CN106701792B - Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof - Google Patents
Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof Download PDFInfo
- Publication number
- CN106701792B CN106701792B CN201710145166.6A CN201710145166A CN106701792B CN 106701792 B CN106701792 B CN 106701792B CN 201710145166 A CN201710145166 A CN 201710145166A CN 106701792 B CN106701792 B CN 106701792B
- Authority
- CN
- China
- Prior art keywords
- mcry2ah
- gene
- plant
- plants
- transgenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
- C07K14/325—Bacillus thuringiensis crystal protein (delta-endotoxin)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Abstract
The invention relates to an artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof, belonging to the technical field of biological control. The invention provides a new DNA sequence (shown in SEQ ID NO2, SEQ ID NO3 and SEQ ID NO4) which is artificially optimized, modified and synthesized for an mcry2Ah gene, an mcry2Ah-vp gene and an mcry2Ah-sp gene with high toxicity to lepidoptera pests, the expression quantity and the stable expression characteristic of the mcry2Ah gene, the mcry2Ah-vp gene and the mcry2Ah-sp gene in transgenic plants can be improved by using a preferred codon sequence of the plants, the resistance of the mcry2Ah-sp to resistant lepidoptera pests is higher than that of other modified genes, and the gene sequence can be used for transforming the plants to control the pests and delay the generation of the resistance of the pests.
Description
Technical Field
The invention belongs to the technical field of biological control, and particularly relates to an artificially synthesized insecticidal gene sequence with high toxicity to lepidoptera pests and application thereof.
Background
Insect damage is an important factor for reducing crop yield in the world, so that the average annual loss of the insect damage is about 10 percent of the total yield of grains, and the direct economic loss reaches over 100 hundred million dollars. The prevention and treatment in the past decades mainly depends on chemical pesticides, which make great contribution to agricultural production and cause serious consequences such as environmental pollution, poisoning of people and livestock, ecological imbalance and the like. At these enormous costs, new pest control strategies and technologies are being sought and developed globally.
Bacillus thuringiensis (abbreviated as Bt) is a gram-positive bacterium with wide distribution. It produces protein-like parasporal crystals (parasporal crystals) with specific insecticidal activity against various insects of the orders Lepidoptera (Lepidotera), Diptera (Diptera), Coleoptera (Coleoptera), Hymenoptera (Hymenoptera), Homoptera (Homoptera), Orthoptera (Orthoptera), and Mallophaga (Mallophaga), as well as nematodes, mites and protozoa (Schnepf E.et al,1998, Microbiology and molecular Biology Review,62(3):775 806). The Insecticidal Crystal Proteins (ICPs) are also called Delta-endotoxins (Delta-endoxin), which are firstly dissolved in the insect midgut to become protoxins, and then degraded into toxins with specific activity by intestinal proteases, and are combined with specific receptors on the midgut (Craig,2007, Microbiology and Molecular Biology Review,71(2):255 and 281), so that the insects die, and the Bacillus thuringiensis is harmless to human and livestock and does not pollute the environment, so that the Bt is widely applied to biological control of pests.
825 Bt insecticidal genes encoding insecticidal crystallins have been cloned and classified into 318 model genes (seehttp://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt// holo2.html)。
In 1987, Vaeck et al introduced Bt insecticidal crystal protein gene into tobacco for the first time, which initiated the first time that human beings used transgenic technology to control pests (Vaeck et al,1987, Nature,328: 33-37). However, in transgenic studies, it was found that direct transfer of Bt-derived insecticidal protein gene into plants has the disadvantage of unstable expression product and low expression level (van Aarssen et al,1995, Plant Molecular Biology,28: 513-524). The specific problems include: 1) the natural Bt gene has high AT content which is more than 60 percent, and mRNA expressed by the gene in a plant body is easily degraded by the plant; 2) the natural Bt gene has intron cutting points and transcription terminator sequences similar to eukaryotic genes, so that incomplete transcription, abnormal shearing of mRNA and the like are caused; 3) the codon used in the natural Bt gene has great difference with the plant, which can cause the reduction of the protein translation efficiency; 4) the natural Bt gene is used as a prokaryotic gene, and the structure of the natural Bt gene is obviously different from that of eukaryotic organisms such as plants, for example, the eukaryotic organisms contain a 5 '-UTR sequence and a polyA tail sequence at the 3' end. Therefore, the solution of these key problems is an important guarantee to achieve efficient and stable expression of Bt genes in plants. With the improvement and perfection of these technologies, over two decades since 1996, transgenic insect-resistant corn, potato, rice, and other crops were developed in succession and gradually entered the application stage (James C, isaaaabrifs, 2016).
The insecticidal gene Cry2Ah1 from Bacillus thuringiensis was shown to have weight-inhibiting activity against the lepidopteran pest corn borer, growth-inhibiting activity against cotton bollworms, and also good growth-inhibiting activity against Cry1Ac resistant cotton bollworms (Shu et al, Journal of Invertebrate Pathology,2013,114: 31-33). There is no report on the transfer of cry2Ah into plants. There are many factors that affect the expression of exogenous genes in plants, including the application of different promoters and enhancers (enhancer), codon optimization forms of genes, termination signal recognition sequences, etc., different regulatory elements and different gene codon sequences will produce different transgenic events (events), and the produced insect-resistant effects are also different.
Disclosure of Invention
The invention aims to provide a novel DNA sequence which is artificially optimized, modified and synthesized by Bt cry2Ah, cry2Ah-vp and cry2Ah-sp genes with high toxicity to lepidoptera pests, and a plant has insect-resistant property by transformation.
An artificially synthesized sequence of mcry2Ah-vp for plant transformation, which is characterized by having a nucleotide sequence shown in SEQ ID NO 3.
An artificially synthesized sequence of mcry2Ah-sp for plant transformation, which is characterized by having a nucleotide sequence shown as SEQ ID NO 4.
A plant expression vector is characterized in that the plant expression vector contains the artificially synthesized sequence and a binary vector shuttling in escherichia coli and agrobacterium tumefaciens.
The binary vector is pCAMBIA2300 vector.
The plant expression vectors are pCSm2Ah-vpN and pCSm2Ah-spN, and the structures of the vectors are respectively shown in figures 3 and 4.
The use of the above plant expression vectors for transforming plants to produce insect-resistant traits.
The transformation method is an agrobacterium-mediated method, and the plant is tobacco or corn.
The insect-resistant insect is resistant to cotton bollworms and lepidoptera pests.
The plant expression vector is pCSm2Ah-spN, and the plant is tobacco.
The invention carries out codon optimization on nucleotide sequences of Bt cry2Ah (SEQ ID NO: 1) and two mutants of Bt cry2Ah-vp and Bt 2Ah-sp, synthesizes a new gene in a synthetic mode, constructs a plant expression vector to transform a plant, obtains a transgenic plant with high insect resistance, improves the transformation power of Bt cry2Ah, Bt 2Ah-vp and Bt 2Ah-sp genes in the transgenic process, and simultaneously improves the expression quantity and the stable expression characteristic in the transgenic plant. Compared with mcry2Ah (SEQ ID NO: 2) and mcry2Ah-vp (SEQ ID NO: 3) transgenic plants, the mcry2Ah-sp (SEQ ID NO: 4) transgenic plants show high toxicity to resistant pests, so the mcry2Ah-sp gene is an important candidate gene for delaying the generation of resistance of the pests to the Bt gene and controlling the resistant pests, and has good application potential.
Drawings
FIG. 1 shows the construction of plant expression vector pCS2AhN,
FIG. 2 is a schematic diagram of the construction of a plant expression vector pCSm2AhN,
FIG. 3 is a schematic diagram of the construction of a plant expression vector pCSm2Ah-vpN,
FIG. 4 is a schematic diagram of the construction of a plant expression vector pCSm2Ah-spN,
FIG. 5 PCR detection of cry2Ah transgenic tobacco,
wherein M DNA molecular weight Marker; 1 PCR amplification with pCS2AhN plasmid as template; 2, PCR amplification by taking non-transgenic tobacco genome DNA as a template; 3-6, carrying out PCR amplification by using the transformed plant genome DNA as a template; 7 with H2O is blank control of the template;
FIG. 6 PCR detection of mcry2Ah transgenic tobacco,
wherein M DNA molecular weight Marker; 1 PCR amplification with pCSm2AhN plasmid as template; 2 non-transgenic tobaccoPCR amplification with grass genome DNA as template; 3-6, carrying out PCR amplification by using the transformed plant genome DNA as a template; 7 with H2O is blank control of the template;
FIG. 7 PCR detection of mcry2Ah-vp gene-transferred tobacco,
wherein M DNA molecular weight Marker; 1, PCR amplification by using pCSm2Ah-vpN plasmid as a template; 2, PCR amplification by taking non-transgenic tobacco genome DNA as a template; 3-10 PCR amplification with the transformed plant genome DNA as a template; 11 with H2O is blank control of the template;
FIG. 8 shows PCR detection of mcry2Ah-sp gene-transferred tobacco,
wherein M DNA molecular weight Marker; 1, PCR amplification by using pCSm2Ah-spN plasmid as a template; 2, PCR amplification by taking non-transgenic tobacco genome DNA as a template; 3-15, carrying out PCR amplification by using the transformed plant genome DNA as a template; 16 with H2O is blank control of the template;
FIG. 9 southern blot assay of transgenic tobacco
Wherein P is directly against the mcry2Ah expression box in the pCSm2AhN plasmid; 1-3-mcry 2Ah-sp gene transformed tobacco; 4-5 mcry2Ah-vp gene-transformed tobacco; 6-transgenic mcry2Ah gene tobacco; n non-transgenic tobacco; b blank control;
FIG. 10 ELISA detection of transgenic tobacco
FIG. 11 qRT-PCR detection of transgenic tobacco
FIG. 12 identification of the insect resistance of transgenic tobacco to sensitive Helicoverpa armigera
Wherein, the insect resistance of A non-transgenic tobacco leaf and transgenic cry2Ah gene tobacco leaf is detected; detecting the insect resistance of the B-transformed mcry2Ah1 gene tobacco leaves; c-transgenic mcry2Ah1-vp gene tobacco leaf blade insect resistance detection; d, detecting the insect resistance of the transgenic mcry2Ah1-sp tobacco leaves;
FIG. 13 insect resistance identification of transgenic tobacco against Cry1Ac resistant Helicoverpa armigera
Wherein, the A is used for detecting the insect resistance of the tobacco leaves with non-transgenic and transgenic cry2Ah genes; detecting the insect resistance of the B-transformed mcry2Ah1 gene tobacco leaves; c-transgenic mcry2Ah1-vp gene tobacco leaf blade insect resistance detection; d, detecting the insect resistance of the transgenic mcry2Ah1-sp tobacco leaves;
Detailed Description
The present invention will be described in further detail with reference to examples.
The following biological materials are stored in the laboratory of the applicant and can be dispensed to the outside.
1. Codon modification and optimization of Bt cry2Ah, cry2Ah-vp and cry2Ah-sp genes
The Bt Cry2Ah1 gene (GenBank No. ACL13555.1) is a gene cloned from Bt strain isolated in China by Zygu project group of national institute of plant protection, the coding region of the gene has 1899bp, the nucleic acid sequence is shown in SEQ ID NO 1, the coded protein consists of 632 amino acid residues, and through the analysis of the Cry2Ah1 protein sequence domain, three conserved structural domains exist: domain I (Endotoxin _ N), domain II (Endotoxin _ M) and domain III (Endotoxin _ C). The 632 amino acid coding sequence of the cry2Ah1 gene sequence is optimized according to the preferred codons of plants, the GC content of the original cry2Ah1 gene is 34%, the GC content of the modified gene is 61.6%, the similarity with the original cry2Ah1 nucleic acid sequence is 65.82%, coding bases of 535 amino acids are changed, and the nucleic acid sequence is shown in SEQ ID NO 2. The Cry2Ah-vp mutant protein is formed by adding proline (Pro) after valine (Val) at position 354 of Cry2Ah1 protein, and adding 3 bases CCC after 1062bp of mcry2Ah sequence on nucleic acid sequence to code proline. The Cry2Ah-sp mutant protein is obtained by mutating valine (Val) at position 354 of Cry2Ah1 protein into serine (Ser) and proline (Pro), and removing 3 bases GTG and adding 6 bases AGCCCC after 1059bp of mcry2Ah sequence on nucleic acid sequence to encode serine-proline. The nucleic acid sequences of the mcry2Ah-vp and mcry2Ah-sp genes are shown in SEQ ID NO3 and SEQ ID NO 4.
2. Construction of plant expression vectors
Multiple cloning sites are respectively added at two ends of Btcry2Ah1 gene, artificially synthesized mcry2Ah, mcry2Ah-vp and mcry2Ah-sp genes, the 5 'end contains HindIII, XbaI, XmaI, SmaI and BamHI, the 3' end contains KpnI, XhoI and EcoRI, the original gene and the synthesized gene are constructed into pUC57 vectors which are respectively called pU2Ah, pUm2Ah, pUm2Ah-vp and pUm2Ah-sp (the plasmids are stored in the Langmo project group of the institute of biotechnology and biological technology of Chinese agrology institute and can be provided for the public). pE35SN is an intermediate vector containing two enhancer CaMV35S promoters and a nos terminator (plasmids stored in the encyclopedia group of the institute of biotechnology, national academy of agricultural sciences, which is available to the public), pU2Ah, pUm2Ah, pUm Ah-vp and pUm Ah-sp were double-digested with BamHI and KpnI, fragments of 2Kb were recovered respectively, and ligated to pE35SN digested with the same enzymes, and expression cassettes of the four vectors were transferred to pCSN vectors (pCSN vectors are transformed from the commercial pCAMBIA2300 vector, a pair of T-DNA sequences were introduced between BstXI and EcoRI of pCAMBIA2300 vector, Sm 35-vpN and Sm2 are stored in the encyclopedia group of the institute of biotechnology, which is available to the public), and the resulting vectors were named pCS2AhN, pCSm 25-vpN and Sm 2-spN are shown in FIG. 1 and FIG. 2 (FIG. 1, schematic drawing).
3. Obtaining transgenic tobacco
The constructed pCS2AhN, pCSm2Ah-vpN and pCSm2Ah-spN are transformed into tobacco by agrobacterium transformation method, which is a conventional method for transforming dicotyledon by agrobacterium, and the leaves of aseptic tobacco seedlings are first cut into pieces with the size of 0.4x0.6cm2The small blocks are placed in an agrobacterium infection solution for 10min, tobacco leaves are taken out, bacteria liquid is sucked by sterile filter paper and is placed in an MS culture medium with a layer of filter paper, co-culture is continued for 3d in the dark, after 3d, the tobacco leaves are moved to an MS screening differentiation culture medium (MS salt, 100mg/L kanamycin, 500mg/L Cab (carbenicillin), 2 mg/L6-BA, 0.5mg/L NAA (naphthylacetic acid), 30g/L sugar, 7g/L agar and pH 5.8) for two weeks, green callus points appear at the edges of the leaves after two weeks of screening, the callus points are differentiated into small plants after one week, and the small plants take roots in a rooting culture medium. And (3) hardening the plants with good rooting states in a greenhouse for 1-2 days, transferring the plants into a nutrition pot, preserving moisture, and transferring the plants into a large flowerpot to grow after the seedlings survive to obtain resistant plants.
4. PCR identification of transgenic plants
Extracting genome DNA of a transformed plant, designing primers according to cry2Ah1 original gene and mcry2Ah, mcry2Ah-vp and mcry2Ah-sp sequences, wherein the sequence of the cry2Ah1 primer is as follows: cry2Ah 1F: 5'-TTTAATATTTCCTAG-3', cry2Ah 1R: 5'-GTCGTGTTGCTTTGT-3', respectively; the common primer sequences of mcry2Ah, mcry2Ah-vp, mcry2 Ah-sp: mcry2 AhF: 5'-CCTCATCTTCCCGTC-3', mcry2 AhR: 5'-GTGTTGCTCTGCTCG-3', the size of the fragment obtained by amplifying the transgenic tobacco with cry2Ah1 gene and mcry2Ah1 gene is 1350bp, and the size of the fragment obtained by amplifying the transgenic tobacco with mcry2Ah1-vp gene and mcry2Ah1-sp gene is 1353 bp;
the reaction system is as follows:
reaction conditions are as follows:
94℃2min；94℃30s，54℃30s，72℃1min，30cycles；72℃10min，4℃pause。
the results of PCR products are shown in FIGS. 5, 6, 7 and 8.
In the tobacco transformation of the transgenic cry2Ah1, mcry2Ah, mcry2Ah-vp and mcry2Ah-sp genes, 10 transformed plants, 29 transformed plants, 45 transformed plants and 62 transformed plants are obtained respectively, positive plants are detected to be 4, 15, 28 and 46 plants respectively through PCR, and the positive rates are 40%, 51.7%, 62.2% and 74.2%.
5. Southern blot detection of transgenic tobacco
And (3) selecting partial transgenic positive plants to extract genome DNA, carrying out agarose gel electrophoresis after the genome DNA is completely digested by HindIII, and transferring the DNA to a nylon membrane (N +). The mcry2Ah expression cassette (3.1Kb) was a positive control, non-transgenic tobacco genomic DNA was a negative control, and water was a blank control. The detection Probe is a section of 862bp sequence shared by mcry2Ah, mcry2Ah-vp and mcry2Ah-sp genes, the amplification is carried out by PCR DIG Probe Synthesis Kit and DIG-11-dUTP is marked, and the amplification primer sequence: mcry2Ah-probe-F: 5'-GAGTGGATGGAGTGGAAG-3', mcry2Ah-probe-R is: 5'-CGATGTTTGGGAAGGTCT-3' are provided. The Southern blot assay results are shown in FIG. 9.
6. ELISA detection of transgenic tobacco
Soluble protein of the leaves of the transgenic positive plants is extracted, and Cry2Ah1 protein in the transgenic plants is quantified by using QuantIPlate Kit for Cry2A (Envirologix). The purified Cry2Ah1 protein at different concentration gradients was plotted as a standard curve. The ELISA assay results are shown in FIG. 10.
No Cry2Ah1 protein expression is detected in 4 Cry2Ah1 transgenic tobacco plants, 4 Cry2Ah1 protein is expressed in 4 out of 15 mcry2Ah transgenic tobacco plants, the Cry2Ah1 protein expression amount is 4.41-10.27 mu g/g fresh weight, 8 Cry2Ah1 protein is expressed in 28 mcry2Ah-vp transgenic tobacco plants, the Cry2Ah1 protein expression amount is 8.32-36.35 mu g/g fresh weight, 24 Cry2Ah1 protein is expressed in 24 out of 46 mcry2Ah-sp transgenic tobacco plants, and the Cry2Ah1 protein expression amount is 5.26-40.28 mu g/g fresh weight (Table 1). Statistical analysis shows that the difference between the expression quantities of proteins of mcry2Ah-sp and mcry2Ah-vp transgenic tobacco plants Cry2Ah1 is not significant, but the difference between the expression quantities of proteins of the mcry2Ah-sp and the expression quantities of proteins of mcry2Ah1 of mcry2Ah transgenic tobacco plants is significant, the expression quantity of the tobacco foreign proteins of transgenic Cry2Ah1 original genes is lower than a detectable level, and the fact that the genes which are not subjected to codon optimization hardly express the foreign proteins in the plants in a high degree is indicated.
7. qRT-PCR detection of transgenic tobacco
Total RNA of transgenic positive plant leaves is extracted, and the RNA is reversely transcribed into cDNA by utilizing a RevertAID First Strand cDNAsSynthesis Kit. The Actin gene is an internal reference gene, and the primer sequence is as follows: actin-qF: GGCATCATACATTTTACAACGAA, actin-qR: ATGGCGACATACATAGCAGGAGT are provided. The common detection primers of mcry2Ah1, mcry2Ah1-vp and mcry2Ah1-sp genes are as follows: mcry2Ah 1-qF: AGGGCGTACATGGTGAGC, mcry2Ah 1-qR: GGATGGGGGAGATGGTGA are provided.
The reaction system is as follows:
reaction conditions are as follows:
94℃30s；94℃ 5s，60℃30s，40cycles；
the result graph of the qRT-PCR product is shown in figure 11, and the expression of exogenous mcry2Ah1 gene, mcry2Ah1-vp gene and mcry2Ah1-sp gene at the transcription level can be detected in the transgenic tobacco.
8. Insect resistance identification of transgenic tobacco
Sensitive or Cry1Ac resistant bollworm hatched larvae are selected for feeding the transgenic plants and the excised leaves of the control plants. The number of larvae dead was counted daily. After 3d feeding, the transgenic plants showed significant resistance to either sensitive or Cry1Ac resistant cotton bollworms, with leaves fed only a few small wells and larvae dead in a black toxic state, a few non-dead larvae in a rigid state with no further damage to the leaves (fig. 12, 13). While the leaves of the plants of the non-transgenic plants (WT) and the transgenic Cry2Ah gene had no effect on the susceptible or Cry1Ac resistant cotton bollworms and were taken in large quantities (FIGS. 12, 13). The sensitive or Cry1Ac resistant cotton bollworm is fed by the isolated leaf blade of 4 mcry2Ah transgenic tobacco plants, and the corrected mortality rate of the sensitive or Cry1Ac resistant cotton bollworm after 3 days is 95.30-100% and 90.84-100%. 8 mcry2Ah-vp gene-transferred 8-strain tobacco is fed with isolated leaves to sensitive or Cry1Ac resistant cotton bollworms, and the mortality corrected by the sensitive or Cry1Ac resistant cotton bollworms after 3 days is 100% and 92.09-100%. The sensitive or Cry1Ac resistant cotton bollworm is fed by the excised leaf of 24 mcry2Ah-sp transgenic tobacco, and the corrected mortality rate of the sensitive or Cry1Ac resistant cotton bollworm after 3 days is 100 percent and 96.34 to 100 percent (Table 1). Statistical analysis shows that the resistance of mcry2Ah, mcry2Ah-vp and mcry2Ah-sp transgenic tobacco is not obviously different for sensitive cotton bollworms. For Cry1Ac resistant cotton bollworms, the insect resistance of mcry2Ah and mcry2Ah-sp transgenic tobacco is obviously different, and the insect resistance of mcry2Ah-sp is higher than that of mcry2 Ah; the activity of mcry2Ah-vp is greater than mcry2Ah, and the anti-insect activity of mcry2Ah-sp is higher than mcry2Ah-vp, but no significant difference is analyzed statistically. In conclusion, mcry2Ah, mcry2Ah-vp and mcry2Ah-sp have obvious insect resistance to sensitive or Cry1Ac resistant cotton bollworms, wherein the resistance of mcry2Ah-sp to Cry1Ac resistant cotton bollworms is highest, and the method can be used for breeding insect-resistant plants and delaying the generation of insect resistance.
TABLE 1 transgenic tobacco Cry2Ah protein expression and insect resistance statistics
SEQUENCE LISTING
<110> institute of biotechnology of Chinese academy of agricultural sciences
<120> artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof
<130>PP17022-SWJ
<160>4
<170>PatentIn version 3.3
<210>1
<211>1899
<212>DNA
<213> Bt cry2Ah1 original sequence
<400>1
atgaataatg tattgaatag cggaagagct actaatggtg atgcgtataa tgtagtggct 60
catgatccat ttagttttca acataaatca ttagatacca tacaagaaga atggatggag 120
tggaaaaaag ataatcatat tttatatgta gatcctattg ttggaactgt ggctagcttt 180
cttttaaaga aagtggggag tcttgttgaa aaaagaatat taagtgagtt acggaattta 240
atatttccta gtggcagtac aaatctaatg caagatattt taagagagac agaaaaattc 300
ctgaatcaaa gacttaatac agacactctt gcccgtgtaa atgcggaatt gacagggctg 360
caagcaaatg tagaagagtt taatcgacaa gtagataatt ttttgaaccc taaccgaaat 420
gctgttcctt tatcaataac ttcttcagtt aatacaatgc agcaattatt tctaaataga 480
ttaccccagt ttcagatgca aggataccaa ttgttattat tacctttatt tgcacaggca 540
gccaatttac atctttcttt tattagagat gttattctta atgcagatga atggggaatt 600
tcagcagcaa cattacgtac gtatcaaaat cacctgagaa attatacaag agagtactct 660
aattattgta taactacgta tcaaactgcg tttagaggtt taaacacccg tttacacgat 720
atgttagaat ttagaacata tatgttttta aatgtatttg aatatgtatc tatctggtcg 780
ttgtttaaat atcaaagcct tctagtatct tctggcgcta atttatatgc aagtggtagt 840
ggaccacagc agacccaatc atttacttca caagactggc catttttata ttctcttttc 900
caagttaatt caaattatgt gttaaatggc tttagtggcg ctagacttac gcagactttc 960
cctaatattg ttggtttacc tggtactact acaactcacg cattgcttgc tgcaagggtc 1020
aattacagtg gaggagtttc gtctggtgat ataggcgctg tgtttaatca aaattttagt 1080
tgtagtacat ttctcccacc tttgttaaca ccatttgtta gaagttggct agattcaggt 1140
tcagatcggg gggggattaa taccgttacc aattggcaaa cagaatcctt tgagacaact 1200
ttaggtttaa ggagtggtgc ttttacagct cgaggtaatt caaactattt cccagattat 1260
tttatccgta atatttctgg agttccttta gttgttagaa atgaagattt aagaagaccg 1320
ttacactata atcaaataag aaatatagaa agtccttcag gaacacctgg tggattacga 1380
gcttatatgg tatctgtgca taacagaaaa aataatatct atgccgttca tgaaaatggt 1440
actatgattc atttagcgcc ggaagattat acaggattta ctatatcgcc gatacatgca 1500
actcaagtga ataatcaaac gcgaacattt atttctgaaa aatttggaaa tcaaggtgat 1560
tccttaagat ttgaacaaag caacacgaca gctcgttata cccttagagg gaatggaaat 1620
agttacaatc tttatttaag agtatcttca ataggaaatt ccactattcg agttactata 1680
aacggtagag tttatactgc ttcaaatgtt aatactacta caaataacga tggagttaat 1740
gataatggag ctcgtttttc agatattaat atcggtaatg tagtagcaag tgataatact 1800
aatgtaccgt tagatataaa tgtgacatta aattcgggta ctcaatttga gcttatgaat 1860
attatgtttg ttccaactaa tcttccacca ctttattaa 1899
<210>2
<211>1899
<212>DNA
<213> artificially modified mcry2Ah sequence
<400>2
atgaacaacg tcctcaacag cggcagggct acgaacggcg acgcgtacaa cgtggtcgcc 60
cacgacccct tctccttcca gcacaagagc ctcgacacca tccaggagga gtggatggag 120
tggaagaagg acaaccacat cctctacgtg gacccgatcg tgggcaccgt cgcctccttc 180
ctcctgaaga aggtcggcag cctcgtcgag aagcgcatcc tctccgagct gaggaacctc 240
atcttcccgt ccggcagcac gaacctcatg caggacatcc tgcgcgagac cgagaagttc 300
ctgaaccagc gcctcaacac ggacaccctg gctagggtca acgctgagct gaccggcctc 360
caggctaacg tcgaggagtt caaccgccag gtggacaact tcctcaaccc gaacaggaac 420
gccgtccccc tgtccatcac gtccagcgtg aacaccatgc agcagctctt cctgaacagg 480
ctcccccagt tccagatgca gggctaccag ctcctgctcc tgccactgtt cgctcaggct 540
gcgaacctcc acctgtcctt catccgcgac gtgatcctga acgctgacga gtggggcatc 600
agcgctgcta cgctcaggac ctaccagaac cacctgcgca actacacgag ggagtactcc 660
aactactgca tcaccacgta ccagacggcg ttccgcggcc tgaacaccag gctccacgac 720
atgctggagt tccgcaccta catgttcctc aacgtgttcg agtatgtgtc catctggagc 780
ctgttcaagt accagagcct cctggtctcc agcggcgcca acctctacgc ttccggcagc 840
ggcccacagc agacgcagtc cttcaccagc caggactggc cgttcctgta ctccctcttc 900
caggtgaaca gcaactacgt cctcaacggc ttctccggcg ctaggctgac gcagaccttc 960
ccaaacatcg tgggcctgcc aggcaccacg accacgcacg cgctcctggc tgctagggtg 1020
aactactccg gcggcgtctc cagcggcgac atcggcgctg tgttcaacca gaacttctcc 1080
tgcagcacgt tcctcccacc actcctgacc ccattcgtcc gcagctggct ggactccggc 1140
agcgacaggg gcggcatcaa cacggtgacc aactggcaga cggagagctt cgagaccacg 1200
ctcggcctgc gctccggcgc cttcaccgcg aggggcaaca gcaactactt cccggactac 1260
ttcatccgca acatctccgg cgtgcccctc gtggtcagga acgaggacct ccgcaggccg 1320
ctgcactaca accagatcag gaacatcgag tccccaagcg gcaccccagg cggcctcagg 1380
gcgtacatgg tgagcgtcca taacaggaag aacaacatct acgcggtcca cgagaacggc 1440
acgatgatcc acctggcccc ggaggactac acgggcttca ccatctcccc catccacgcg 1500
acccaggtga acaaccagac gcgcaccttc atcagcgaga agttcggcaa ccagggcgac 1560
tccctcaggt tcgagcagag caacaccacg gctaggtaca ccctgagggg caacggcaac 1620
tcctacaacc tctacctgcg cgtctccagc atcggcaaca gcacgatccg cgtgaccatc 1680
aacggcaggg tctacaccgc ctccaacgtg aacaccacga ccaacaacga cggcgtgaac 1740
gacaacggcg cgaggttctc cgacatcaac atcggcaacg tggtcgccag cgacaacacg 1800
aacgtccccc tcgacatcaa cgtgacgctg aacagcggca cccagttcga gctgatgaac 1860
atcatgttcg tgccgaccaa cctgccgccc ctctactga 1899
<210>3
<211>1902
<212>DNA
<213> artificially modified mcry2Ah-vp sequence
<400>3
atgaacaacg tcctcaacag cggcagggct acgaacggcg acgcgtacaa cgtggtcgcc 60
cacgacccct tctccttcca gcacaagagc ctcgacacca tccaggagga gtggatggag 120
tggaagaagg acaaccacat cctctacgtg gacccgatcg tgggcaccgt cgcctccttc 180
ctcctgaaga aggtcggcag cctcgtcgag aagcgcatcc tctccgagct gaggaacctc 240
atcttcccgt ccggcagcac gaacctcatg caggacatcc tgcgcgagac cgagaagttc 300
ctgaaccagc gcctcaacac ggacaccctg gctagggtca acgctgagct gaccggcctc 360
caggctaacg tcgaggagtt caaccgccag gtggacaact tcctcaaccc gaacaggaac 420
gccgtccccc tgtccatcac gtccagcgtg aacaccatgc agcagctctt cctgaacagg 480
ctcccccagt tccagatgca gggctaccag ctcctgctcc tgccactgtt cgctcaggct 540
gcgaacctcc acctgtcctt catccgcgac gtgatcctga acgctgacga gtggggcatc 600
agcgctgcta cgctcaggac ctaccagaac cacctgcgca actacacgag ggagtactcc 660
aactactgca tcaccacgta ccagacggcg ttccgcggcc tgaacaccag gctccacgac 720
atgctggagt tccgcaccta catgttcctc aacgtgttcg agtatgtgtc catctggagc 780
ctgttcaagt accagagcct cctggtctcc agcggcgcca acctctacgc ttccggcagc 840
ggcccacagc agacgcagtc cttcaccagc caggactggc cgttcctgta ctccctcttc 900
caggtgaaca gcaactacgt cctcaacggc ttctccggcg ctaggctgac gcagaccttc 960
ccaaacatcg tgggcctgcc aggcaccacg accacgcacg cgctcctggc tgctagggtg 1020
aactactccg gcggcgtctc cagcggcgac atcggcgctg tgcccttcaa ccagaacttc 1080
tcctgcagca cgttcctccc accactcctg accccattcg tccgcagctg gctggactcc 1140
ggcagcgaca ggggcggcat caacacggtg accaactggc agacggagag cttcgagacc 1200
acgctcggcc tgcgctccgg cgccttcacc gcgaggggca acagcaacta cttcccggac 1260
tacttcatcc gcaacatctc cggcgtgccc ctcgtggtca ggaacgagga cctccgcagg 1320
ccgctgcact acaaccagat caggaacatc gagtccccaa gcggcacccc aggcggcctc 1380
agggcgtaca tggtgagcgt ccataacagg aagaacaaca tctacgcggt ccacgagaac 1440
ggcacgatga tccacctggc cccggaggac tacacgggct tcaccatctc ccccatccac 1500
gcgacccagg tgaacaacca gacgcgcacc ttcatcagcg agaagttcgg caaccagggc 1560
gactccctca ggttcgagca gagcaacacc acggctaggt acaccctgag gggcaacggc 1620
aactcctaca acctctacct gcgcgtctcc agcatcggca acagcacgat ccgcgtgacc 1680
atcaacggca gggtctacac cgcctccaac gtgaacacca cgaccaacaa cgacggcgtg 1740
aacgacaacg gcgcgaggtt ctccgacatc aacatcggca acgtggtcgc cagcgacaac 1800
acgaacgtcc ccctcgacat caacgtgacg ctgaacagcg gcacccagtt cgagctgatg 1860
aacatcatgt tcgtgccgac caacctgccg cccctctact ga 1902
<210>4
<211>1902
<212>DNA
<213> artificially modified mcry2Ah-sp sequence
<400>4
atgaacaacg tcctcaacag cggcagggct acgaacggcg acgcgtacaa cgtggtcgcc 60
cacgacccct tctccttcca gcacaagagc ctcgacacca tccaggagga gtggatggag 120
tggaagaagg acaaccacat cctctacgtg gacccgatcg tgggcaccgt cgcctccttc 180
ctcctgaaga aggtcggcag cctcgtcgag aagcgcatcc tctccgagct gaggaacctc 240
atcttcccgt ccggcagcac gaacctcatg caggacatcc tgcgcgagac cgagaagttc 300
ctgaaccagc gcctcaacac ggacaccctg gctagggtca acgctgagct gaccggcctc 360
caggctaacg tcgaggagtt caaccgccag gtggacaact tcctcaaccc gaacaggaac 420
gccgtccccc tgtccatcac gtccagcgtg aacaccatgc agcagctctt cctgaacagg 480
ctcccccagt tccagatgca gggctaccag ctcctgctcc tgccactgtt cgctcaggct 540
gcgaacctcc acctgtcctt catccgcgac gtgatcctga acgctgacga gtggggcatc 600
agcgctgcta cgctcaggac ctaccagaac cacctgcgca actacacgag ggagtactcc 660
aactactgca tcaccacgta ccagacggcg ttccgcggcc tgaacaccag gctccacgac 720
atgctggagt tccgcaccta catgttcctc aacgtgttcg agtatgtgtc catctggagc 780
ctgttcaagt accagagcct cctggtctcc agcggcgcca acctctacgc ttccggcagc 840
ggcccacagc agacgcagtc cttcaccagc caggactggc cgttcctgta ctccctcttc 900
caggtgaaca gcaactacgt cctcaacggc ttctccggcg ctaggctgac gcagaccttc 960
ccaaacatcg tgggcctgcc aggcaccacg accacgcacg cgctcctggc tgctagggtg 1020
aactactccggcggcgtctc cagcggcgac atcggcgcta gccccttcaa ccagaacttc 1080
tcctgcagca cgttcctccc accactcctg accccattcg tccgcagctg gctggactcc 1140
ggcagcgaca ggggcggcat caacacggtg accaactggc agacggagag cttcgagacc 1200
acgctcggcc tgcgctccgg cgccttcacc gcgaggggca acagcaacta cttcccggac 1260
tacttcatcc gcaacatctc cggcgtgccc ctcgtggtca ggaacgagga cctccgcagg 1320
ccgctgcact acaaccagat caggaacatc gagtccccaa gcggcacccc aggcggcctc 1380
agggcgtaca tggtgagcgt ccataacagg aagaacaaca tctacgcggt ccacgagaac 1440
ggcacgatga tccacctggc cccggaggac tacacgggct tcaccatctc ccccatccac 1500
gcgacccagg tgaacaacca gacgcgcacc ttcatcagcg agaagttcgg caaccagggc 1560
gactccctca ggttcgagca gagcaacacc acggctaggt acaccctgag gggcaacggc 1620
aactcctaca acctctacct gcgcgtctcc agcatcggca acagcacgat ccgcgtgacc 1680
atcaacggca gggtctacac cgcctccaac gtgaacacca cgaccaacaa cgacggcgtg 1740
aacgacaacg gcgcgaggtt ctccgacatc aacatcggca acgtggtcgc cagcgacaac 1800
acgaacgtcc ccctcgacat caacgtgacg ctgaacagcg gcacccagtt cgagctgatg 1860
aacatcatgt tcgtgccgac caacctgccg cccctctact ga 1902
Claims (9)
1. An artificially synthesized sequence of mcry2Ah-vp for plant transformation, which is characterized in that the nucleotide sequence is shown as SEQ ID NO 3.
2. An artificially synthesized sequence of mcry2Ah-sp for plant transformation, which is characterized in that the nucleotide sequence is shown as SEQ ID NO 4.
3. A plant expression vector characterized in that it comprises the artificially synthesized sequence of claim 1 or 2 and a binary vector shuttled between E.coli and Agrobacterium tumefaciens.
4. The plant expression vector of claim 3, wherein the binary vector is pCAMBIA2300 vector.
5. The plant expression vector of claim 4, which is pCSm2Ah-vpN and pCSm2Ah-spN, the structures of which are shown in FIG. 3 and FIG. 4, respectively.
6. Use of a plant expression vector according to any one of claims 3 to 5 for transforming a plant to produce insect-resistant properties.
7. The use according to claim 6, wherein the transformation method is Agrobacterium mediated transformation and the plant is tobacco or maize.
8. The use according to claim 7, said pest resistance being against lepidopteran pests.
9. The use of claim 8, the plant expression vector is pCSm2Ah-spN, and the plant is tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710145166.6A CN106701792B (en) | 2017-03-13 | 2017-03-13 | Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710145166.6A CN106701792B (en) | 2017-03-13 | 2017-03-13 | Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701792A CN106701792A (en) | 2017-05-24 |
| CN106701792B true CN106701792B (en) | 2020-07-03 |
Family
ID=58918266
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710145166.6A Active CN106701792B (en) | 2017-03-13 | 2017-03-13 | Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701792B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109776659B (en) * | 2019-03-14 | 2021-01-29 | 中国农业科学院生物技术研究所 | Application of cry2Ah-vp gene in anti-myxobolus |
| CN111057707B (en) * | 2019-12-09 | 2022-05-20 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insert of transgenic insect-resistant corn 2HVB4 and its detection method |
| CN114032247B (en) * | 2021-11-08 | 2023-04-25 | 中国农业科学院生物技术研究所 | Application of insecticidal gene cry2Ah-vp and cry9Ee combination in insect-resistant plants |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358190A (en) * | 2008-09-03 | 2009-02-04 | 中国农业科学院植物保护研究所 | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof |
| CN103204912A (en) * | 2013-04-27 | 2013-07-17 | 中国农业科学院植物保护研究所 | Insecticidal gene cry2Ah-like with high toxicity on lepidoptera pest and application thereof |
| CN106318954A (en) * | 2016-09-23 | 2017-01-11 | 中国农业科学院生物技术研究所 | Artificially synthesized gene sequences of mcry1Ba and mcry1Ia with high toxicity to lepidoptera pests and gene combination |
-
2017
- 2017-03-13 CN CN201710145166.6A patent/CN106701792B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358190A (en) * | 2008-09-03 | 2009-02-04 | 中国农业科学院植物保护研究所 | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof |
| CN103204912A (en) * | 2013-04-27 | 2013-07-17 | 中国农业科学院植物保护研究所 | Insecticidal gene cry2Ah-like with high toxicity on lepidoptera pest and application thereof |
| CN106318954A (en) * | 2016-09-23 | 2017-01-11 | 中国农业科学院生物技术研究所 | Artificially synthesized gene sequences of mcry1Ba and mcry1Ia with high toxicity to lepidoptera pests and gene combination |
Non-Patent Citations (2)
| Title |
|---|
| G8XR72;G8XR72;《UniProtKB》;20120222;第1页 * |
| Insect resistance to Bacillus thuringiensis Toxin Cry2Ab is conferred by mutations in an ABC transporter subfamily a protein;Wee Tek Tay等;《PLOS genetics》;20151119;第1-23页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701792A (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Takatsu et al. | Transgenic chrysanthemum (Dendranthema grandiflorum (Ramat.) Kitamura) expressing a rice chitinase gene shows enhanced resistance to gray mold (Botrytis cinerea) | |
| CN102660560B (en) | Artificially synthesized Bt insect-resistant gene Cry1F-t and application thereof | |
| CN102010873B (en) | Artificially synthesized Bt insect-resistant gene Cry1Ab-t and application thereof | |
| CN112779273B (en) | Artificially synthesized high-toxicity insecticidal gene for spodoptera frugiperda and application thereof | |
| CN107383177B (en) | Artificially synthesized Bt insecticidal gene mcry1Ab for transgenic insect-resistant plants | |
| CN106701792B (en) | Artificially synthesized insecticidal gene with high toxicity to lepidoptera pests and application thereof | |
| WO2009003412A1 (en) | Bacillus thuringiensis stain, cry8g genes, proteins, which are all highly toxic to order coleoptera insect pests, and uses thereof | |
| EP3243830A1 (en) | Protein associated with disease resistance and encoding gene thereof, and use thereof in regulation of plant disease resistance | |
| US20100218278A1 (en) | Method for improved stress tolerance | |
| CN102464710A (en) | Helicoverpa armigera juvenile hormone binding protein (Ha-JHBP) and encoding gene and application thereof | |
| CN102234647B (en) | Identification and application of rice stress inducible promoter KT619P | |
| CN113337536B (en) | Application of RS2Z32 gene as plant immune negative regulatory factor in improving crop resistance | |
| US20180216131A1 (en) | Artificially synthesized insect-resistant protein, biological materials associated therewith, and use thereof | |
| CN111235166B (en) | Novel induction-expressed Cry2Ab insecticidal gene and application thereof | |
| CN110862996B (en) | Application of isolated soybean gene in improving soybean cyst nematode resistance | |
| CN107299103A (en) | Thick boisiana IpASR genes and its encoding proteins and application | |
| CN116286724A (en) | Lectin receptor protein TaLecRLK2 and encoding gene and application thereof | |
| CN113195723A (en) | Codon-optimized cry1Da nucleic acid molecules, nucleic acid constructs, vectors, host cells, plant cells, transgenic plants, methods of transforming cells, methods of producing transgenic plants, methods of controlling invertebrate pests in crop plants, and uses of the nucleic acid molecules | |
| Lebedev et al. | Plant-defensin genes introduction for improvement of pear phytopathogen resistance | |
| CN109295068B (en) | Pseudo-ginseng sweet protein gene PnTLP2 and application | |
| CN111574604B (en) | Wheat disease-resistant protein TaAFRK and related biological material and application thereof | |
| CN111534536B (en) | Method for improving rice blast resistance and related biological material thereof | |
| CN102796747A (en) | Application of Zea mays L. drought-induced protein (ZmDIP1) gene and its encoding protein | |
| CN111995690A (en) | Artificially synthesized insect-resistant protein mCry1Ia2, and preparation method and application thereof | |
| CN100424177C (en) | Fusion pest killing gene cryci and its use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |