CN106701909B - Primer probe, method and kit for detecting sweet potato-derived components - Google Patents
Primer probe, method and kit for detecting sweet potato-derived components Download PDFInfo
- Publication number
- CN106701909B CN106701909B CN201510793791.2A CN201510793791A CN106701909B CN 106701909 B CN106701909 B CN 106701909B CN 201510793791 A CN201510793791 A CN 201510793791A CN 106701909 B CN106701909 B CN 106701909B
- Authority
- CN
- China
- Prior art keywords
- sweet potato
- probe
- derived components
- derived
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an oligonucleotide primer and a probe for detecting sweet potato-derived components. The invention also relates to a real-time fluorescence PCR detection method for determining the sweet potato-derived components, which comprises the use of specific oligonucleotide primers and probes aiming at the sweet potato-derived components. The invention also relates to a real-time fluorescence PCR detection kit for rapidly detecting the sweet potato-derived components, wherein the kit comprises specific oligonucleotide primers and probes for detecting the sweet potato-derived components by real-time fluorescence PCR. The invention also relates to the application of the specific oligonucleotide primer and the probe aiming at the sweet potato-derived component in detecting the sweet potato-derived component. By using the real-time fluorescent PCR detection method and the kit, whether the samples such as starch, vermicelli, potato chips, cakes and the like contain sweet potato-derived components can be specifically, sensitively and accurately determined.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an oligonucleotide primer and a probe for detecting sweet potato-derived components, a real-time fluorescent PCR detection method for detecting the sweet potato-derived components, a real-time fluorescent PCR detection kit for rapidly detecting the sweet potato-derived components, and application of the specific oligonucleotide primer and the probe of the sweet potato-derived components in detecting the sweet potato-derived components in a sample.
Background
Sweet potato original name (sweet potato)Ipomoea batatas) Also named sweet potato, yam, sweet potato, etc. The sweet potato is rich in protein, starch, pectin, cellulose, amino acid, vitamin and various mineral substances, and has the reputation of longevity food. Sweet potato starch is one of the foods with multiple nutritional types and high comprehensive nutritional value in crops. The sweet potato starch is mainly used for processing vermicelli and noodles, particularly in Hebei, Henan and Shandong areas, the deep processing of the starch is in a large scale, and some products are exported to Japan, Korea and other countries.
Because the price of the sweet potato starch is higher than that of the corn starch, some sweet potato starch production enterprises mix the corn starch in the sweet potato starch for sale, and profit is obtained. In 2007, the Hunan quality supervision department investigates and disposes sweet potato vermicelli made of corn starch. In the vermicelli processing, because the sweet potato starch purchased by manufacturers is mixed with corn starch, the quality of the vermicelli is sharply reduced, the pulverizing rate is up to more than 30 percent, and the sales of the vermicelli is seriously influenced. In 2011 and 12 months, the Xinlang network reports that sweet potato vermicelli with cassava starch like appears in the southwestern Schchang, and gelatin is used for enhancing the strength of the vermicelli. The above starch adulteration events not only harm the consumer's interests and disturb the starch market, but also have a great negative impact on starch application, such as a significant deterioration in the mouthfeel and cooking resistance of the noodles.
In view of this, the scholars establish a detection method for determining whether the sweet potato starch is mixed with the corn starch or not based on the principle that the composition structures of the corn starch and the sweet potato starch are different, so that the two starches show different color development when encountering iodine preparations, and the like, and determine the content of the corn starch in the mixed starch by using a spectrophotometer to determine the absorbance value of the mixed starch test solution. In addition, researches show that the content of the corn starch in the sweet potato starch can be rapidly determined by analyzing the property change of the sweet potato starch added with corn starch in different proportions by adopting a scanning electron microscope, a laser particle size analyzer, a rapid viscosity analyzer and an X-ray diffractometer.
The modern biotechnology analyzes the sources and characteristics of raw materials and products from the gene level by the characteristics of convenience, rapidness, accuracy and the like, has strong specificity and high sensitivity, and is widely applied to food identification research such as food type identification, origin tracing and the like. However, molecular biology technology, especially real-time fluorescence PCR technology, has less application in identifying adulterated edible starch, and has not been reported in identifying sweet potato starch. In recent years, real-time fluorescence PCR technology is widely adopted in the counterfeit identification research of foods such as meat products, fruit juice, bee products, aquatic products and the like.
At present, no report exists at home and abroad on a method and a kit which can quickly, simply, conveniently, specifically and sensitively detect sweet potato-derived components in samples such as starch, vermicelli, potato chips, cakes and the like.
Therefore, a method for detecting sweet potato-derived components in samples such as starch, vermicelli, potato chips, cakes and the like is needed in the field, wherein the method is rapid, good in specificity and high in sensitivity.
Disclosure of Invention
The invention aims to provide specific oligonucleotide primers and probes for accurately detecting sweet potato-derived components.
The invention also aims to provide a real-time fluorescence PCR detection method for accurately determining the sweet potato-derived components.
The invention also aims to provide a real-time fluorescence PCR detection kit for accurately determining the sweet potato-derived components.
The invention also aims to provide the application of the specific oligonucleotide primer and the probe of the sweet potato-derived component in accurately detecting the sweet potato-derived component.
Aiming at the above purpose, the invention provides the following technical scheme:
the inventor of the invention bases on sweet potatoesg3pdhAn oligonucleotide primer pair and a probe which can specifically identify sweet potato-derived components are designed in the gene (glyceraldehyde-3-phosphate dehydrogenase gene), and a short sweet potato specific gene fragment can be efficiently and specifically amplified from sample DNA. According to one embodiment of the invention, the invention provides a specific oligonucleotide primer pair and a fluorescence labeling probe for detecting sweet potato-derived ingredients by a real-time fluorescence PCR method, wherein the primer pair and the probe are based ong3pdhThe gene sequence has different characteristics in different species. The primer pair consists of an upstream primer and a downstream primer, wherein the upstream primer is Sweet potatoto-F: CAAAAGCACGGCACTAGTCA (SEQ ID No. 1), wherein the downstream primer is Sweet potatoto-R: AGTGAGACAGGGGAAGTGGA (SEQ ID No. 2); the probe is Sweet potato-P: CCCAGCAACCGCTCTTTATA (SEQ ID No. 3), a fluorescence quencher TAMAR linked to the 3 'end of the probe, and a fluorescence reporter FAM linked to the 5' end. In one embodiment, the invention provides a sweet potato specific detection composition, which comprises a specific oligonucleotide primer pair and a probeAnd (3) a needle. In a preferred embodiment, the invention provides a composition for qualitatively detecting sweet potato-derived ingredients by a real-time fluorescent PCR method, wherein the composition comprises a sweet potato-specific oligonucleotide primer pair and a probe, wherein the sweet potato-specific primer pair consists of an upstream primer and a downstream primer, the base sequence of the upstream primer is SEQ ID No.1, and the base sequence of the downstream primer is SEQ ID No. 2; the base sequence of the probe is SEQ ID No.3, the 3 'end of the probe is connected with a fluorescence quenching group TAMAR, and the 5' end of the probe is connected with a fluorescence reporting group FAM.
According to another embodiment of the invention, the invention provides a real-time fluorescent PCR qualitative detection method of sweet potato-derived components, which comprises using specific oligonucleotide primer pairs and probes aiming at the sweet potato-derived components, wherein the primer pairs and the probes are based ong3pdhThe gene sequence has different characteristics in different species. In one embodiment, in the method for qualitatively detecting the sweet potato-derived component by real-time fluorescence PCR, the used sweet potato-specific oligonucleotide primer pair consists of an upstream primer and a downstream primer, wherein the base sequence of the upstream primer is SEQ ID No.1, and the base sequence of the downstream primer is SEQ ID No. 2; the base sequence of the probe is SEQ ID No.3, the 3 'end of the probe is connected with a fluorescence quenching group TAMAR, and the 5' end of the probe is connected with a fluorescence reporting group FAM. In one embodiment, the PCR amplification conditions are 95 ℃ for 10 min; at 95 ℃ for 15 s and 60 ℃ for 1 min, for 40 cycles.
According to another embodiment of the invention, the invention provides a kit for accurately and qualitatively detecting sweet potato-derived components, which comprises the specific oligonucleotide primer pair for detecting the sweet potato-derived components by the real-time fluorescent PCR method, the probe and the use instruction. In a preferred embodiment of the kit of the invention, the specific oligonucleotide primer pair for qualitatively detecting the sweet potato-derived component of the invention is based ong3pdhThe gene sequence has different characteristics in different species. In one embodiment, the sweet potato specific oligonucleotide primer pair of the kit consists of an upstream primer and a downstream primerThe base sequence of the upstream primer is SEQ ID No.1, and the base sequence of the downstream primer is SEQ ID No. 2; the base sequence of the probe in the kit is SEQ ID No.3, the 3 'end of the probe is connected with a fluorescence quenching group TAMAR, and the 5' end of the probe is connected with a fluorescence reporting group FAM. According to another embodiment of the invention, the invention provides a kit for accurately and qualitatively detecting sweet potato-derived components, which comprises the specific oligonucleotide primer pair and probe for identifying the sweet potato-derived components by the real-time fluorescent PCR method and an instruction for use. In a preferred embodiment of the kit, the kit comprises a sweet potato specific oligonucleotide primer pair SEQ ID No.1, SEQ ID No.2 and a sweet potato specific probe SEQ ID No.3 in sweet potatoesg3pdhThe 3 'end of the gene probe is connected with a fluorescence quenching group TAMAR, and the 5' end is connected with a fluorescence reporter group FAM. In a preferred embodiment, the instruction book of the kit comprises a description of real-time fluorescent PCR amplification conditions for rapidly detecting the sweet potato-derived ingredients. In a preferred embodiment, the PCR amplification conditions given in the instructions for the kit are 95 ℃, 10 min; at 95 ℃ for 15 s and 60 ℃ for 1 min, for 40 cycles. In a specific embodiment, the kit for qualitatively detecting sweet potato-derived components further comprises a reference substance. Preferably, the control comprises a negative control and a positive control. In one embodiment, the negative control is cassava DNA.
According to another embodiment of the invention, the invention provides the application of the specific oligonucleotide primer and the probe for detecting the sweet potato-derived component by the real-time fluorescent PCR method in detecting the sweet potato-derived component in a sample. In a preferred embodiment, the invention provides specific oligonucleotide primer pairs SEQ ID No.1 and SEQ ID No.2 and specific probes SEQ ID No.3 of sweet potato derived components in a sampleg3pdhThe 3 'end of the gene probe is connected with a fluorescence quenching group TAMAR, and the 5' end is connected with a fluorescence reporter group FAM. In another embodiment, the invention also provides application of the kit provided by the invention in qualitative detection of sweet potato-derived components in a sample. Preferably, the first and second electrodes are formed of a metal,in the above applications of the present invention, the method comprises the sweet potato specific oligonucleotide primer pair and the probe of the present invention. More preferably, in the above application of the present invention, the kit comprises the application of the sweet potato specific oligonucleotide primer pair and the probe of the present invention in detecting sweet potato-derived components.
The invention takes the DNA of the sweet potato as the detection basisg3pdhThe gene sequences have the characteristic of difference in different species, and sweet potatoes are compared and analyzedg3pdhA gene sequence. And designing primers according to the sequences, and utilizing a real-time fluorescent PCR method to qualitatively detect the sweet potato-derived components in the sample.
Real-time fluorescent quantitative PCR is that on the basis of a conventional PCR method, a probe or a fluorescent dye which is fluorescently labeled is added, a fluorescent signal emitted by the probe or the dye is enhanced along with the accumulation of a PCR product, and a fluorescent monitoring system can receive the fluorescent signal, namely, one fluorescent molecule is formed every time one DNA chain is generated, so that the complete synchronization of the accumulation of the fluorescent signal and the formation of the PCR product is realized. Therefore, the whole PCR reaction process can be monitored in real time, and the initial copy number of the sample to be detected can be finally detected, so that the sweet potato-derived components contained in the sample to be detected, such as starch, vermicelli, potato chips, cakes and the like can be detected.
The real-time fluorescent PCR detection method adopts complete closed-tube detection, does not need PCR post-treatment, and avoids cross contamination and false positive. The method skillfully utilizes the high-efficiency DNA amplification of the PCR technology, the specificity of nucleic acid hybridization and the rapidness and the sensitivity of the fluorescence detection technology, and has the advantages of simple operation, time and labor saving, reliable result, accuracy and sensitivity and the like. The kit prepared according to the primer sequence is used for qualitative detection of the products, and has the advantages of high sensitivity, strong specificity, stable and reliable result and avoidance of false positive caused by cross contamination. The PCR detection method and the PCR detection kit can be used for qualitative detection, and have the characteristics of simplicity, rapidness, specificity and sensitivity, so that the PCR detection method and the PCR detection kit are suitable for detection of sweet potato-derived components in samples such as starch, vermicelli, potato chips, cakes and the like in markets at home and abroad.
Drawings
FIG. 1 shows the results of specific detection of sweet potato by real-time fluorescent PCR, wherein specific oligonucleotide primers of SEQ ID No.1 and SEQ ID No.2 and SEQ ID No.3 are used for detection, wherein the amplification curve of the sweet potato sample is shown above the base line, and the amplification curve of the sweet potato sample is shown below the base line, and 28 kinds of samples such as cassava, taro, yam, potato, lotus root, corn, wheat, oat, barley, rye, rice, buckwheat, sorghum, pearl barley, millet, mung bean, red bean, cowpea, pea, hyacinth bean, kidney bean, broad bean, soybean, jujube, apricot, lily, olive and the blank control (sterile double distilled water) are shown below the base line.
FIG. 2 is a graph showing the evaluation of absolute sensitivity of specific detection of sweet potato components by real-time fluorescence PCR, in which a 10-fold gradient of a sweet potato DNA solution is diluted to 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L, 0.01 ng/. mu.L, 0.001 ng/. mu.L, 0.0001 ng/. mu.L, and a blank control (sterile double distilled water) in this order.
FIG. 3 is a graph showing the evaluation of the relative sensitivity of the real-time fluorescence PCR specific detection of sweet potato components, in which sweet potato starch and tapioca starch are mixed so that the mass ratios of the sweet potato starch and tapioca starch are 100%, 50%, 10%, 5%, 1%, 0.1%, and 0.01%, respectively.
FIG. 4 shows the results of the detection of a commercially available product by the real-time fluorescent PCR method established in the present invention. The part above the base line is positive control (sweet potato DNA), 3 parts (1 #, 2#, 3 #) of sweet potato starch, and the parts above the base line are cassava starch (1 # and 2 #), 2 parts (1 # and 2 #) of lotus root starch and blank control (sterile double distilled water).
Detailed Description
The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.
Example 1
This example is a test for evaluating the specificity and sensitivity of a primer pair and a probe for sweet potato.
By detectingg3pdhThe gene sequence can determine the specificity and the detection sensitivity of the sweet potato primer probe combination. The reaction system is as follows: fast Start Universal PCR Master Mix 12.5. mu.L; probe (10. mu.M) 0.5. mu.L; 0.5. mu.L of each of the upstream and downstream primers (10. mu.M); 5 mu L of template DNA; add ddH2O to a total volume of 25. mu.L. The reaction program is 95 ℃ for 10 min; 15 s at 95 ℃; 60 ℃ for 1 min, 40 cycles.
The used primers and probe sequences for detecting the sweet potatoes are as follows:
the primer sequences are SEQ ID No.1 and SEQ ID No.2, the probe sequence is SEQ ID No.3, the 3 'end is connected with a fluorescence quenching group TAMAR, and the 5' end is connected with a fluorescence reporter group FAM.
The detection main instruments used:
a micropipette (10 μ L, 100 μ L, 1000 μ L, Eppendorf), a fluorescent quantitative PCR instrument (ABI 7500, Applied Biosystems), a high-speed desktop centrifuge (Pico17 Thermo,), and the like.
Detecting main reagents:
chloroform and isopropanol were purchased from Beijing Liuhe Tong, respectively; CTAB lysate (20 g/L CTAB, 1.4 mol/L NaCl, 0.1 mol/L Tris, 0.02 mol/L Na)2EDTA), CTAB precipitation solution (5 g/L CTAB, 0.04 mol/L NaCl) and 1.2 mol/L NaCl are all prepared by the experiment; fast Start Universal Probe Master Mix (Rox) from Roche; the primers and probes were synthesized by Shanghai Yingjun Biotechnology GmbH, and the like.
The detection comprises the following main steps:
1 DNA extraction
Detecting a sample: (1) 29 samples of sweet potatoes, cassava, taros, Chinese yams, potatoes, lotus roots, corns, wheat, oats, barley, rye, rice, buckwheat, sorghum, coix seeds, millet, mung beans, red beans, cowpeas, peas, hyacinth beans, kidney beans, broad beans, soybeans, dates, apricots, lilies, olives and the like are used for specificity analysis; (2) diluting the extracted sweet potato DNA solution with sterile water to concentrations of 10 ng/muL, 1 ng/muL, 0.1 ng/muL, 0.01 ng/muL, 0.001 ng/muL and 0.0001 ng/muL respectively for analyzing the absolute sensitivity of the primer probe combination; (3) mixing sweet potato starch and cassava starch to ensure that the mass ratio of the sweet potato starch to the cassava starch is 100%, 50%, 10%, 5%, 1%, 0.1% and 0.01% respectively, so as to determine the relative sensitivity of the sweet potato specific primer probe combination.
Weigh 0.1 g of sample powder into a clean 2.0 mL centrifuge tubeAdding 1.5 mL CTAB lysate, inverting at 65 deg.C for 1 h, and mixing several times; 8000 rpm for 15 min, taking 1 mL of supernatant into 1 clean 2.0 mL centrifuge tube, adding 700 μ L of chloroform, violently mixing for 30 s, 14500 rpm for 10 min, respectively taking 650 μ L of supernatant into a clean 2.0 mL centrifuge tube, adding 1300 μ L of CTAB precipitation, violently mixing for 30 s, and standing at room temperature for 1 h; 14500 rpm for 10 min, discarding the supernatant, adding 350 μ L1.2M NaCl, shaking vigorously for 30 s, adding 350 μ L chloroform, mixing vigorously for 30 s, 14500 rpm for 10 min; collecting supernatant 320 μ L, adding 0.8 times volume of isopropanol, mixing, heating to-20 deg.C for 1 hr, 14500 rpm for 20min, discarding supernatant, adding 500 μ L70% ethanol, mixing, 14500 rpm for 20min, discarding supernatant, air drying, adding 100 μ L ddH2Dissolving O, and storing at 4 ℃ for later use.
2 primers and probes for real-time fluorescent PCR detection
The primer sequences are SEQ ID No.1 and SEQ ID No. 2;
the probe sequence is SEQ ID No.3, the 3 'end is connected with a fluorescence quenching group TAMAR, and the 5' end is connected with a fluorescence reporter group FAM.
3, real-time fluorescent PCR reaction system:
Fast Start Universal PCR Master Mix 12.5 μL
probe (10. mu.M) 0.5. mu.L
0.5. mu.L of upstream primer (10. mu.M)
Downstream primer (10. mu.M) 0.5. mu.L
Add ddH2O to a total volume of 25. mu.L
Note: setting corresponding blank control in each PCR detection (using ultrapure water for preparing a reaction system to replace a DNA template to detect whether a reagent is polluted);
4 real-time fluorescent PCR reaction parameters:
95℃ 10 min
95℃ 15 s
60℃ 1 min
40 cycles.
Note: the reagents and reaction parameters of PCR should be adjusted properly for different instruments.
As shown in FIG. 1, the method for specifically detecting sweet potatoes by using real-time fluorescent PCRg3pdhWhen the gene sequence is determined, except the typical S-shaped amplification curve of the sweet potato sample, other samples: 28 samples such as cassava, taro, Chinese yam, potato, lotus root, corn, wheat, oat, barley, rye, rice, buckwheat, sorghum, coix seed, millet, mung bean, red bean, cowpea, pea, hyacinth bean, kidney bean, broad bean, soybean, jujube, apricot, lily, olive and the like and blank control (sterile double distilled water) do not have amplification curves, and the primer probe designed in the experiment is fully proved to be specific to the sweet potato sample.
In order to determine the absolute detection limit of the combination of the specific primers and probes of sweet potato, the extracted DNA solution of sweet potato was diluted with sterile water to the concentrations of 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L, 0.01 ng/. mu.L, 0.001 ng/. mu.L and 0.0001 ng/. mu.L, respectively, and the real-time fluorescence PCR amplification was performed under the above conditions, and the results are shown in FIG. 2. The specific amplification curve is shown when the DNA concentration of sweet potato is 10 ng/muL, 1 ng/muL, 0.1 ng/muL, 0.01 ng/muL, and no specific amplification curve appears when the concentration is reduced below 0.01 ng/muL. The experimental result shows that the established real-time fluorescence PCR detection method can detect the content of the sweet potato component to be 0.01 ng/muL.
Sweet potato starch and cassava starch are mixed, the mass ratio of the sweet potato starch to the cassava starch is respectively 100%, 50%, 10%, 5%, 1%, 0.1% and 0.01%, and real-time fluorescence PCR amplification is respectively carried out according to the conditions to determine the relative sensitivity of the sweet potato specific primer probe combination (figure 3). The experimental result shows that the relative sensitivity of the method for detecting the sweet potato component is 0.1%.
Example 2
The embodiment provides a kit for accurately detecting sweet potato-derived components. The kit comprises a specific oligonucleotide primer pair and a probe for identifying the sweet potato-derived component by the real-time fluorescent PCR method and an instruction for use. The kit comprises a primer pair SEQ ID No.1, SEQ ID No.2 and a probe SEQ ID No.3, wherein the 3 'end of the probe is connected with a fluorescence quenching group TAMAR, the 5' end of the probe is connected with a fluorescence reporting group FAM, and the application instruction provides PCR amplification conditions which are 95 ℃ for 10 min; 15 s at 95 ℃; 60 ℃ for 1 min, 40 cycles. The reaction parameters were adjusted appropriately for the different instruments.
In order to ensure that the established method has feasibility, 7 parts of commercial samples including 2 parts of cassava starch (1 # and 2 #), 3 parts of sweet potato starch (1 #, 2#, 3 #), 2 parts of lotus root starch (1 # and 2 #), and the like are selected, and the real-time fluorescence PCR detection is carried out in the same way as the method described in the embodiment 1, wherein sterile double-distilled water is used as a blank reference substance of the kit, and sweet potato DNA is used as a positive reference substance of the kit.
As shown in FIG. 4, the real-time fluorescence PCR is used to detect sweet potatog3pdhDuring gene sequence, the fluorescent amplification curves of the sweet potato DNA and 3 parts of sweet potato starch samples are all above a baseline, and the other samples and blank control amplification curves are all at baseline positions, which shows that the method can effectively detect the sweet potato-derived components.
While particular embodiments of the present invention have been described, those skilled in the art will recognize that many changes and modifications may be made thereto without departing from the scope or spirit of the invention. Accordingly, it is intended to cover all such changes and modifications that fall within the scope of the appended claims and equivalents thereof.
Claims (5)
1. The application of a composition of a specific oligonucleotide primer pair and a probe in preparing a reagent for detecting Sweet potato-derived components by a real-time fluorescent PCR method is characterized in that an upstream primer of the primer pair is Sweet potato to-F: CAAAAGCACGGCACTAGTCA, the downstream primer of the primer pair is Sweet potatoto-R: AGTGAGACAGGGGAAGTGGA, respectively; the probe is Sweet potato-P: CCCAGCAACCGCTCTTTATA, wherein the probe has a fluorescence quencher TAMAR attached to its 3 'end and a fluorescence reporter FAM attached to its 5' end.
2. Use according to claim 1, characterized in that said sweet potato-derived ingredients are derived from starch.
3. Use according to claim 1, characterized in that the sweet potato derived ingredient is from vermicelli.
4. Use according to claim 1, wherein the sweet potato derived ingredients are from vermicelli.
5. Use according to claim 1, wherein the sweet potato-derived ingredients are derived from potato chips.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510793791.2A CN106701909B (en) | 2015-11-18 | 2015-11-18 | Primer probe, method and kit for detecting sweet potato-derived components |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510793791.2A CN106701909B (en) | 2015-11-18 | 2015-11-18 | Primer probe, method and kit for detecting sweet potato-derived components |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701909A CN106701909A (en) | 2017-05-24 |
| CN106701909B true CN106701909B (en) | 2022-04-01 |
Family
ID=58932731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510793791.2A Active CN106701909B (en) | 2015-11-18 | 2015-11-18 | Primer probe, method and kit for detecting sweet potato-derived components |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701909B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593133B (en) * | 2019-02-20 | 2022-07-19 | 中国检验检疫科学研究院 | Method, composition and kit for identifying four kinds of pollen by multiplex fluorescence PCR |
| CN110004243B (en) * | 2019-03-07 | 2022-03-29 | 广东出入境检验检疫局检验检疫技术中心 | Kit for quantitatively detecting sweet potato components based on microdroplet digital PCR and application thereof |
| CN110317895B (en) * | 2019-06-19 | 2023-07-14 | 许昌学院 | LAMP primer group for detecting sweet potato source components and application thereof |
| CN110878339A (en) * | 2019-09-19 | 2020-03-13 | 河北省食品检验研究院（国家果类及农副加工产品质量监督检验中心、河北省食品安全实验室） | Fluorescent quantitative PCR detection method for identifying authenticity of sweet potato starch and doping analysis thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1420182A (en) * | 2002-10-11 | 2003-05-28 | 覃文 | Probe sequence and kit for real time fluorescence PCR detection of transgenic potato |
| WO2011097492A1 (en) * | 2010-02-05 | 2011-08-11 | The Board Of Trustees Of The University Of Illinois | A dna sequence that confers aphid resistance in soybean |
| CN102134603B (en) * | 2010-12-21 | 2013-02-13 | 中国检验检疫科学研究院 | Primer, probe, test kit and method for testing genetically modified rice or products thereof |
| KR101403494B1 (en) * | 2011-12-28 | 2014-06-10 | 대한민국 | SSR Primer for the Identification of Sweet Potatoes and Method for Identifying Sweet Potatoes |
| CN103484555B (en) * | 2013-10-14 | 2014-10-29 | 湖北省农业科学院粮食作物研究所 | Method for identifying authenticity of sweet potato variety by using inter-simple sequence repeat (ISSR) molecular marker method |
| CN103849691B (en) * | 2014-02-26 | 2015-10-07 | 福建省农业科学院作物研究所 | A kind of sweet potato viruses detects primer and method |
-
2015
- 2015-11-18 CN CN201510793791.2A patent/CN106701909B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701909A (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vemireddy et al. | Review of methods for the detection and quantification of adulteration of rice: Basmati as a case study | |
| Linacero et al. | Application of real-time PCR for tree nut allergen detection in processed foods | |
| CN106701909B (en) | Primer probe, method and kit for detecting sweet potato-derived components | |
| Faria et al. | High resolution melting of trnL amplicons in fruit juices authentication | |
| Zhang et al. | Advanced DNA-based methods for the detection of peanut allergens in processed food | |
| He et al. | Development and optimization of an efficient method to detect the authenticity of edible oils | |
| Wei et al. | Identification techniques and detection methods of edible fungi species | |
| CN106811513A (en) | Eucalyptus composition real-time fluorescence PCR detection method and its kit | |
| CN106701907B (en) | Primer probe, method and kit for cassava-derived component detection | |
| CN103160609B (en) | Food allergen wheat component LAMP (loop-mediated isothermal amplification) field quick detection method | |
| CN107058498A (en) | A kind of detection ox, sheep, triple real time fluorescent PCR methods of pig derived component | |
| CN112813189B (en) | Method for rapidly identifying transgenic corn strain by utilizing quadruple real-time fluorescent PCR (polymerase chain reaction) | |
| Qin et al. | Self‐signal‐on fluorescent colorimetric protocol for rapid authentication of horsemeat adulterated beef samples with functional designed probes | |
| Zhang et al. | Identification of tps2 used as an endogenous reference gene in qualitative and real-time quantitative pcr detection of flammulina velutipes | |
| CN101768640B (en) | Puffer fish ingredient fluorescence quantitative PCR detection reagent and preparation method and application thereof | |
| Kim et al. | Molecular identification of economically motivated adulteration of red pepper powder by species-specific PCR of nuclear rDNA-ITS regions in garlic and onion | |
| JP3903044B2 (en) | Wheat inspection method | |
| JP5902517B2 (en) | Wheat detection method | |
| CN101988121A (en) | Quantitative detection technique for fusarium graminearum infestation quantity in wheat grains | |
| CN110734998B (en) | Primers, method and kit for identifying NFC orange juice and FC orange juice | |
| CN103160608A (en) | Food allergen lupin component LAMP (loop-mediated isothermal amplification) field quick detection method | |
| CN103484456B (en) | Loop-mediated isothermal amplification primer and kit for detecting apium graveolens ingredients and application of loop-mediated isothermal amplification primer | |
| CN106676164B (en) | Method for detecting pineapple components in sample to be detected | |
| CN110257544A (en) | Ergot germ fluorescence quantitative PCR detection reagent and detection kit and application | |
| CN110628939B (en) | Primer probe, method and kit for detecting camellia oleifera derived components |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |