CN106701896A

CN106701896A - Method for detecting fidelity of DNA polymerase

Info

Publication number: CN106701896A
Application number: CN201510540019.XA
Authority: CN
Inventors: 王金
Original assignee: 王金
Current assignee: Abrack Biotechnology (Shandong) Co.,Ltd.
Priority date: 2015-08-28
Filing date: 2015-08-28
Publication date: 2017-05-24

Abstract

The invention provides a method for detecting the fidelity of DNA polymerase. The method comprises the steps: designing a PCR (polymerase chain reaction) amplification primer according to a DNA template; performing PCR amplification reaction by using a DNA polymer; performing bidirectional determination on each DNA molecule by a PCR product and by utilizing an NGS (next generation sequencing) platform, screening data which is effective in positive and negative directions, and selecting a position which is determined to have mutation in two directions to mark as one mutation, wherein the mutation belongs to mutation introduced in the amplification process of the DNA polymerase; if the position which is determined to have mutation in one direction and not have mutation in the other direction exists, indicating that the mutation is the mutation introduced by a sequencing platform and does not belong to the mutation introduced in the amplification process of the DNA polymerase; calculating the fidelity. Sequence determination is conducted by utilizing the NGS platform and the sequencing cost is greatly reduced, so the fidelity of the DNA polymerase can be measured accurately and quickly under the condition of low cost.

Description

A kind of method for detecting archaeal dna polymerase fidelity

Technical field

It is inexpensive, fast the present invention relates to a kind of method for detecting archaeal dna polymerase fidelity, more particularly to one kind Speed, accurate, quantitative determination archaeal dna polymerase fidelity method.

Background technology

PCR (PCR) is a kind of molecular biosciences skill for amplifying amplification specific DNA fragments Art, micro DNA can be significantly increased, so as to be used for DNA sequencing.Current PCR disease surveillance, The fields such as forensic detection, DNA synthesis are widely used.

But, if the amplified production needs of PCR are accurate, for example, gene cloning etc. is applied to, it is used for The fidelity of the archaeal dna polymerase of PCR amplifications is just very crucial.The fidelity of archaeal dna polymerase is often used There is wrong probability to represent in how many mistakes of 1000 bases or each base, in addition, high-fidelity journey The level of degree can also be weighed with Taq enzyme, and how many times of Taq enzyme fidelity represent.

If the circumscribed enzyme activity that archaeal dna polymerase contains 3 ' to 5 ', then can be to mistake in amplification procedure The base of addition carries out excision reparation, and rejoins correct base, is consequently belonging to high-fidelity DNA polymerization Enzyme.And as Taq archaeal dna polymerases, due to not possessing 3 ' to 5 ' circumscribed enzyme activity, therefore it is not belonging to guarantor high True archaeal dna polymerase, is also seldom used to do gene cloning.

At present, multiple biotech companies have developed various high-fidelity DNA polymerases, wherein representational product Product have Pfu (multiple companies), Phusion (NEB), AccuPrime^TMPfx (Life), Q5 high-fidelities And KOD (ToYoBo) etc. (NEB).The DNA cloning fidelity of the archaeal dna polymerase of separate sources is Difference；It is worth noting that, different biotech companies often all declares the fidelity of oneself product Preferably, this brings puzzlement to consumer.

At present, having various methods can be used to determine the fidelity of polymerase.Earliest method is Thomas What Kunkel et al. was developed covers bacterium using the lacZ α genes in M13 bacteriophages, and combines blue hickie Screen with assess archaeal dna polymerase fidelity (Kunkel, T.A.and Tindall, K.R., 1987, Biochemistry,27,6088–6013.).William Thilly et al. are detected using gradient gel electrophoresis and contained Have mutation pcr amplification product (Ling, L.L.et al., 1991, Genome Research, 1, 63–69.).Later, Wayne Barnes et al. expanded whole lacZ using 16 PCR programs of circulation Gene, and combine blue hickie test come assess PCR amplifications fidelity (Kermekchiev, M.B., Tzekov, A and Barnes, W.M., 2003, Nucl.Acids Res.31,6139-6147.), the method and It is similar that Kunkel et al. is developed.Not only workload is big for the above method, and accuracy is not high；Particularly without Method distinguishes the same sense mutation (different DNA sequence dnas, but coding identical protein sequence) of DNA.

More than in addition to the method for batch screening, may also be used for determining in theory using Sanger PCR sequencing PCRs The accuracy (i.e. the fidelity of archaeal dna polymerase) of PCR primer.Comprise the concrete steps that, clone PCR products, Then large-scale DNA sequencing is carried out.But, because the workload and cost of the method are all very high, Do not see which company employs this method to carry out the survey of archaeal dna polymerase fidelity in actual life It is fixed.

With the development of sequencing technologies of future generation (NGS, such as 454, Illumina, Ion Torrent etc.) with And the appearance of single-molecule sequencing technology (such as PacBio RS), the cost of DNA sequencing is compared to Sanger PCR sequencing PCR is significantly reduced.However, the error rate of above-mentioned instrument and technology is higher, platform also can in itself Introduce mutation, and as the reading of Illumina and Ion Torrent technologies is grown all very short, therefore limit State application of the technology in terms of archaeal dna polymerase fidelity measure.

Additionally, in addition to introducing the base of mistake, the mistake of archaeal dna polymerase also actually includes insertion mutation With delete mutation etc..

The content of the invention

The problem of archaeal dna polymerase fidelity cannot accurately, be quickly and cheaply determined for prior art, The invention provides a kind of method of new detection archaeal dna polymerase fidelity.

The method of detection DNA polymer fidelitys provided by the present invention, including：

Pcr amplification primer thing is designed according to DNA profiling；

Pcr amplification reaction is carried out using DNA polymer；

PCR primer carries out two-way measure using NGS platforms to each DNA molecular,

The all effective data of positive and negative both direction are screened, and selects to measure the position mark of identical mutation in both direction To be mutated at one, the mutation belongs to the mutation introduced in archaeal dna polymerase amplification procedure；If in the presence of only one Individual direction determines mutation and mutation, or both direction mutation difference does not occur in other direction, then show The mutation of microarray dataset introducing is sported at this, the mutation introduced in archaeal dna polymerase amplification procedure is not belonging to； Fidelity and/or mutation rate are calculated, the mutation/effective dna introduced in mutation rate=archaeal dna polymerase amplification procedure Sequencing amount；Calculate fidelity, fidelity=1- mutation rates.

Wherein, in the above of the present invention, pcr amplification product length can be 0.1kb-50kb, more preferably Be 0.5kb-40kb, more preferably 1kb-20kb, more preferably 2kb-15kb, such as 10kb, 8kb, 6kb, 5kb, 4kb, 3kb etc..

Wherein, in the above of the present invention, during pcr amplification reaction, period is preferably 6-35 times, More preferably 10-30 times, such as 15 times, 20 times, it is 25 inferior.

Wherein, in the above of the present invention, the NGS platforms can be 454, Illumina Hiseq, Any one or a few in the platforms such as Illumina Miseq, Ion Torrent.

Wherein, in the above of the present invention, the mutation can be selected from base mistake, insertion mutation and deletion Any one or a few in mutation.

In one preferred embodiment of the invention, the PCR primer entered Break Row, Jian Ku before sequencing, The reading that DNA length after interrupting need to be equal to or less than NGS platforms is long.

In the above of the present invention, the base mistake refers to that the base of the mistake on the position instead of correctly Base, the insertion mutation refers to that unnecessary base is occurred in that on the position, and the deletion mutation refers at this The base that should exist has been lacked on position.

In the present invention by using the technical advantage of existing high-flux sequence platform, and combine a set of new mistake Rate computational methods, realize the Accurate Determining of archaeal dna polymerase fidelity.Meanwhile, it is the method low cost, fast It is fast, sensitive, general.

Brief description of the drawings

Fig. 1 is the method flow schematic diagram of present invention detection DNA polymer fidelitys.

Specific embodiment

Reference picture 1, the method for present invention detection DNA polymer fidelitys comprises the following steps：

Sequence information design pcr amplification primer thing according to DNA to be amplified.

Enter performing PCR using archaeal dna polymerase to expand, then purified pcr product carries out NGS sequencings.

PCR primer carries out the two-way measure of sequence by after interrupting and building the steps such as storehouse.The DNA length for wherein interrupting should Unidirectional reading equal to or less than microarray dataset is long.

Analyze data.The all effective data of positive and negative both direction are screened, then selects to measure identical dashing forward in both direction The position of change, and labeled as the mutation introduced in archaeal dna polymerase amplification procedure.If only one of which direction determines Go out mutation, and other direction does not occur being mutated if (or mutation is different), then show to sport survey at this The mutation that sequence platform is introduced, is not belonging to the mutation introduced in archaeal dna polymerase amplification procedure.

Mutation rate is calculated：Mutation rate=mutation number/effective DNA sequencing amount.

Fidelity calculates：Fidelity=1- mutation rates.

The present invention carries out sequencing using NGS platforms, significantly reduces sequencing cost, therefore can be The fidelity of archaeal dna polymerase is accurately and fast determined under the conditions of low cost.

The method of present invention detection DNA polymer fidelitys will be carried out by specific embodiment below detailed Introduce and describe it should be appreciated that following embodiments are not intended to limit the scope of the invention.

The carrier that selection pUC18 plasmids are expanded as PCR, design pairing primer：

5’-CGCCAGGGTTTTCCCAGTCACGAC-3’；

5’-AGCGGATAACAATTTCACACAGGA-3’。

Respectively by taking Taq, Pfu, Q5 polymerase as an example, PCR reaction systems are as follows：

pUC18：100ng

10×PCR buffer：5 μ l (if buffer solution be 5 ×, plus 10 μ l)

10mM dNTP：1μl

100mM M13F-47：0.5μl

100mM M13R-48：0.5μl

H₂O：Cumulative volume is added to for 50 μ l

PCR amplification programs：

95 DEG C, 5min --- (95 DEG C, 30s；60 DEG C, 30s；72 DEG C, 30s) 30 circulations --- 72 DEG C, 5min。

PCR primer builds storehouse kit TruSeq DNA LT Sample by direct Illumina after purification Preparation Kit carry out building storehouse.Then paired is carried out using Illumina HiSeq2500 sequencing systems End 2x125 nt multiplex are sequenced, and the data collection software provided using Illumina Carry out real-time data capture.

Initial data fastq files are processed：(1) low quality base is held in removal 3 '；(2) reads is removed In contained joint sequence；(3) reads of the removal containing N bases；(4) removal length is less than 125bp Reads and azygous reads.

The theoretical sequence of PCR is：

cgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgact ctagaggatccccgggtaccgagctcgaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatccgct

Select by positive and negative two chain sequencing covering 24 C to 125 T between sequence carry out sequence analysis and The calculating of error rate.

Table 1, different polymerase errors rate statistics and fidelity calculate

Specific embodiment of the invention has been described in detail above, but it is intended only as example, and the present invention is simultaneously It is not restricted to particular embodiments described above.To those skilled in the art, it is any that the present invention is carried out Equivalent modifications and substitute also all among scope of the invention.Therefore, spirit of the invention and model are not being departed from Enclose lower made impartial conversion and change, all should be contained within the scope of the invention.

Claims

1. a kind of method of detection DNA polymer fidelitys, it is characterised in that including：

Pcr amplification primer thing is designed according to DNA profiling；

Pcr amplification reaction is carried out using DNA polymer；

The all effective data of positive and negative both direction are screened, selection is at one in the position mark that both direction measures mutation Mutation, the mutation belongs to the mutation introduced in archaeal dna polymerase amplification procedure；If there is only one of which direction Determine and be mutated and the position of mutation does not occur in other direction, then show to sport microarray dataset introducing at this Mutation, be not belonging to the mutation introduced in archaeal dna polymerase amplification procedure；

Fidelity is calculated, the mutation/effective dna sequencing amount introduced in fidelity=archaeal dna polymerase amplification procedure.

2. method according to claim 1, it is characterised in that the pcr amplification product length is 0.1kb-50kb。

3. method according to claim 1, it is characterised in that during the pcr amplification reaction, follow Number of rings is 6-35 times.

4. method according to claim 1, it is characterised in that the NGS platforms are selected from 454, Illumina Any one or a few in the platforms such as Hiseq, Illumina Miseq, Ion Torrent.

5. method according to claim 1, it is characterised in that it is prominent that the mutation is selected from base mistake, insertion Become and delete any one or a few in being mutated.

6. method according to claim 1, it is characterised in that the PCR primer was carried out before sequencing Interrupt, the reading that the DNA length after interrupting meets NGS platforms is long.