CN106699885A - Humanized anti-VEGFR2 antibody and application thereof - Google Patents

Abstract

The invention discloses a humanized anti-VEGFR2 antibody and application of the humanized anti-VEGFR2 antibody. The provided humanized anti-VEGFR2 antibody is an IgG, a heavy chain of the humanized anti-VEGFR2 antibody comprises a heavy chain variable region and a heavy chain constant region, a light chain of the humanized anti-VEGFR2 antibody comprises a light chain variable region and a light chain constant region; CDR1, CDR2 and CDR3 in the heavy chain variable region are sequentially 45-54th amino acid residues, 69-85th amino acid residues and 118-124th amino acid residues from the N tail end in a sequence 1 of a sequence table; CDR1, CDR2 and CDR3 in the light chain variable region are sequentially 44-54th amino acid residues, 70-76th amino acid residues and 109-117th amino acid residues from the N tail end in a sequence 3 of the sequence table. The humanized anti-VEGFR2 antibody has an important application value on the treatment of tumors and diseases caused by proliferation and migration of human umbilical vein endothelial cells.

Description

A kind of people source anti-vegf R2 antibody and its application

Technical field

The present invention relates to a kind of people source anti-vegf R2 antibody and its application.

Background technology

The tumor vessel oxygen enough for tumorigenesis are provided and nutrition, target tumor angiogenesis can reach The therapeutic effect of tumour hungry to death, but the molecular regulation mechanism of neonate tumour blood vessel it is extremely complex, it is necessary to many growths because The mediation of son, acceptor and signal path.

Vascular endothelial growth factor (VEGF) is the necessary cell factor of angiogenesis, and VEGFR2 is VEGF One of three acceptors, the signal path transduction of main responsible angiogenesis.

Inhibitor bevacizumab (Bevacizumab) for VEGF is that the one kind developed by Genentech company is directed to The recombinant humanized monoclonal antibody of VEGF, is made up of the mouse source part of 93% people source and 7%.2 months 2004 26 The approval for obtaining FDA days is the medicine of the suppression Tumor Angiongesis of first, the U.S. listing that gets the Green Light in U.S.'s listing. Bevacizumab global marketing volume in 2004 is 5.56 hundred million dollars, and 2013 are reached for 70.37 hundred million dollars.For VEGFR2 Inhibitor Lei Molu monoclonal antibodies (ramucirumab), IMC-1121B of ImClone companies of Shi Lilai corporate buyouts After mesh, develop and successfully list.Lei Molu monoclonal antibodies are directed to full human IgG1's monoclonal antibody of VEGFR2, specificity With reference to KDR/VEGFR2.The medicine is listed in May, 2014 in the U.S., is applied to late period or metastatic gastric carcinoma or stomach Esophageal junction gland cancer.

The content of the invention

It is an object of the invention to provide a kind of people source anti-vegf R2 antibody and its application.

The people source anti-vegf R2 antibody that the present invention is provided, is a kind of IgG, and its heavy chain is by weight chain variable district and light chain constant District's groups are into its light chain is made up of light chain variable district and constant region of light chain；CDR1, CDR2 in the weight chain variable district It is residual from N-terminal 45-54 amino acids residue, 69-85 amino acids with the sequence 1 that CDR3 is followed successively by sequence table Base and 118-124 amino acids residues；CDR1, CDR2 and CDR3 in the light chain variable district are followed successively by sequence The sequence 3 of table is from N-terminal 44-54 amino acids residue, 70-76 amino acids residue and 109-117 Amino acid residue.

Heavy chain polypeptide concretely shown in the sequence 1 of sequence table.

Light chain polypeptide concretely shown in the sequence 3 of sequence table.

The gene for encoding the IgG falls within protection scope of the present invention.

The gene for encoding the heavy chain is following (1) or (2)：

(1) DNA molecular shown in the sequence 2 of sequence table from the nucleotides of 5 ' end 10-1398；

(2) DNA molecular shown in the sequence 2 of sequence table；

The gene for encoding the light chain is following (3) or (4)：

(3) DNA molecular shown in the sequence 4 of sequence table from the nucleotides of 5 ' end 25-726；

(4) DNA molecular shown in the sequence 4 of sequence table.

The present invention also protects the IgG preparing suppression vascular cell growth and/or propagation and/or migration and/or micro-pipe Application in the product of formation.The vascular cell is Human umbilical vein endothelial cells.The Human umbilical vein endothelial cells tool Body is HUVEC cells.

The present invention also protects the IgG preparing the application in suppressing the product that CNV is formed.

The present invention also protects applications of the IgG in the product for suppressing growth of tumour cell and/or propagation is prepared.It is described Tumour cell is human liver cancer cell.The human liver cancer cell is specially HepG-2 cells.

The present invention also protects applications of the IgG in the product for suppressing tumour growth is prepared.The tumour growth embodies Increase for the volume of tumour becomes big and/or tumour quality.The tumour concretely liver cancer.The tumour is concretely Tumour or subcutaneous transplantation knurl that human liver cancer cell causes.The human liver cancer cell is specially HepG-2 cells.

The invention provides the human monoclonal antibodies to VEGFR2, can blocking VEGF R2 combined with its part VEGF, Suppress propagation and the migration of Human umbilical vein endothelial cells.

The present invention has great for the treatment of disease and tumour that the propagation of Human umbilical vein endothelial cells and migration cause Application value.

Brief description of the drawings

Fig. 1 is the structural representation of recombinant plasmid pCMV-H+L.

Fig. 2 is FORTBIO result of the tests.

Fig. 3 is the result of the test of the HUVEC cells propagation that antibody can effectively suppress VEGF inductions.

Fig. 4 is the result of the test that antibody can effectively suppress HUVEC cells propagation.

Fig. 5 is the result of the test that antibody effectively suppresses HUVEC cell migrations.

Fig. 6 is the result of the test that antibody effectively suppresses the formation of HUVEC cellular microtubules.

Fig. 7 is the changes of weight of animal subject during packet transaction.

After Fig. 8 terminates for packet transaction, the knurl weight distribution map (one animal subject of the single table of each point) of animal subject.

After Fig. 9 terminates for packet transaction, the gross tumor volume of animal subject.

After Figure 10 terminates for packet transaction, the knurl volume inhibiting rate of animal subject.

Figure 11 is fluorescence area improvement rate result.

Figure 12 thickens improvement rate result for eye ground.

Specific embodiment

Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, It is what is be commercially available from routine biochemistry reagent shop.Quantitative test in following examples, is respectively provided with three repetitions real Test, results averaged.

Chinese hamster ovary celI (Chinese hamster ovary cell)：ATCC numberings are CRL-9096.HUVEC cells are (in human umbilical vein Chrotoplast)：Sciencell companies, catalog number is 8000.HepG-2 cells (human hepatoma cell strain)：ATCC Numbering is A019.

The discovery of embodiment 1, VEGFR2 specific antibodies

First, human monoclonal antibody library is set up

Peripheral blood is obtained from the volunteer of 30 informed consents, lymphocyte is separated and is extracted total serum IgE.Total serum IgE is anti- Transcription obtains cDNA.With cDNA as template, the variable region (VH of heavy chain of antibody and light chain is expanded with degenerate primer PCR And VL).PCR primer carries out 1% agarose gel electrophoresis, reclaims the DNA of the DNA and VL of VH, uses over-lap PCR Connect into single-chain antibody (scFv) gene.Single-chain antibody gene mixed in equal amounts from different volunteers, packet are used Inscribe cleavage, then carries out 1% agarose gel electrophoresis, reclaims DNA fragmentation and is connected to and has used identical restriction endonuclease The phagemid vector plasmid of cutting, the phagemid vector plasmid electric drilling transfection Escherichia coli after connection is bitten Thalline single-chain antibody library.

2nd, VEGFR2 human monoclonal antibodies screening

Recombinant human VEGF R2 protein is coated on 10 centimetres of plates first, is added single chain antibody phage and is incubated, Uncombined bacteriophage is washed away, the bacteriophage and ehec infection for combining is reclaimed, to expand bacteriophage.By first The bacteriophage that wheel is obtained and expanded is then added to be coated with 10 centimetres of plates of VEGFR2 protein, carries out the second wheel screening, So repeat, three-wheel screening enrichment is carried out altogether.The parent of the bacteriophage to VEGFR2 protein of enrichment is detected by ELISA And power.On the basis of three-wheel screening, the antibody sequence in positive bacteriophage is expanded by PCR, obtain some anti- The single-chain antibody of VEGFR2 protein.

The DNA of the DNA of the VH of each single-chain antibody and VL is cloned into the constant region of human IgG1's heavy chain and light chain respectively Aminoterminal, is then attached to mammalian expression vector, and transfection CHO cell obtains some anti-vegf R2 full length antibodies. By more each antibody of ELISA to the binding ability of VEGFR2 protein, one of antibody is shown to VEGFR2 The high affinity of protein, VEGFR2 specific antibodies are named as by the antibody.

As shown in the sequence 1 of sequence table, weight chain variable district contains three CDR region domains to the heavy chain of VEGFR2 specific antibodies (CDR1, CDR2 and CDR3 are followed successively by the sequence 1 of sequence table from N-terminal 45-54 amino acids residue, 69-85 Amino acids residue and 118-124 amino acids residue).The coded sequence of the heavy chain of VEGFR2 specific antibodies such as sequence Shown in the sequence 2 of list.

As shown in the sequence 3 of sequence table, light chain variable district contains three CDR region domains to the light chain of VEGFR2 specific antibodies (CDR1, CDR2 and CDR3 are followed successively by the sequence 3 of sequence table from N-terminal 44-54 amino acids residue, 70-76 Amino acids residue and 109-117 amino acids residue).The coded sequence of the light chain of VEGFR2 specific antibodies such as sequence Shown in the sequence 4 of list.

The acquisition of embodiment 2, recombinant cell

First, the structure of recombinant plasmid

1st, the DNA molecular (double-stranded DNA shown in the sequence 2 of sequence table of the heavy chain of composite coding VEGFR2 specific antibodies Molecule) and as template, the primer pair constituted using H-F and H-R is entered performing PCR and expanded, and obtains PCR amplifications Product.

H-F：GGCAAAGAATTCGCCGCCACC ATGGAACTGGGGCTCCGCTG；

H-R：GAGCTCGAATTCCTATTTACCCGGAGACAGGGAG。

2nd, the pcr amplification product obtained with restriction enzyme EcoR I digestion steps 1, reclaims digestion products.

3rd, with restriction enzyme EcoR I digestion pCMV-Myc plasmids, carrier framework is reclaimed.

4th, the carrier framework of the digestion products of step 2 and step 3 is connected, obtains recombinant plasmid pCMV-H.

5th, the DNA molecular (double-stranded DNA shown in the sequence 4 of sequence table of the light chain of composite coding VEGFR2 specific antibodies Molecule) and as template, the primer pair constituted using L-F and L-R is entered performing PCR and expanded, and obtains PCR amplifications Product.

L-F：GCAAAGAATTCGGCTTAATTGCCGCCACCATGGACATGAGGGTCCCTGCTCAG；

L-R：GCTCGAATTCCTAACACTCTCCCCTGTTGAAG。

6th, the pcr amplification product obtained with restriction enzyme EcoR I digestion steps 5, reclaims digestion products.

7th, with restriction enzyme EcoR I digestion pShuttle-CMV plasmids, carrier framework is reclaimed.

8th, the carrier framework of the digestion products of step 6 and step 7 is connected, obtains recombinant plasmid pShuttle-L.

9th, with restriction enzyme Spe I digestion recombinant plasmid pCMV-H, the large fragment of about 7100bp is reclaimed.

10th, with restriction enzyme Spe I digestion recombinant plasmid pShuttle-L, the small fragment of about 2600bp is reclaimed.

12nd, the large fragment of step 9 is connected with the small fragment of step 10, obtains recombinant plasmid pCMV-H+L.Restructuring The structural representation of plasmid pCMV-H+L is shown in Fig. 1.

2nd, the acquisition of recombinant cell

By recombinant plasmid pCMV-H+L transfection CHO cells, recombinant cell is obtained.

The extensive preparation and purification of embodiment 3, VEGFR2 specific antibodies

CD07V4 culture mediums：Shanghai Powermat Ltd. of Austria product.PFF06 supplemented mediums：Shanghai Powermat Ltd. of Austria product. The full name of MTX is methotrexate.

1st, the recombinant cell that Example 2 is obtained, is seeded to the CD07V4 culture mediums containing 400nM MTX, 37 DEG C, Shaken cultivation to cell density is (2-4) × 10⁶Individual cell/ml.

2nd, using 20 liters of working volume bioreactor culture cells of Dutch Applikon companies producing albumen.By 2500ml The cultivating system for completing step 1 is seeded to 10 liters of CD07V4 culture mediums, 36.5 ± 0.5 DEG C of cultures, 15 days (incubations In, it is 7.0 ± 0.05 to control pH；In incubation, by adjusting range of speeds 60-90rpm, throughput 0.02-0.05vvm, dissolved oxygen sets up an office 40%；Cell density reaches 5 × 10⁶Individual cell/ml starts feed supplement, every 48 hours Addition volume is the PFF06 supplemented mediums of the 5% of cultivating system).

3rd, after completing step 2, culture supernatant is taken, successively using one-level film bag (MILLIPORE:D0HC) and secondary membrane Bag (MILLIPORE:A1HC) clarification filtration is carried out, collect filtrate.

4th, the filtrate that step 3 is obtained is taken, affinity chromatography is carried out.

The affine fillers of Mabselect SURE produced using the chromatographic columns of GE AxiChrom 300 and GE companies, in chromatographic column Footpath is 300 millimeters, and dress pillar height degree is 150 millimeters.After the filtrate loading that step 3 is obtained, first with 20 liters of level pads (the PB buffer solutions of pH7.4,20mM containing 150mM NaCl) balance pillar, then (contains 20mM with 40L leacheates 1 The aqueous solution of sodium citrate and 1M NaCl, pH5.0) post is crossed, then with the (water containing 20mM sodium citrates of 40L leacheates 2 Solution, pH5.0) post is crossed, then cross post with 30 liters of leacheates 3 (aqueous solution containing 20mM sodium citrates, pH3.5). Collect absorption value OD when crossing post using leacheate 3_280nmIt is solution after the post excessively of more than 50mAU.

5th, take that step 4 obtains crosses solution after post, adjusts pH to 3.7 and room temperature is placed, and completes inactivation of virus.

6th, the solution that step 5 is obtained is taken, adjusts pH to 7.0, carry out ion-exchange chromatography.

The Q FF filled medias produced using the chromatographic columns of GE AxiChrom 200 and GE companies, chromatography column internal diameter is 200 Millimeter, dress pillar height degree is 300 millimeters.After loading, post is crossed with balance solution (the 0.02M Tris aqueous solution, pH7.0). Absorption value OD is collected since loading_280nmIt is solution after the post excessively of more than 100mAU.

7th, solution after the post excessively that step 6 is obtained is taken, it is below 4mS/cm to adjust electrical conductivity with water for injection.

8th, the solution that step 7 is obtained is taken, (purpose is removal HCP, host to carry out POROS XS ion-exchange chromatographies Residual DNA, the proteinA that comes off, endotoxin and condensate).

Using the chromatographic columns of GE AxiChrom 200, filler is POROS XS, and chromatography column internal diameter is 200 millimeters, dress Pillar height degree is 200 millimeters.After the solution loading that step 7 is obtained, first with 15 liters of equilibrium liquid (20mM sodium citrates The aqueous solution, pH5.0) balance pillar, then with 20 liters of eluents (sodium citrate containing 20mM and 0.16M NaCl's The aqueous solution, pH5.0) cross post.Absorption value OD is collected since with elution_280nmAfter the post excessively of more than 100mAU Solution.

9th, solution, the viral prefilter produced using Millipore companies and virus removal after the post excessively that step 8 is obtained are taken Filter, completes virus removal filtering under the pressure condition of 30psi, collects filtered fluid.

10th, the filtered fluid that step 9 is obtained is taken, the molecular cut off 30KD milipore filter bags for producing Millipore companies Concentrated, obtained VEGFR2 specific antibodies solution (protein concentration is not less than 50mg/ml).

VEGFR2 specific antibodies carry out SDS- polyacrylamide gel electrophoresises, in 2 bands, molecular weight be about 55KD and 22KD, the molecular weight with heavy chain and light chain matches.It is stored in -80 DEG C for a long time.Reclaim heavy chain and the corresponding albumen of light chain Band simultaneously carries out 15 sequencings of amino acid residue of N-terminal, respectively with the 1st to 15 of amino acid sequence shown in sequence 1 the It is consistent with the 1st to 15 of amino acid sequence shown in sequence 3.

According to patent " anti-vegf acceptor monoclonal antibody and its preparation method and application " (Application No. 200710171762.8；Authorization Notice No. be CN 101245106) in method prepare its claim 1 protection blood The monoclonal antibody (abbreviation control antibodies) of endothelial cell growth factor acceptor 2, as the VEGFR2 in the present invention The control of specific antibody.

The binding ability of embodiment 4, antibody and VEGFR2 protein

By FORTBIO testing inspections test antibodies and the binding ability of VEGFR2 protein.Test antibodies are embodiment The 3 VEGFR2 specific antibodies for preparing or control antibodies.Mouse source VEGFR2 protein and people source VEGFR2 protein are purchased From Suzhou Tongbo Biotechnology Co., Ltd., article No. is respectively mSKDR and hSKDR.

FORTBIO result of the tests are shown in Fig. 2.

Action effect of the embodiment 5, antibody to HUVEC cells

Specific antibody in the present embodiment, is the VEGFR2 specific antibodies of the preparation of embodiment 3 unless otherwise specified.

First, specific antibody can effectively suppress HUVEC cells propagation (mtt assay) of VEGF inductions

HUVEC cell surfaces have vegf receptor, can breed under the induction of VEGF.

VEGF (VEGF)：R＆D companies, article No. 293-VE.

1st, HUVEC cells are inoculated into 96 porocyte culture plates according to the concentration of 5000-8000 cells/well, are cultivated 8-10 hours, reject culture supernatant.

2nd, after completing step 1,96 porocyte culture plates are taken, adds plasma-free DMEM medium, cultivate 4-6 Hour, reject culture supernatant.

3rd, after completing step 2, VEGF containing 5ng/ml, 2% (volume ratio) hyclone and 0.015-32 μ g/ml are added The DMEM culture mediums of specific antibody (in terms of protein concentration), 37 DEG C, cultivate 96 hours in the environment of 5% carbon dioxide. Setting is added without VEGF and is added without the control first of specific antibody.Set and add VEGF but be added without the right of specific antibody According to second.

4th, after completing step 3, developed the color using tetramethyl azo azoles colorimetric method.

Result is shown in Fig. 3.Result show 2 μ g/ml specific antibodies can 30% suppression VEGF HUVEC cells are bred Facilitation.

2nd, antibody can effectively suppress HUVEC cells propagation (colony method)

Whether it is in vivo into the external model of knurl experiment, to having internal Tumor formation that soft agarose generation experiment can be examined With important prompting.

By HUVEC cells with containing 0.7% (volume ratio) soft agar, 20% (volume ratio) calf serum and test antibodies DMEM culture mediums mix in equal volume, and concentration of the test antibodies in mixed system is 5-20 μ g/ml (in terms of protein concentration). Mixed system is added in the culture dish of a diameter of 6cm, 37 DEG C is placed in, is cultivated 7 days in the environment of 5% carbon dioxide, Then observed under inverted microscope, taken pictures and colonies number.Setting is added without the control of test antibodies.It is to be measured anti- Body is control antibodies prepared by specific antibody or embodiment 3.

Result is shown in Fig. 4 (1：Specific antibody concentration is 5 μ g/ml；2：Specific antibody concentration is 20 μ g/ml；3：It is right It is 5 μ g/ml according to AC；4：Control antibodies concentration is 20 μ g/ml).Compared with the control, specific antibody is 5 The colony formation of HUVEC cells can effectively be suppressed during μ g/ml, and (specific antibody is to HUVEC cells during 5 μ g/ml Inhibiting rate for 50%), control antibodies are 20% to the inhibiting rate of HUVEC cells during 5 μ g/ml.

3rd, antibody effectively suppresses HUVEC cell migrations (scarification)

Cell migration is the necessary condition of angiogenesis, can be with observation of cell plane motion capabilities using scratch test.

By 5 × 10⁵Individual HUVEC cells/wells are inoculated into 24 porocyte culture plates, after forming cell monolayer, with aseptic Toothpick draws " one " on cell monolayer, then rinses cell 3 times with serum free medium, adds special containing 5 μ g/ml The DMEM culture mediums of xenoantibody and 10% (volume ratio) calf serum, observe after continuing to cultivate 48 hours.Set not Add the control of specific antibody.

Result is shown in Fig. 5.Result shows that specific antibody can effectively suppress HUVEC migrations during 5 μ g/ml.

4th, antibody effectively suppresses HUVEC cellular microtubules and forms (MatriGEL methods)

Micro-pipe forms experiment and can simulate the process of angeogenesis in human body, including endothelial cell teething propagation and capillary The steps such as plexus structure formation, close to the real process of blood in human body in pipe generation.Endothelial cell is in matrigel culture Network structure can be formed when being cultivated on base.

By 8 × 10⁴Individual HUVEC cells/wells are inoculated into six porocyte culture plates, and suction is added containing 10 μ g/ml after abandoning supernatant The matrigel culture medium (Matric gel) of specific antibody, culture is observed after 72 hours.Setting is added without specific antibody Control.

Result is shown in Fig. 6.Result shows that specific antibody can effectively suppress HUVEC and form micro-tubular structure during 10 μ g/ml.

Growth inhibition effect of the embodiment 6, antibody to HepG-2 cell subcutaneous transplantation knurls

Animal subject is adult BALB/C-nu/nu mouse, and 18.0~22.0g, female, Beijing dimension tonneau China experiment is dynamic Thing Technology Co., Ltd., experimental animal credit number：SCXK- (army) 2012-0001.

1st, with the resuspended HepG-2 cells of physiological saline, 5 × 10 are obtained⁷The cell suspension of individual cell/ml；Take tested dynamic Thing, right fore armpit subcutaneous vaccination 0.2ml cell suspensions, during animal subject Subcutaneous Tumor Growth to diameter about 2-3cm, Tumor mass is taken out under aseptic condition, the tumor mass of about 1.5mm × 1.5mm sizes is cut into.

2nd, new animal subject, the tumor mass that every mouse right fore armpit 1 step 1 of subcutaneous vaccination is obtained, packet are taken Treatment is following (every group of 8 mouse)：

First group：Successive administration surrounding, gives 2 VEGFR2 of the preparation of embodiment 3 by tail vein injection weekly Specific antibody, unit dosage form is 40mg medicines/kg body weight；

Second group：Successive administration surrounding, gives 2 VEGFR2 of the preparation of embodiment 3 by tail vein injection weekly Specific antibody, unit dosage form is 20mg medicines/kg body weight；

3rd group：Successive administration surrounding, gives 2 VEGFR2 of the preparation of embodiment 3 by tail vein injection weekly Specific antibody, unit dosage form is 10mg medicines/kg body weight；

4th group：Successive administration surrounding, gives 2 VEGFR2 of the preparation of embodiment 3 by tail vein injection weekly Specific antibody, unit dosage form is 5mg medicines/kg body weight；

5th group (control group)：Successive administration surrounding, gives 2 physiological saline by tail vein injection weekly.

After packet administration terminates, cervical dislocation puts to death animal, and peeling off tumor mass is used to take pictures, and weighs.Tumor-like hyperplasia= (control group knurl weight-administration group knurl weight)/control group knurl weight × 100%.Gross tumor volume=1/2ab²(a=tumour major diameters, B=tumours minor axis)；Knurl volume inhibiting rate=(control group gross tumor volume-administration group gross tumor volume)/control tumor group body Product × 100%.Test data is usedRepresent.Statistical analysis between carrying out group with t- check problems in EXCEL softwares.

Packet transaction starts number of days, and the changes of weight of animal subject is shown in Fig. 7 during packet transaction.Packet transaction terminates Afterwards, the knurl weight distribution map of animal subject is shown in Fig. 8 (one animal subject of the single table of each point).After packet transaction terminates, receive The gross tumor volume for trying animal is shown in Fig. 9, and knurl volume inhibiting rate is shown in Figure 10.

The results are shown in Table 1.

Growth inhibition effect of the table 1VEGFR2 specific antibodies to HepG-2 cell subcutaneous transplantation knurls

(start to refer to packet transaction to start, end refers to packet transaction and terminates, and knurl weight and gross tumor volume refer to packet Treatment terminate after knurl weight and gross tumor volume)

Note：Compare with control group, " * " P<0.05, " * * " P<0.01, " * * * " P<0.001.

Embodiment 7, antibody suppresses laser-induced rhesus macaque CNV

Rhesus macaque, all-male, 2-4 Sui, body weight 3.90-4.90kg, Chengdu Green Hao Si bio tech ltd, Production licence number：SCXK (river) 2011-013.

First, animal model is made

It is solidifying around rhesus macaque fundus flavimaculatus central fovea light using 532nm laser, eyeground choroidal neovascularization is induced, build The vertical animal model similar with mankind's CNV.Color fundus photograph is carried out before light is solidifying and after light is solidifying within 20-21 days Phase, fundus fluorescein angiography, optical coherence tomography (OCT), judge modeling situation.After light is solidifying 21 days, Laser spot is in fluorescence high around monkey fundus flavimaculatus, and notable Fluorescein Leakage, seepage exceedes light spot edge substantially, points out Modeling success.

2nd, packet administration

The successful rhesus macaque of modeling is taken, packet transaction is as follows：

First group (control group, 2)：Simple eye injection, through the sodium chloride injections of 50 μ L of vitreum single injection 0.9%；

Second group (3)：Simple eye injection, the VEGFR2 prepared through 50 μ L embodiments of vitreum single injection 3 is special Xenoantibody (specific antibodies of VEGFR2 containing 0.05mg, with albumen gauge)；

3rd group (3)：Simple eye injection, the VEGFR2 prepared through 50 μ L embodiments of vitreum single injection 3 is special Xenoantibody (specific antibodies of VEGFR2 containing 0.2mg, with albumen gauge)；

4th group (2)：Simple eye injection, the VEGFR2 prepared through 50 μ L embodiments of vitreum single injection 3 is special Xenoantibody (specific antibodies of VEGFR2 containing 0.5mg, with albumen gauge).

Respectively at 7 days after administration, carry out within 21 days color fundus photograph, fundus fluorescein angiography, optical coherence break Layer scanning etc. checks observation test sample to the suppression situation of CNV, and dissects animal and take eyeball and carry out pathology Histological examination.

Fundus fluorescein angiography the results are shown in Table 2.Fluorescence area improvement rate result is shown in Figure 11.Control group rhesus macaque Giving 0.9% sodium chloride injection 7 days and after 21 days：Fluorescein Leakage degree has no mitigation, and fluorescent spot area is not See diminution, fluorescent penetrant area improvement rate is respectively -6.27%, 22.66%；OCT is checked and is had no that the solidifying place's retina of light is damaged Injure thickness to take an evident turn for the better, disease damage highest point retinal thickness improvement rate is respectively 10.15%, 21.29%.Rhesus macaque After VEGFR2 specific antibodies are given 7 days, have before the relatively administration of Fluorescein Leakage situation and clearly take a turn for the better, fluorescent spot Area is also obviously reduced, and second group, the 3rd group and the 4th group of fluorescent penetrant area improvement rate improvement rate is followed successively by 34.00%th, 34.16%, 49.81%.Rhesus macaque after VEGFR2 specific antibodies are given 21 days, second group, the 3rd group Fluorescent penetrant area improvement rate with the 4th group is followed successively by 44.30%, 51.27%, 71.85%, OCT check visible disease damage Place's retinal thickness has substantially reduction, and PE is more regular, continuous.

What optical coherence tomography (OCT) was checked the results are shown in Table 3.Eye ground thickens improvement rate result and sees Figure 12. After VEGFR2 specific antibodies are given 7 days, second group, the 3rd group and the 4th group of eye ground is thickened and changed rhesus macaque Kind rate is followed successively by 36.58%, 39.36%, 66.62%.Rhesus macaque after VEGFR2 specific antibodies are given 21 days, second Group, the eye ground of the 3rd group and the 4th group thicken improvement rate and are followed successively by 45.23%, 61.59%, 89.58%.Second Group, the effect of the 3rd group and the 4th group are significantly better than that control group, the statistically significant (P of difference<0.05).As a result table Bright, VEGFR2 specific antibodies have obvious inhibitory action to laser-induced CNV.

The result of the fundus fluorescein angiography of table 2, Fluorescein Leakage area improvement rate

First group

Second group

3rd group

4th group

7 days after administration	-6.27±6.48	34.00±2.69*	34.16±5.05*	49.81±7.65*
					21 days after administration	22.66±2.72	44.30±4.32*	51.27±2.75*	71.85±9.44*

The result that the optical coherence tomography of table 3 is checked, eye ground thickens improvement rate

	First group	Second group	3rd group	4th group
					7 days after administration	10.15±6.17	36.58±9.10*	39.36±14.06*	66.62±16.88*
21 days after administration	21.29±2.07	45.23±5.32*	61.59±10.51*	89.58±19.23*

Pharmacokinetic of the embodiment 8, antibody in primate body

The biological sample analysis part of the present embodiment is according to Institute of Radiation Medicine of Military Medical Science Institute medicine generation Thank to research approach, the Military Medical Science Institute's Institute of Radiation Medicine's drug metabolism with pharmacokinetic experiment room SOPs existing with pharmacokinetic experiment room bioanalysis portion is performed, and complies with GLP management.

The present embodiment research the single or multiple drip-feed various dose antibody of rhesus macaque blood concentration-time change with And pharmacokinetics, for the formulation of clinical trial protocol provides theoretical and experimental basis.

By rhesus macaque 24 (male and female half and half), it is divided into 4 groups, every group 6 (3 ♀, 3 ♂)：

Subcutaneous administration low dose group：Single-dose, VEGFR2 specific antibodies/kg body weight prepared by 5mg embodiments 3；

Subcutaneous administration middle dose group：Single-dose, VEGFR2 specific antibodies/kg body weight prepared by 20mg embodiments 3；

Subcutaneous administration high dose group：Single-dose, VEGFR2 specific antibodies/kg body weight prepared by 80mg embodiments 3；

Multiple dosing group：Drip-feed every two weeks 1 time, successive administration 4 times, single dose is 20mg embodiments 3 VEGFR2 specific antibodies/kg the body weight of preparation.

Whole blood about 0.8mL, 1200 × g centrifugation 10 minutes is taken from foreleg vein, is separated in serum to clean tubule, obtained To the blood serum sample at each group each time point.The concentration of VEGFR2 specific antibodies is used through methodology in rhesus serum samples The enzyme linked immunosorbent assay analysis method (ELISA) of confirmation carries out quantitative determination.Minimum quantitative limit (LLOQ) is：31.25ng/mL.

(1) the pharmacokinetics detection of single-dose group

The peak time (Tmax) that basic, normal, high three groups of rhesus macaque single-dose is followed successively by 0.6 ± 0.2hr, 0.6 ± 0.2 Hr and 2.3 (0.5-24) hr, each group peak time no difference of science of statistics (P>0.05).Rhesus macaque single-dose is low, Middle and high three groups are followed successively by 129.1 ± 12.0 μ g/mL, 518.1 ± 116.9 μ g/mL and 2010.5 up to Cmax Cmax ±211.7μg/mL.The AUC (0-t) that basic, normal, high three groups of rhesus macaque single-dose is (during 0 to t time points medicine TG-AUC) it is followed successively by 9580.2 ± 1672.3hr μ g/mL, 54287.9 ± 16040.1hr μ g/mL With 281480.8 ± 62539hr μ g/mL.The AUC (0-inf) (0 that basic, normal, high three groups of rhesus macaque single-dose To infinite area under serum drug concentration) it is followed successively by 10185.8 ± 2336.6hr μ g/mL, 54407.7 ± 16198.4hr μ g/mL and 281670.1 ± 62444.4hr μ g/mL.Cmax and AUC are deposited between each dosage group In notable significant difference (P<0.001).

The basic, normal, high three groups of dosages ratio of rhesus macaque single-dose is 1:4:The ratio between 16, Cmax is 1:4.0:15.6, The ratio between AUC (0-t) is 1:5.7:29.3.Effective T1/2 is followed successively by 92.4 ± 14.9hr, 130.5 ± 20.8hr With 159.7 ± 39.4hr, end phase T1/2 is followed successively by 59.3 ± 23.3hr, and 66.3 ± 36.3hr and 100 ± 36.8hr, T1/2 have extended with dosage increase；System clearance rate Cl is followed successively by 0.5 ± 0.1mL/hr/kg, 0.4 ± 0.2mL/hr/kg and 0.3 ± 0.1mL/hr/kg, is declined slightly with dosage increase；Apparent volume of distribution Vd It is followed successively by between 41.8 ± 12mL/kg, 33.6 ± 10.4mL/kg and 40.9 ± 14.5mL/kg each group without system Meter learns difference (P>0.05).Serum drug level-time change is in typical " chair " shape curve after rhesus macaque administration, It is free with internal also in the presence of one " the sink phases " of concentration dependant i.e. after a quick distribution with elimination phase Antigen is directly related, meets the universal law of antibody elimination.

(2) the pharmacokinetics detection of multiple dosing group

In serum after multiple dosing group first administration VEGFR2 specific antibodies peak concentration (Cmax) be 583.2 ± 73.3 μ g/mL, Cmax is 513 ± 240.3 μ g/mL after last dose；AUC (0-t) after first administration and AUC (0-inf) is respectively 49018.4 ± 5745.5hr μ g/mL and 61269.5 ± 18323.5hr μ g/mL, And the AUC (0-t) and AUC (0-inf) after last dose be respectively 65997.8 ± 48453.3hr μ g/mL and 67099.8±48071.3hr·μg/mL.It is 112.7 ± 47.3hr, last that phase T1/2 is eliminated after first administration After administration, it is 87.7 ± 56.2hr to eliminate phase half-life period T1/2.Compare with first administration, after the 4th administration Rate of accumulation (AR) is 1.3 ± 0.9.After rhesus macaque continuous several times drip-feed VEGFR2 specific antibodies, last medicine Exposure is slightly above first administration, and the accumulation factor is 1.3.

Claims (10)

1. a kind of IgG, its heavy chain is made up of weight chain variable district and heavy chain constant region, and its light chain is by light chain variable district and light Chain constant region is constituted；CDR1, CDR2 and CDR3 in the weight chain variable district are followed successively by the sequence 1 of sequence table from N End 45-54 amino acids residue, 69-85 amino acids residue and 118-124 amino acids residues；Institute State CDR1, CDR2 and CDR3 in light chain variable district and be followed successively by the sequence 3 of sequence table from 44-54 ammonia of N-terminal Base acid residue, 70-76 amino acids residue and 109-117 amino acids residues.

2. IgG as claimed in claim 1, it is characterised in that：The heavy chain is more shown in the sequence 1 of sequence table Peptide；Polypeptide of the light chain shown in the sequence 3 of sequence table.

3. the gene of IgG described in claim 2 is encoded, it is characterised in that：

The gene for encoding the heavy chain is following (1) or (2)：

(1) DNA molecular shown in the sequence 2 of sequence table from the nucleotides of 5 ' end 10-1398；

(2) DNA molecular shown in the sequence 2 of sequence table；

The gene for encoding the light chain is following (3) or (4)：

(3) DNA molecular shown in the sequence 4 of sequence table from the nucleotides of 5 ' end 25-726；

(4) DNA molecular shown in the sequence 4 of sequence table.

4. the IgG described in claim 1 or 2 prepare suppress vascular cell growth and/or propagation and/or migration and/ Or the application in the product of micro-pipe formation.

5. application according to claim 4, it is characterised in that：The vascular cell is Human umbilical vein endothelial cells.

6. the IgG described in claim 1 or 2 is preparing the application in suppressing the product that CNV is formed.

7. the IgG described in claim 1 or 2 in the product for suppressing growth of tumour cell and/or propagation is prepared should With.

8. application according to claim 7, it is characterised in that：The tumour cell is human liver cancer cell.

9. applications of the IgG described in claim 1 or 2 in the product for suppressing tumour growth is prepared.

10. application according to claim 5, it is characterised in that：The tumour growth is presented as the volume of tumour Becoming big and/or tumour quality increases.