovirus vector targeting human NK cells and application thereof | |
| WO1992013073A1 (en) | Pdgf-b analogues | |
| Barklis et al. | Structure of the Dictyostelium discoideum prestalk D11 gene and protein | |
| Royo et al. | Cloning and nucleotide sequence of two S-RNases from Lycopersicon peruvianum (L.) Mill. | |
| Sisk et al. | Deletion of hydrophobic domains of viral glycoproteins increases the level of their production in Escherichia coli | |
| Balazs et al. | Chimeric vector construction for higher-plant transformation | |
| Konings et al. | Mike, a chimeric filamentous phage designed for the separate production of either DNA strand of pKUN vector plasmids by F+ cells | |
| CN113880924A (en) | SARS-CoV-2 pseudovirus | |
| CN102978211B (en) | Interest protein preparation method and purpose thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |