CN106749655B - Monoclonal antibody aiming at protein E2-2 - Google Patents

Abstract

The invention relates to a monoclonal antibody aiming at protein E2-2, in particular to a hybridoma cell strain which is obtained by expressing E2-2(TCF4) protein by a prokaryotic expression system, immunizing a Balb/c mouse and screening by an ELISA and immunohistochemical method and can generate a monoclonal antibody specifically binding with human E2-2 protein. The antibody can be specifically combined with E2-2 in immunoenzymatic detection (ELISA), immunoblotting (Western) and immunohistochemical experiments. The monoclonal antibodies can be used to diagnose various pDC-related diseases, including Pitt-Hopkins syndrome, schizophrenia, solid tumors infiltrated with pDC, blast plasmacytoid dendritic cell lymphoma, other diseases associated with pDC frequency changes, and the like.

Description

Monoclonal antibody aiming at protein E2-2

Technical Field

The invention relates to the field of antibody engineering, in particular to a monoclonal antibody aiming at a protein E2-2.

Background

E2-2 is a member of the E protein family, also known as TCF4(Transcription factor 4), and belongs to the bHLH (basic helix-loop-helix) Transcription factor superfamily [1 ].

The human E2-2 gene has 41 exons and is located on chromosome 18, 18q 21.2. As a monomer E2-2, which has no DNA binding activity but forms homodimers or heterodimers with other proteins, can bind to DNA and exert transcription activity [2]. E2-2 has multiple alternatively spliced transcripts, corresponding to different proteins. Sepp et al investigated the role of alternatively spliced transcripts of the human E2-2 gene in regulating the structure, expression and coding potential of the E2-2 gene. They found that human E2-2 is particularly highly expressed in the brain, and that different protein subtypes, 18 different N-termini, can be formed by using a large number of 5' -terminal exons. They also observed alternative splicing of internal exons, which could form more switchesAnd (5) recording the book. Functional analysis showed that different E2-2 protein subtypes have different subcellular localization: the protein subtype containing the Nuclear Localization Signal (NLS) is localized in the nucleus, and others are detectable in the cytoplasm. Protein subtypes without NLS may enter the nucleus by binding to some bHLH proteins containing NLS. Subtypes without NLS may also be transported out of the nucleus into the cytoplasm by binding some proteins containing Nuclear Export Signals (NES) [3]. E2-2 can bind to calmodulin and may be involved in Ca2⁺And (4) adjusting the signal. Ca2 consistent with physiological conditions in vitro⁺At concentrations where the N-terminal sequences of the basic regions of the E2-2 and E2A proteins bind calmodulin, the DNA binding activity of which is to be inhibited [4]. Increasing intracellular Ca2+ concentration or overexpressing calmodulin inhibited the transcriptional activity of E2-2. The Ca2+ signal may prevent the E protein from binding to the DNA of interest by forming an E protein-calmodulin complex [ 5]]。

E2-2 was mainly expressed in human plasmacytoid dendritic cells (pDCs), and neither myeloid Dendritic Cells (DCs) nor precursor cells were expressed. Overexpression of E2-2 in human thymic precursor cells stimulates the development of pDCs, and inhibition of E2-2 expression by RNA interference effectively inhibits the development of precursor cells to pDCs [6 ]. Overexpression of Id2 or Id3 in CD34+ hematopoietic progenitors can inhibit pDCs development by inhibiting E protein activity, without affecting DCs development [7 ]. E2-2 and SpiB act synergistically, and simultaneous overexpression of both in precursor cells further stimulates pDCs development [6 ]. Studies suggest that Pitt-Hopkins syndrome (PHS) is associated with E2-2 single allele mutations [3 ]. Examination of the patient's blood revealed a decrease in the amount of pDC, a down-regulation of BDCA2 gene expression, and a blocking of interferon production, and a persistent respiratory infection in PHS patients could be caused by a defect in pDC [1,8 ].

In addition, the blastic plasmacytoid dendritic cell lymphoma (BPDCN) is a rare malignancy derived from plasmacytoid dendritic precursor cells. BPDCN cells express pDCS-specific molecules BDCA2, CD123, CD4, TCL1, Bcl11A, CD2AP and Spi-B [9-11 ]. Since BPDCN cells express the myeloid molecule CD56, BPDCN was once considered a blast-like NK cell lymphoma until after pDCs were found, which was classified as blast-like plasmacytoid dendritic cell lymphoma based on its molecular signature and partial function [9 ]. There are reports that Spi-B can be used as a diagnostic marker for BPDCN [12 ].

In the central nervous system, E2-2 is mainly expressed in the forebrain, the diencephalon and the cerebellum. E2-2 is important for glial cell differentiation, especially the maturation of oligodendrocyte precursors [13 ]. In postnatal spinal cord, E2-2 is expressed only in oligodendrocytes, with progressive reduction in myelination. E2-2 can form heterodimers with a series of bHLH transcription factors involved in the regulation of nervous system development, such as ATOH1(Atonal homolog 1, also known as MATH1), expressed in the differentiating neuroepithelial lining [14 ]; ASCL1 (Achaete-scar complex homolog 1, alias MASH-1 in mice, alias HASH-1 in humans), is essential for the formation of central nervous system, particularly forebrain neuronal circuits [15 ]; id1 is necessary for proper neuronal development [16 ]; olig2 regulates ventral neuroectodermal precursor cell fate, essential for oligodendrocyte and motoneuron development [13 ]; NEUROD2 (alias NDRF), is important for neuronal differentiation and survival [17 ]. By participating in such a staggered associative regulatory network, E2-2 regulates development of the central nervous system. Mutations in E2-2 lead to a variety of diseases associated with neurodevelopmental disorders [18 ].

Pitt-Hopkins syndrome is a rare disorder of neurodevelopmental dysfunction, in which the learning and memory abilities of the patient are severely impaired, and the learning ability of the language is almost completely lost, manifesting as intellectual disability, atypical self-closure and hyperventilation, known as "autism". The study suggested that PHS was associated with a single allele mutation in E2-2, and that PHS patients had only half the normal amount of E2-2, indicating that PHS was sensitive to E2-2 doses. Mutations in the E2-2 gene that cause PHS are very diverse, with deletions of the entire gene, deletions of portions of the gene, frame shifts (including premature appearance of stop codons), nonsense mutations, splice site mutations, and missense mutations. Almost all cases so far have their own unique E2-2 gene mutation, and only a very few have the same E2-2 gene mutation. Missense mutations typically occur in the bHLH domain that binds DNA regulatory elements, which is a mutational hot spot, which is the case in about 15% of PHS cases. Approximately 40% of PHS cases are due to premature appearance of stop codons by point mutations [19-21 ].

Genetic epidemiological studies have shown that schizophrenia is inherited with a probability of up to 80% [22 ]. Genome association analysis shows that the variation of two genetic loci near E2-2 is possibly at risk of schizophrenia. The level of E2-2 in the blood of the mental patient was examined and was significantly reduced. The cerebellar cortical areas of the 14 schizophrenic patient groups were dissected and E2-2 expression was found to be up-regulated compared to the 6 control groups. However, there are also studies comparing three brain regions by post-hoc dissection and finding that mRNA levels of E2-2 are not associated with schizophrenia [23 ]. Navarete et al examined lymphocytes from 106 schizophrenic patients and 96 controls and found that E2-2mRNA levels in the patients were about 20% lower than in the controls [24 ].

Studies have shown that diseases such as Pitt-Hopkins syndrome, schizophrenia, solid tumors infiltrated with pDC, and lymphomas with plasmacytoid dendritic cells are all associated with pDCs, and accurate and rapid identification of pDCs is required if these diseases are to be identified. Specific markers of the pDCs include CD123, BDCA2, Spi-B, E2-2 and the like, and the CD123 can recognize both the pDCs and vascular endothelial cells; BDCA2 and Spi-B, although histochemical antibodies, have not been widely used; however, as for E2-2, there is no monoclonal antibody against it at present. E2-2 is a transcription factor of pDCs, protein expression and monoclonal antibody screening are very difficult, and according to the characteristics of the E2-2 protein, the protein of non-full-length E2-2 is purified, and the monoclonal antibody is screened by an immunohistochemical method. The E2-2 monoclonal antibody obtained by screening is not only beneficial to the research of basic science, but also plays an important role in the identification of pDCs related diseases.

Disclosure of Invention

The present invention relates to the following:

1. a monoclonal antibody directed against protein E2-2, said antibody being prepared by the steps of:

1) recombinantly expressing E2-2 or a fragment thereof;

2) immunizing a mouse with the recombinantly expressed E2-2 or fragment thereof;

3) fusing splenocytes of the immunized mice with myeloma cells of the mice;

4) the supernatant was screened for a monoclonal antibody that specifically recognizes protein E2-2 or a fragment thereof.

2. A hybridoma cell that secretes a monoclonal antibody that specifically recognizes protein E2-2 or a fragment thereof.

3. The monoclonal antibody of claim 1 or the hybridoma cell of claim 2, wherein said monoclonal antibody is selected by immunization with fragment E2-2, said fragment E2-2 being represented by SEQ ID NO: 1 is coded by the nucleotide sequence shown in the specification.

4. A monoclonal antibody hybridoma cell strain resisting human E2-2 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.11494 and the name of E2-22G 8.

5. A monoclonal antibody against protein E2-2, said antibody being secreted by the hybridoma cell of item 4.

6. Use of the antibody or hybridoma cell of any one of items 1 to 5 in the preparation of a kit for detecting protein E2-2.

7. Use of the antibody or hybridoma cell of any one of items 1-5 in the manufacture of a kit for diagnosing various pDC related diseases.

8. The use according to item 7, wherein the disease is selected from the group consisting of Pitt-Hopkins syndrome, schizophrenia, solid tumors infiltrated with pDC, lymphomas of plasmacytoid dendritic cells, and other diseases associated with pDC frequency changes.

Specifically, the E2-2(TCF4) protein is expressed by a prokaryotic expression system, a Balb/c mouse is immunized, a hybridoma cell strain E2-22G 8 is obtained by screening through an ELISA and immunohistochemical method, and a monoclonal antibody specifically binding with the human E2-2 protein can be generated. The E2-22G 8 antibody can specifically bind to E2-2 in immunoenzymatic assays (ELISA), immunoblotting (Western) and immunohistochemical experiments.

The invention utilizes a molecular cloning method to clone and obtain an E2-2(TCF4) eukaryotic expression vector for expressing partial genes. The protein of part E2-2(TCF4) was expressed using a eukaryotic expression system. Balb/c mice were immunized with 60ugE2-2 protein in combination with CpG to obtain hybridoma cells. A monoclonal antibody hybridoma cell strain resisting human E2-2 is obtained by screening through an ELISA and immunohistochemical method, wherein the monoclonal antibody hybridoma cell strain is E2-22G 8, and the subtype of the monoclonal antibody is IgG2 a. The hybridoma cell has been deposited in the general microbiological center of China Committee for culture Collection of microorganisms (CGMCC) at 11/9/2015 with the collection number of CGMCC No.11494 and the name of E2-22G 8. Monoclonal antibody E2-22G 8 secreted by the antibody was shown to recognize pDCs in tissues by immunohistochemistry.

The inventor adopts a fragment of E2-2 to screen monoclonal antibodies, and the coding sequence of the fragment is shown as SEQ ID NO: 1 is shown.

CTAGAAATGGAGGACAGGCCTCATCGTCTCCTAATTATGAAGGACCCTTACACTCTTTGCAAAGCCGAATTGAAGATCGTTTAGAAAGACTGGATGATGCTATTCATGTTCTCCGGAACCATGCAGTGGGCCCATCCACAGCTATGCCTGGTGGTCATGGGGACATGCATGGAATCATTGGACCTTCTCATAATGGAGCCATGGGTGGTCTGGGCTCAGGGTATGGAACCGGCCTTCTTTCAGCCAACAGACATTCACTCATGGTGGGGACCCATCGTGAAGATGGCGTGGCCCTGAGAGGCAGCCATTCTCTTCTGCCAAACCAGGTTCCGGTTCCACAGCTTCCTGTCCAGTCTGCGACTTCCCCTGACCTGAACCCACCCCAGGACCCTTACAGAGGCATGCCACCAGGACTACAGGGGCAGAGTGTCTCCTCTGGCAGCTCTGAGATCAAATCCGATGACGAGGGTGATGAGAACCTGCAAGACACGAAATCTTCGGAGGACAAGAAATTAGATGACGACAAGAAGGATATCAAATCAATTACTAGGTCAAGATCTAGCAATAATGACGATGAGGACCTGACACCAGAGCAGAAGGCAGAGCGTGAGAAGGAGCGGAGGATGGCCAACAATGCCCGAGAGCGTCTGCGGGTCCGTGACATCAACGAGGCTTTCAAAGAGCTCGGCCGCATGGTGCAGCTCCACCTCAAGAGTGACAAGCCCCAGACCAAGCTCCTGATCCTCCACCAGGCGGTGGCCGTCATCCTCAGTCTGGAGCAGCAAGTCCGAGAAAGGAATCTGAATCCGAAAGCTGCGTGTCTGAAAAGAAGGGAGGAAGAGAAGGTGTCCTCAGAGCCTCCCCCTCTCTCCTTGGCCGGCCCACACCCTGGAATGGGAGACGCATCGAATCACATGGGACAGATGTAA

Using the immunoblotting (Western) method, it was confirmed that E2-22G 8 specifically binds to E2-2 protein in pDCs cell line Gen 2.2.

Drawings

FIG. 1E 2-2 Gene expression plasmid

FIG. 2E 2-2 identification of protein concentration

And (3) loading sequence:

0. protein marker

1.BSA 2ug

2.BSA 4ug

3.E2-2half 2ug

4.E2-2half 4ug

FIG. 3 monoclonal antibody E2-22G 8 recognizes E2-2 protein

A.Marker

e2-22G 8 and internal reference Tubulin

FIG. 4E 2-22G 8 recognizes pDC cells in tonsils

FIG. 5E 2-22G 8 recognizes pDC cells (IF) in psoriatic tissue

FIG. 6E 2-22G 8 recognizes pDC cells in diseased tissue

Detailed Description

Example 1 plasmid construction and protein expression

Plasmid construction and inducible expression

The full-length gene E2-2 was obtained from pCR in human brain cDNA library (Invitrogen) with primer sequences 5'-GAGTGTCTCCTCTGGCAGC-3' and 5'-CCATGTGATTCGATGCGTC-3', and E2-2 was obtained as a fragment (NM-001083962.1 fragment 1700-2628) using XbaI and XhoI endonucleases (NEB) and cloned into pET28a (Invitrogen), i.e., pET28a-E2-2half (as shown in FIG. 1). .

Transferring the constructed plasmid into BL21 competence, coating a flat plate, inoculating the strain in 100ml culture medium for shaking overnight, inoculating the strain in 1L culture medium (1: 100) for shaking for 3h until OD is about 0.6, cooling to 16 ℃, and adding IPTG (1mM) for inducing 16h for strain collection.

Purification of proteins

Centrifuging to collect induced bacteria, adding protease inhibition (sigma), ultrasonic crushing, centrifuging to collect supernatant, and purifying with HIS-labeled nickel column.

The His-tagged protein was purified using a nickel column as follows: (1) assembling a nickel column: to the column was added 2 ml of purification medium agarose (GE). 100uM of nickel sulfate (10 ml) was added to the upper layer of the medium, and the liquid was left naturally. (2) The column was equilibrated by washing the nickel column with 20 ml of binding buffer (20mM Na2HPO4/0.5M NaCl). (3) The collected supernatant was diluted with the binding buffer in equal volume, applied to a nickel column and the effluent was collected. The effluent can be re-applied to the nickel column for re-binding of the protein. (4) The non-specifically bound proteins were washed off by washing the nickel column with 100ml of washing buffer (20mM Na2HPO4/0.5M NaCl/10mM imidazole/pH 7.4). (5) The protein was eluted with 10 ml of elution buffer (500mM NaCl/20mM Tris base/1M imidazole pH 7.9), and the eluate of the elution, i.e., the target protein, was collected as E2-2 protein as an immunogen. (6) Protein concentration was determined by protein electrophoresis and stained with Coomassie blue (as shown in FIG. 2).

EXAMPLE 2 monoclonal antibody preparation and characterization

Mouse immunization protocol

After the immunogen of E2-2 was prepared, mice used to prepare monoclonal antibodies were immunized. The process is as follows: (1) three BABL/c mice (Witongliwa) were prepared at 6-7 weeks. (2) 60ugE2-2 protein was mixed with 20mg CpG1826(invitrogen), the volume was adjusted to 500uL physiological saline, and the mixture was mixed and injected intraperitoneally into mice. (3) Three immunizations were completed once every four weeks. (4) Blood was collected one week after the third immunization, 96-well plates were coated with E2-2 protein, and the titer of E2-2 antibody in serum was measured by ELISA. (5) A fourth boost was performed with E2-2 protein and hybridoma cell fusion was performed 3 days later.

Hybridoma cell fusion and screening

The fusion method of the hybridoma cell comprises the following steps: (1) blood was collected from the eyes of the mice after the boost, and the mice were left at room temperature for 30 minutes and then left to stand at 4 ℃ overnight. And centrifuging at low speed on the next day, and subpackaging and freezing the serum of the mouse. (2) In a 10cm petri dish, 10 ml of RPMI1640 medium was added. The spleen of a mouse is cut into small fragments by scissors, and then the small fragments are fully ground by the frosted surface of a sterile cover glass to obtain cell suspension. Repeatedly blowing and beating by using a pipette to ensure that the single cell suspension is formed as much as possible. Filtration through a 0.45um filter into a 50 ml centrifuge tube was performed. (3) After centrifugation, the supernatant was discarded, the cell pellet was flicked to loosen it, and 2 ml of erythrocyte lysate was added for treatment. After 2 minutes 50 ml of RPMI1640 medium was added and centrifuged rapidly. Cell counts were performed after two washes with PBS, approximately 3X 10⁸And (4) spleen cells. (4) Taking 4T 75sp20 cells, cell count gave sp20 cells at approximately 3X 10⁸And (4) respectively. PBS was washed three times and centrifuged at 200 g/min for 10min at room temperature. (5) Mixing sp20 cells and splenocytes at a ratio of 1: 1-1: 3. 1500 rpm, centrifugation at room temperature for 10 minutes. The supernatant was discarded and the cell pellet was flicked to loosen. (6) Prepare a 37 ℃ water bath, place the cells in the water bath, shake the 50 ml centrifuge tube, add 2 ml of pre-heated PEG 2000 drop by drop. (7) Pre-warmed 40 ml RPMI1640 medium was added to resuspend the cells. The cells were mixed by inverting the top and bottom. 1500 rpm, centrifugation at room temperature for 10 minutes. (8) The supernatant was removed, the cells were placed in a 37 ℃ water bath, 10 ml/plate of complete medium containing HAT was added, and the mixture was mixed by inverting the top and bottom. About 100 microliters of 2 drops of fluid were added per well. (9) After about one week of culture, each clone was proliferated to about 10 cells, and ELISA detection was performed.

Detection by ELISA method

The E2-2 antibody was detected in the supernatant by ELISA (1) a 96-well ELISA plate was coated with E2-2 protein prepared in example 1, the protein was diluted to a final concentration of 5. mu.g/mL in PBS, 100. mu.L was added to each well, and the plate was coated overnight at 4 ℃. (2) Wash once with wash solution (PBS/0.05tween20/pH7.5, sigma) and add 200. mu.L of blocking solution (PBS/0.5% BSA/pH7.5) per well and block for 2h at room temperature. (3) Washing with lotion for three times, adding 100 μ L of immune E2-2 protein mouse serum (requiring 10-fold dilution, i.e. 10000,50000, 100000,500000,1000000) and 100 μ L of corresponding sample to be tested (i.e. cell culture supernatant), mixing by shaking table, and reacting at room temperature at 100 r/min for 2 h. (4) Washing with washing solution three times, adding 100 μ L biotin-labeled antibody (China fir gold bridge) for detecting goat anti-mouse IgG into each well, and reacting at room temperature for 1 h. (5) Washing with washing solution three times, adding 100 μ L streptavidin labeled horse radish peroxidase reagent (China fir gold bridge) per well, and reacting at room temperature for 1 h. (6) Washing with washing solution for three times, adding 100 μ L TMB substrate into each well, mixing with shaking table, and reacting at room temperature at 100 rpm for 10 min. When the highest concentration of standard protein wells appeared dark blue, 50. mu.L of stop solution (2M sulfuric acid) was added to each well. (7) The spectrophotometer recorded the light absorption at 450.1nm, i.e., the OD, and selected higher than the mouse polyclonal antibody value for immunohistochemical detection (mouse polyclonal antibody is derived from mouse serum of immunized E2-2 protein).

Through an ELISA method, clones of E2-2 antibodies 1G4, 1G6, 2G8, 4B5 and 10F7 are obtained through screening, and OD values are obviously higher than those of mouse polyclonal antibodies. To further validate the antibodies, immunohistochemical experiments were performed.

SDS-PAGE and immunoblotting experiments

(1) The protein sample was subjected to SDS-PAGE by adding 5 XSDS buffer and boiling at 100 ℃ for 5 min.

(2) If a western experiment is not needed, the protein gel is directly stained by Coomassie brilliant blue after electrophoresis is finished, and the experimental result is observed after decoloration (the experiment shown in figure 2), and if the western experiment is needed, the step (3) is carried out.

(3) Film transfer: the samples were transferred from the gel onto PVDF membrane at a constant current of 250mA for 2 h.

(4) And (3) sealing: PVDF membrane was blocked with Blocking buffer (PBS/0.5% BSA/pH7.5) for 1h at room temperature.

(5) Primary antibody incubation: an appropriate amount of primary antibody (E2-22G 8: concentration 1-5ng/mL) was added and incubated overnight at 4 ℃.

(6) Rinsing: PVDF membrane was washed three times with TBST for 10min each.

(7) And (3) secondary antibody incubation: the corresponding secondary antibody (horseradish peroxidase-labeled goat anti-mouse IgG antibody, sequoia jessamine) was added and incubated at room temperature for 1 h.

(8) Rinsing: PVDF membrane was washed three times with TBST, 10min each time, and finally once with TBS.

(9) And (3) film washing: the PVDF membrane was incubated with horseradish peroxidase substrate (Millipore corporation) for 3min, and the results were obtained by the steps of sheeting, developing, fixing, washing, air-drying in a dark room (FIG. 3).

Immunohistochemical method of detection

Clones with higher OD values, 1G4, 1G6, 2G8, 4B5 and 10F7, were tested by ELISA and further tested by immunohistochemical staining. Because pDCs cells highly express E2-2 protein, tonsil tissues were selected for detection of E2-2. (1) Dewaxing and hydrating: the xylene I, the xylene II, the xylene III and the xylene IV are respectively soaked for 5 minutes, and the absolute ethyl alcohol I, the absolute ethyl alcohol II, 95 percent ethyl alcohol and 75 percent ethyl alcohol are respectively soaked for 5 minutes. PBS wash 2 times for 5 minutes each. (2) And (5) repairing the antigen, heating the steamer for 40min, and balancing the room temperature for 60 min. PBS wash 2 times for 5 minutes each. (3) Treated with 3% H2O2 (80% methanol dilution) and allowed to stand at room temperature for 10 minutes. PBS wash 2 times for 5 minutes each. (4) 10% normal goat serum confining liquid is dripped, the temperature is kept for 30 minutes, and the redundant liquid is thrown off. (5) Hybridoma culture supernatant was added dropwise and left overnight at 4 ℃. PBS was washed 3 times for 5 minutes each (30 minutes at room temperature if 4 ℃ overnight). (6) The secondary antibody (Taxus chinensis: P6001/6002) was added dropwise at 37 ℃ for 30 minutes. PBS was washed 3 times for 5 minutes each. (7) DAB was developed for 1-10 min and the degree of staining was monitored under a microscope. The tap water is flushed for 30 seconds, which can count 1 to 30. (8) Hematoxylin counterstain for 30 seconds. The tap water is flushed for 30 seconds, which can count 1 to 30. (9) Dehydrating and transparent: 75 percent ethanol, 95 percent ethanol, absolute ethanol II, absolute ethanol I, xylene IV, xylene III, xylene II and xylene I are respectively soaked for 3 minutes. 10) And (5) sealing the neutral gum.

The results showed that E2-22G 8 was able to recognize the E2-2 protein in human tonsil tissue and co-stained with pDC cell marker CD123, indicating that E2-22G 8 was able to recognize pDC cells in human tonsil tissue (see results in FIG. 4).

Hybridoma cell expansion and ascites preparation

After positive clones were obtained, the cells were subcloned until monoclonal antibodies were obtained. The monoclonal hybridoma cell strain can be cultured in a large scale or used for immunizing a mouse to obtain ascites so as to prepare the antibody. The preparation method of ascites comprises: (1) 6-8 weeks of NOG (NOD/SCID/IL-2R gamma null) immunodeficient mice (Jackson Lab) were injected intraperitoneally one week earlier with 0.5 ml of a lipid-lowering alkane. (2) Screening the obtained positive hybridoma clones, transferring the clones to a 24-well plate for continuous culture after the clones proliferate to 50% coverage, and carrying out expanded culture to a T75 culture flask. And (4) taking a proper amount of hybridoma cells for freezing storage. (3) Hybridoma cells were harvested from T75 flasks, 1500 rpm, and centrifuged at room temperature for 5 minutes. (4) The supernatant was discarded, the cells were resuspended in PBS, 1500 rpm, and centrifuged for 5 minutes at room temperature. PBS washing was repeated once, then use PBS cell heavy suspension to 4X 106/ml. (5) The hybridoma cells were injected intraperitoneally into mice treated with lipid-lowering alkane for one week. (6) After 1-2 weeks, the abdominal cavity of the mouse is enlarged, the mouse is killed by removing the neck, and ascites is extracted with a 10 ml syringe, so that 2-5 ml of ascites is obtained from each mouse. (7) Centrifuging at low temperature and high speed, and packaging the supernatant into new EP tubes at-80 deg.C.

Monoclonal antibody purification

The antibody was purified from ascites fluid using Protein G, according to the following procedure: (1) the protein G pre-column (GE) and the buffer required for purification were equilibrated to room temperature. (2) The antibody was diluted in an equal volume of binding buffer (20mM sodium phosophate buffer, pH 7.0). 1 ml of ascites fluid was taken and 1 ml of binding buffer was added. (3) The protein G pre-packed column was placed in a 15 ml centrifuge tube and the storage buffer in the column was allowed to flow out spontaneously. 5 ml of binding buffer was added and the column pre-packed with protein G was equilibrated. (4) The diluted ascites was applied to the column and the effluent was collected. (5) The column was washed by adding 15 ml of binding buffer and the first 2 ml of wash (0.1M glycine, pH 2.7-3.0) and the last 2 ml of wash were collected. (6) 5 EP tubes were taken and 100. mu.l of neutralization buffer (1M Tris-HCl, pH 9) was added to each tube. 5 ml of elution buffer is added, 1 ml of elution liquid is collected in each tube and is rapidly and uniformly mixed, and the phenomenon that the local pH value is too low to cause the loss of activity of the protein is prevented. (7) The purity of the purified antibody was checked by Coomassie blue staining.

Immunofluorescence staining

(1) Dewaxing and hydrating: the xylene I, the xylene II, the xylene III and the xylene IV are respectively soaked for 5 minutes, and the absolute ethyl alcohol I, the absolute ethyl alcohol II, 95 percent ethyl alcohol and 75 percent ethyl alcohol are respectively soaked for 5 minutes. PBS wash 2 times for 5 minutes each. (2) And (5) repairing the antigen, heating the steamer for 40min, and balancing the room temperature for 60 min. PBS wash 2 times for 5 minutes each. (3) Treated with 3% H2O2 (80% methanol dilution) and allowed to stand at room temperature for 10 minutes. PBS wash 2 times for 5 minutes each. (4) 10% normal goat serum confining liquid is dripped, the temperature is kept for 30 minutes, and the redundant liquid is thrown off. (5) Primary antibody (E2-2 antibody, E2-22G 8) was added dropwise thereto, and the mixture was allowed to stand at room temperature for 1 hour or overnight at 4 ℃. PBS was washed 3 times for 5 minutes each (30 minutes at room temperature if 4 ℃ overnight). (6) A fluorescent secondary antibody (Alesa Fluor 488-labeled goat anti-mouse IgG antibody, invitrogen) was added dropwise thereto at 37 ℃ for 30 minutes. PBS was washed 3 times for 5 minutes each. (7) DAPI staining was performed for 1min and 3 times for 3min in PBS. (8) Using anti-fluorescence attenuation sealing agent to seal the piece, and using nail polish to seal the periphery of the piece for a circle. Storage at 4 ℃ or observation by a fluorescence microscope. The results show that clone E2-22G 8 can identify pDC cells in human psoriatic skin tissue by immunofluorescence (see FIG. 5 for results).

Example 3 monoclonal antibody Studies of pDCs in recognized tissues

Expression of the E2-2 antibody E2-22G 8 in pDCs cells in various tissues was verified using immunohistochemical methods as described previously. E2-2 positive pDCs were identified on tonsil tissue, liver cancer tissue, pancreatic cancer lymph nodes, breast cancer lymph nodes, Peyer's patches (colon cancer) and BPDCN skin tissue, respectively (see results in FIG. 6).

Reference to the literature

1.Cisse,B.,et al.,Transcription factor E2-2is an essential and specific regulator of plasmacytoid dendritic cell development.Cell,2008.135(1):p.37-48.

2.Murre,C.,Helix-loop-helix proteins and lymphocyte development.Nat Immunol,2005.6(11):p.1079-86.

3.Sepp,M.,et al.,Functional diversity of human basic helix-loop-helix transcription factor TCF4 isoforms generated by alternative 5'exon usage and splicing.PLoS One,2011.6(7):p.e22138.

4.Corneliussen,B.,et al.,Calcium/calmodulin inhibition of basic-helix-loop-helix transcription factor domains.Nature,1994.368(6473):p.760-4.

5.Saarikettu,J.,N.Sveshnikova,and T.Grundstrom,Calcium/calmodulin inhibition of transcriptional activity of E-proteins by prevention of their binding to DNA.J Biol Chem,2004.279(39):p.41004-11.

6.Nagasawa,M.,et al.,Development of human plasmacytoid dendritic cells depends on the combined action of the basic helix-loop-helix factor E2-2and the Ets factor Spi-B.Eur J Immunol,2008.38(9):p.2389-400.

7.Spits,H.,et al.,Id2and Id3inhibit development of CD34(+)stem cells into predendritic cell(pre-DC)2 but not into pre-DC1.Evidence for a lymphoid origin of pre-DC2.J Exp Med,2000.192(12):p.1775-84.

8.Ghosh,H.S.,et al.,Continuous expression of the transcription factor e2-2 maintains the cell fate of mature plasmacytoid dendritic cells.Immunity,2010.33(6):p.905-16.

9.Jacob,M.C.,et al.,CD4+CD56+lineage negative malignancies:a new entity developed from malignant early plasmacytoid dendritic cells.Haematologica,2003.88(8):p.941-55.

10.Herling,M.,et al.,TCL1 expression in plasmacytoid dendritic cells(DC2s)and the related CD4+CD56+blastic tumors of skin.Blood,2003.101(12):p.5007-9.

11.Marafioti,T.,et al.,Novel markers of normal and neoplastic human plasmacytoid dendritic cells.Blood,2008.111(7):p.3778-92.

12.Montes-Moreno,S.,et al.,SPIB,a novel immunohistochemical marker for human blastic plasmacytoid dendritic cell neoplasms:characterization of its expression in major hematolymphoid neoplasms.Blood,2013.121(4):p.643-7.

13.Fu,H.,et al.,A genome-wide screen for spatially restricted expression patterns identifies transcription factors that regulate glial development.J Neurosci,2009.29(36):p.11399-408.

14.Flora,A.,et al.,The E-protein Tcf4 interacts with Math1 to regulate differentiation of a specific subset of neuronal progenitors.Proc Natl Acad Sci U S A,2007.104(39):p.15382-7.

15.Persson,P.,et al.,HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex.Biochem Biophys Res Commun,2000.274(1):p.22-31.

16.Einarson,M.B.and M.V.Chao,Regulation of Id1 and its association with basic helix-loop-helix proteins during nerve growth factor-induced differentiation of PC12 cells.Mol Cell Biol,1995.15(8):p.4175-83.

17.Ravanpay,A.C.and J.M.Olson,E protein dosage influences brain development more than family member identity.J Neurosci Res,2008.86(7):p.1472-81.

18.Steinberg,S.,et al.,Common variants at VRK2 and TCF4 conferring risk of schizophrenia.Hum Mol Genet,2011.20(20):p.4076-81.

19.Amiel,J.,et al.,Mutations in TCF4,encoding a class I basic helix-loop-helix transcription factor,are responsible for Pitt-Hopkins syndrome,a severe epileptic encephalopathy associated with autonomic dysfunction.Am J Hum Genet,2007.80(5):p.988-93.

20.Brockschmidt,A.,et al.,Severe mental retardation with breathing abnormalities(Pitt-Hopkins syndrome)is caused by haploinsufficiency of the neuronal bHLH transcription factor TCF4.Hum Mol Genet,2007.16(12):p.1488-94.

21.Zweier,C.,et al.,Haploinsufficiency of TCF4 causes syndromal mental retardation with intermittent hyperventilation(Pitt-Hopkins syndrome).Am J Hum Genet,2007.80(5):p.994-1001.

22.Cardno,A.G.,et al.,A twin study of genetic relationships between psychotic symptoms.Am J Psychiatry,2002.159(4):p.539-45.

23.Barnes,M.R.,et al.,Transcription and pathway analysis of the superior temporal cortex and anterior prefrontal cortex in schizophrenia.J Neurosci Res,2011.89(8):p.1218-27.

24.Navarrete,K.,et al.,TCF4(e2-2；ITF2):a schizophrenia-associated gene with pleiotropic effects on human disease.Am J Med Genet B Neuropsychiatr Genet,2013.162B(1):p.1-16.

Claims (3)

1. A monoclonal antibody hybridoma cell strain resisting human E2-2 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.11494 and the name of E2-22G 8.

2. A monoclonal antibody directed against protein E2-2, which is secreted by the hybridoma cell of claim 1.

3. Use of the antibody or hybridoma cell of any one of claims 1 to 2 for the preparation of a kit for the detection of protein E2-2.

Images