CN106676118A - Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same - Google Patents
Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same Download PDFInfo
- Publication number
- CN106676118A CN106676118A CN201710098833.XA CN201710098833A CN106676118A CN 106676118 A CN106676118 A CN 106676118A CN 201710098833 A CN201710098833 A CN 201710098833A CN 106676118 A CN106676118 A CN 106676118A
- Authority
- CN
- China
- Prior art keywords
- bacillus licheniformis
- epsa
- engineering bacterium
- genetic engineering
- polysaccharide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Separation Of Suspended Particles By Flocculating Agents (AREA)
Abstract
The invention provides a bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and a construction method for the same, relates to gene engineering and microbial fermentation, and discloses bacillus licheniformis of an overexpressed glycosyltransferase gene and a construction method thereof. A key enzyme epsA is cloned by a polysaccharide flocculant synthesis method, and a recombinant expression vector is constructed by virtue of an Escherichia coli-bacillus shuttle plasmid. The recombinant plasmid is introduced into bacillus licheniformis to construct recombinant bacillus licheniformis HN301-3 by an electrotransformation method, the polysaccharide flocculant yield of the constructed recombinant bacillus licheniformis is increased by 23.17 percent compared with that of an original strain, and the constructed recombinant bacillus licheniformis is expected to be used for industrially producing polysaccharide flocculants to increase the yield and reduce the cost.
Description
Technical field
The present invention relates to genetic engineering and microbial fermentation, more particularly, to the bacillus licheniformis of high polysaccharide flocculant
Genetic engineering bacterium and its construction method.
Background technology
Glycosyl transferase (glycosyltransferases, Gtfs) is that a series of catalysis disaccharide, glycan and sugar of participating in are answered
The class of enzymes of sugar chain synthesis in compound, it is main to be responsible for for the monose of active donor being transferred to sugar, protein, lipid and nucleic acid point
On son, glycosylation is completed.There are some researches show glycosyltransferase gene (epsA) is the weight in polysaccharide biosynthetic process
Gene is wanted, effect is the transhipment for determining the chain length of polysaccharide and participating in polysaccharide.(J Bacteriol,1999,181(11):3599-
3605；Proc Natl Acad Sci U S A,2001,98(20):11621-11626).
Microbial flocculant (Microbial flocculant, MBF) is that microorganism secretion can make suspension
The macromolecular compound of solid particle, thalline, cell and jelly flocculation sediment, main component has polysaccharide, glycoprotein, albumen
Matter, cellulose and DNA etc..Microbial flocculant has the advantage such as safe efficient, biodegradable and environmentally safe, and
The microbe species that can produce flocculant are more, growth is fast, be easy to realize industrialization using engineering means.Therefore microbial flocculation
The DEVELOPMENT PROSPECT of agent is very good.At present, polysaccharide bioflocculant has been applied to remove the pigment in textile printing and dyeing wastewater
(Colloids and Surfaces B-Biointerfaces,2005,44(4):179-186.), Industry Waste can also be removed
Heavy metal ion in water and other suspended contaminants (Bioresource Technology, 2007,98 (2):361-367.).
But polysaccharide flocculant yield poorly, it is relatively costly, govern its heavy industrialization application.At present, for culture medium, culture
The external factor such as condition, growth factor influence polysaccharide flocculant synthesis report a lot (Process Biochemistry,
2014,49(4:576-582；Colloids and Surfaces B:Biointerfaces,2014,116:257-264).And
The report influenceed on its polysaccharide flocculant synthetic quantity from the heredity of bacillus licheniformis and angle of physiology is very rare.Due to many
Sugared flocculant complex structure, and most of research for polysaccharide and flocculation activity is not concerned with, relevant polysaccharide flocculant metabolism is on the way
The research in footpath is also less, and does not almost have by the report that Protocols in Molecular Biology transforms bacterial strain raising polysaccharide flocculant yield,
Therefore high yield strain excellent is built by technique for gene engineering, polysaccharide flocculant activity and yield is further improved, with important
Economic worth and social effect.
It is bacillus licheniformis that the applicant provides bacillus licheniformis in Chinese patent 200910111262.4
(Bacillus licheniformis), the microorganism was preserved in Chinese microorganism strain preservation pipe on 01 14th, 2009
Reason committee common micro-organisms center, collection numbering of registering on the books is CGMCCNo.2876.
The content of the invention
The first object of the present invention is for polysaccharide flocculant flocculation activity in the prior art is high, Regulation Mechanism is failed to understand
The problems such as, there is provided glycosyltransferase gene epsA.
The second object of the present invention is to provide bacillus licheniformis genetic engineering bacterium.
The third object of the present invention is the construction method for providing bacillus licheniformis genetic engineering bacterium.
The fourth object of the present invention is to provide bacillus licheniformis genetic engineering bacterium answering in polysaccharide flocculant is prepared
With.
The glycosyltransferase gene epsA is obtained using PCR amplification clone's polysaccharide flocculant route of synthesis, the glycosyl
SEQ ID No in the nucleotide sequence of transferase gene epsA such as sequence table：Shown in 1.
The bacillus licheniformis genetic engineering bacterium is that the glycosyltransferase gene epsA fragments are connected into expression to carry
On body, bacillus licheniformis then is imported into for bacillus licheniformis (Bacillus using the method for electricity conversion
Licheniformis in), bacillus licheniformis genetic engineering bacterium is obtained by resistance screening.The bacillus licheniformis
(Bacillus licheniformis) was preserved in China Committee for Culture Collection of Microorganisms on 01 14th, 2009
Common micro-organisms center, collection numbering of registering on the books is CGMCCNo.2876；The expression vector is episomal vector, preferably
Expression vector PHY300PLK-PamyL-TTamyL, the promoter of the expression vector is bacillus licheniformis (Bacillus
Licheniformis) the promoter PamyL of alpha-amylase gene.
The construction method of the bacillus licheniformis genetic engineering bacterium is comprised the following steps：
1) design PCR primer amplification glycosyltransferase gene epsA；
2) genes of interest for obtaining will be expanded to be inserted under PHY300PLK-PamyL-TTamyL constitutive promoters PamyL
Trip MCS, obtains PHY300-epsA overexpression plasmids；
3) and then by PHY300-epsA overexpression plasmids it imported into E.coli DH5 α, in case electricity conversion after amplification；
4) by the PHY300-epsA overexpression plasmid electricity conversion bacillus licheniformis after extracted, concentration, 37 DEG C of recovery 5h
Afterwards, tetracyclin resistance flat board is coated with, then 12h is cultivated at 37 DEG C, screen transformant；
5) after transformant is through plasmid extraction, verified using PCR and double digestion, so as to obtain overexpression glycosyl transferase
The bacillus licheniformis recombinant bacterium HN301-3 of gene.
The bacillus licheniformis genetic engineering bacterium is applied in polysaccharide flocculant is prepared.
The method that the bacillus licheniformis genetic engineering bacterium prepares polysaccharide flocculant is comprised the following steps：
1) scrape a ring bacillus licheniformis recombinant bacterium HN301-3 to be inoculated in liquid seed culture medium, 35~37 DEG C,
200r/min cultivates 12~16h, prepares seed culture fluid；
2) by volume, it is inoculated in polysaccharide flocculant fermentation medium with 4% inoculum concentration, at 30~40 DEG C, 150~
50~60h is cultivated under the conditions of 300r/min, fermentation is carried out and is produced polysaccharide flocculant experiment；
3) gained zymotic fluid is collected by centrifugation supernatant, then is precipitated with Ethanol Method, freezing vacuum is done after being precipitated and dissolved in water
It is dry to obtain final product.
In step 2) in, it is described to be inoculated in polysaccharide flocculant fermentation medium with 4% inoculum concentration by volume,
37 DEG C, 48~56h is cultivated under conditions of 200r/min.
In step 3) in, the ethanol precipitation is extracted with the ethanol of three times volume, 4 DEG C of standing 12h, the speed of centrifugation
It is 6000~8000rpm, centrifugation time is 10~15min, and centrifuging temperature is 4 DEG C.
EpsA genes are the important genes in a series of eps gene clusters for encode glycosyl transferases, in different substrate specificities
Property glycosyl transferase effect under, include substantially the step of polysaccharide synthesizes in bacillus licheniformis：The phosphorylation of glucose, sugared core
Synthesis and transhipment, the synthesis of polysaccharide repeat unit, modification, polymerization and the transhipment of thuja acid.EpsA can participate in polysaccharide repeat unit
Polymerization, and determine the chain length of polysaccharide, is responsible for being transferred to the polysaccharide of synthesis afterwards extracellular.Based on above theory analysis, overexpression
EpsA genes, can increase the metabolic flux of polysaccharide flocculant route of synthesis, be conducive to improving the yield of polysaccharide flocculant, reduce
Cost.
The technical effects of the invention are that：The invention provides the genetic engineering bacterium that can improve polysaccharide flocculant yield
Construction method.The method includes procedure below：Clone the key enzyme glycosyltransferase gene of polysaccharide flocculant route of synthesis
(epsA), using E. coli-Bacillus shuttle plasmid construction recombinant expression carrier.To be recombinated by the method for electricity conversion
Plasmid imported into bacillus licheniformis, transformant is screened by tetracycline, then by PCR and double digestion to genetic engineering bacterium
(such as Fig. 1) is verified, so as to construct bacillus licheniformis recombinant bacterium HN301-3, the bacillus licheniformis that the present invention builds
23.17% (such as Fig. 2) of polysaccharide flocculant output increased of recombinant bacterium HN301-3 than starting strain.It is expected to be flocculated for polysaccharide
The industrialized production of agent, improves yield, reduces cost.
Brief description of the drawings
Fig. 1 is the PCR and digestion verification result figure of recombinant expression plasmid PHY300-epsA, wherein swimming lane 1,2:Kpn I are mono-
Digestion recombinant plasmid PHY300-epsA；Swimming lane 3,4：Kpn I and Spe I double digestion recombinant plasmid PHY300-epsA, swimming lane 5,
6:PCR expands epsA.
Fig. 2 is bacillus licheniformis CGMCC 2876 and its recombinant bacterium HN301-3 polysaccharide flocculants flocculation activity and yield
Compare figure.
Specific embodiment
According to following embodiments, the present invention can be best understood from.But as it will be easily appreciated by one skilled in the art that embodiment
Described content is only limitted to the explanation present invention.
Embodiment 1：The structure of recombinant expression carrier PHY300-epsA
Design PCR primer, for expanding epsA genetic fragments.
Upstream and downstream primer is respectively：
Sense primer：GCCGGTACCATGAAAGAAAATATTG (underscore is KpnI restriction enzyme sites)
Anti-sense primer：GAAACTAGTCATATAGCCAAGCGGC (underscore is SpeI restriction enzyme sites)
With the genomic DNAs of Bacillus licheniformis CGMCC 2876 as template, following PCR programs are carried out：
(1) 94 DEG C, 5min；(2)94℃,30s；(3) 55 DEG C, 30s；(4) 72 DEG C, 1min, step (2)~(4) repeat 35 circulations；
(5) 72 DEG C, 10min, 4 DEG C of preservations.
PCR reaction systems are as shown in table 1.
Table 1
PCR primer and expression vector PHY300PLK-PamyL-TTamyL are used into restriction enzyme Kpn I and Spe respectively
I double digestions, after recovery, PCR primer and expression vector are connected with T4DNA ligases with the ratio of (3 ︰ 1)~(5 ︰ 1) at 16 DEG C
12h builds recombinant expression carrier PHY300-epsA.
Embodiment 2:The structure of bacillus licheniformis genetic engineering bacterium HN301-3
By PHY300-epsA overexpression plasmids it is extracted and concentration after, electroporated bacillus licheniformis, 37 DEG C of recovery 5h
Afterwards, tetracyclin resistance flat board is coated with, then 12h is cultivated at 37 DEG C, screen transformant.After transformant is through plasmid extraction, using PCR and
Double digestion is verified (such as Fig. 1).So as to obtain the bacillus licheniformis engineering bacteria of overexpression glycosyltransferase gene epsA
HN301-3。
Electricity conversion is comprised the following steps that：
The preparation of bacillus licheniformis competence：
(1) in the ring B.licheniformis of 50mL LB inoculation of mediums one, 37 DEG C, 200r/min incubated overnights 12h；
(2) take incubated overnight liquid 1mL access 50mL growth mediums in, in 37 DEG C, after 200r/min is cultivated into logarithm
Phase, until cell OD600Reach 0.85~0.95；
(3) cell ice bath 30min, after stopping growing, (takes the clean centrifuge tubes of 50mL of advance precooling, adds 40mL to stop
The nutrient solution of growth) cell is harvested by centrifugation with 6 000r/min then at 4 DEG C；
(4) (shaken in 0 DEG C of ice-water bath every time for four times with the EP buffer solution 40mL suspension cells of ice-cold (0 DEG C of ice-water bath)
It is dynamic, precipitation is suspended, rifle gently pressure-vaccum can be used), and most cell is suspended in 1mL EP buffer solutions at last, reaches cell concentration
(1~1.3) × 1010CFU mL-1；
(5) competent cell is sub-packed in 1.5mL centrifuge tubes (precooled), often the μ L of pipe 100, then is directly carried out next
Step experiment or -70 DEG C of preservation competence；
The electricity of bacillus licheniformis turns：
(1) competent cell and 1~5 μ g plasmid mixtures are transferred in the electric shock pond in ice-cold 0.1cm gaps；
(2) converted with 1800V, 5ms pulse；
(3) 1mL recovery mediums are added in the rapid pond toward electric shock, bacteria suspension is recovered in 5mL centrifuge tubes, in 37 DEG C,
200r/min cultivates 5h；
(4) bacterium solution is coated in resistant panel, in 37 DEG C of cultures until occurring bacterium colony on flat board.
Embodiment 3:Polysaccharide flocculant is prepared using bacillus licheniformis and its engineering bacteria fermentation
The starting strains of bacillus licheniformis CGMCC 2876 and genetic engineering bacterium described in embodiment 2 are inoculated in liquid seeds
In culture medium, 37 DEG C, 200r/min culture 16h prepare seed culture fluid, and being inoculated in polysaccharide with the inoculum concentration of 4% (V/V) flocculates
In agent fermentation medium, 37 DEG C, 200r/min cultures carry out fermentation and produce polysaccharide flocculant experiment.Zymotic fluid is determined after 56h respectively
Flocculation activity and polysaccharide flocculant yield (such as Fig. 2).The thick of epsA gene overexpression recombination engineering bacteria polysaccharide flocculants is carried
Yield is 9.29g/L, and compared with opportunistic pathogen strain, slightly carrying yield 7.51g/L improves 23.17%.
The flocculation activity of biological flocculant can be determined using following methods:
Weigh in kaolin powder 0.2g and 50mL scale test tubes, sequentially add 2.5mLCaCl2Solution (10g/L) and 1mL
Prepare liquid, distilled water adds to concordant with graduation mark.After being sufficiently mixed, be immediately placed in cuvette, stand 5min after, with it is ultraviolet can
See spectrophotometer mensuration absorbance under wavelength 550nm.Blank determination is done with distilled water.Computing formula is as follows:
Flocculation activity (U/mL)=(B-A)/B × 100 × D
In formula, A：The OD of testing sample550Value, B：The OD of blank cultures550Value, D：Zymotic fluid extension rate.
The method for extraction and purification of biological flocculant：
(1) 10mL zymotic fluids 8000rpm centrifugation 5min are taken, except thalline, supernatant is collected, is repeated twice.
(2) 3 times of absolute ethyl alcohols of volume are added in supernatant, 12h is stood under the conditions of 4 DEG C.
(3) 8000rpm centrifugations 10min, abandons supernatant, plus 10mL deionized water dissolvings.3 times of volumes of addition in supernatant
Absolute ethyl alcohol, after standing 12h under the conditions of 4 DEG C, supernatant is abandoned in centrifugation.
(4) vacuum freezedrying.
Sequence table
<110>Xiamen University
<120>The bacillus licheniformis genetic engineering bacterium and its construction method of high polysaccharide flocculant
<130> 2016
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 753
<212> DNA
<213> Bacillus Licheniformis
<400> 1
atgaaagaaa atattgattt tagagaactg attgcaatct tgcgaaaaag aacggttctt 60
attctcgttt tgacaatagg tgtaacattg acgaccggaa tcattcagtt ctatgtgctg 120
acacctgtct atcaggcatc gacgcagatt ttggtgcatc aagtaggaga gaaaaaaggg 180
agcgccacgt acagcgatat tcaaatcaac ctgcaataca cgcggacatt ccaagcgctt 240
ctgaagaacc cggtgatttt ggagcaagtc aagagagagc ttgatttacc ttactctgcc 300
ggccggttgg gtgaaaaaat cgcaacgagc agtgaaagcg aatcagagat tattaacatt 360
acagttcaag acgaaaatca gaaacgggca gccgatatag cgaacacgct aacagcggtg 420
ctcaaaaaag agattaagca aatcatgaac accgatcgga taaccgtcct ttcaaaagcc 480
gacatcgtcg attcgccgac tcctgtcaga ccgaattaca aaatgaatat tttgctggca 540
ttcggcgccg caataatgac cggaatcgct ttggcgttct ttttggattt tatcgatgat 600
acggttgcaa ggccgtctca agtcgaaaag gaagcgggat ttatttattt gggaagtatt 660
gagcaaatga agcatacaaa aagtctgttt cgcggagacc ccgatatgaa tatccgtgtg 720
aaagcaggaa ggagtgagcc gcttggctat tag 753
<210> 2
<211> 25
<212> DNA
<213>Sense primer
<400> 2
gccggtacca tgaaagaaaa tattg 25
<210> 3
<211> 25
<212> DNA
<213>Anti-sense primer
<400> 3
gaaactagtc atatagccaa gcggc 25
Claims (8)
1. glycosyltransferase gene epsA, it is characterised in that the nucleotide sequence such as sequence table of the glycosyltransferase gene epsA
Middle SEQ ID No：Shown in 1.
2. bacillus licheniformis genetic engineering bacterium, it is characterised in that the glycosyltransferase gene epsA fragments are connected to expression
On carrier, bacillus licheniformis then is imported into for bacillus licheniformis (Bacillus using the method for electricity conversion
Licheniformis in), bacillus licheniformis genetic engineering bacterium is obtained by resistance screening；The bacillus licheniformis
(Bacillus licheniformis) was preserved in China Committee for Culture Collection of Microorganisms on 01 14th, 2009
Common micro-organisms center, collection numbering of registering on the books is CGMCCNo.2876.
3. bacillus licheniformis genetic engineering bacterium as claimed in claim 2, it is characterised in that the expression vector is episomal vector,
Expression vector is PHY300PLK-PamyL-TTamyL, and the promoter of the expression vector is bacillus licheniformis
(Bacilluslicheniformis) the promoter PamyL of alpha-amylase gene.
4. the construction method of bacillus licheniformis genetic engineering bacterium as claimed in claim 2, it is characterised in that comprise the following steps：
1) design PCR primer amplification glycosyltransferase gene epsA；
2) expanding the genes of interest that obtains, to be inserted into PHY300PLK-PamyL-TTamyL constitutive promoter PamyL downstreams more
Cloning site, obtains PHY300-epsA overexpression plasmids；
3) and then by PHY300-epsA overexpression plasmids it imported into E.coli DH5 α, in case electricity conversion after amplification；
4) by the PHY300-epsA overexpression plasmid electricity conversion bacillus licheniformis after extracted, concentration, after 37 DEG C of recovery 5h,
Coating tetracyclin resistance flat board, then 12h is cultivated at 37 DEG C, screen transformant；
5) after transformant is through plasmid extraction, verified using PCR and double digestion, so as to obtain overexpression glycosyltransferase gene
Bacillus licheniformis recombinant bacterium HN301-3.
5. bacillus licheniformis genetic engineering bacterium as claimed in claim 2 is applied in polysaccharide flocculant is prepared.
6. the method that bacillus licheniformis genetic engineering bacterium as claimed in claim 5 prepares polysaccharide flocculant, it is characterised in that bag
Include following steps：
1) scrape a ring bacillus licheniformis recombinant bacterium HN301-3 to be inoculated in liquid seed culture medium, 35~37 DEG C, 200r/min
12~16h of culture, prepares seed culture fluid；
2) by volume, it is inoculated in polysaccharide flocculant fermentation medium with 4% inoculum concentration, at 30~40 DEG C, 150~
50~60h is cultivated under the conditions of 300r/min, fermentation is carried out and is produced polysaccharide flocculant experiment；
3) gained zymotic fluid is collected by centrifugation supernatant, then is precipitated with Ethanol Method, vacuum freezedrying is i.e. after being precipitated and dissolved in water
.
7. the method that bacillus licheniformis genetic engineering bacterium as claimed in claim 6 prepares polysaccharide flocculant, it is characterised in that
Step 2) in, it is described to be inoculated in polysaccharide flocculant fermentation medium with 4% inoculum concentration by volume, in 37 DEG C, 200r/
48~56h is cultivated under conditions of min.
8. the method that bacillus licheniformis genetic engineering bacterium as claimed in claim 6 prepares polysaccharide flocculant, it is characterised in that
Step 3) in, the ethanol precipitation is extracted with the ethanol of three times volume, 4 DEG C of standing 12h, the speed of centrifugation for 6000~
8000rpm, centrifugation time is 10~15min, and centrifuging temperature is 4 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710098833.XA CN106676118A (en) | 2017-02-23 | 2017-02-23 | Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710098833.XA CN106676118A (en) | 2017-02-23 | 2017-02-23 | Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106676118A true CN106676118A (en) | 2017-05-17 |
Family
ID=58862299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710098833.XA Pending CN106676118A (en) | 2017-02-23 | 2017-02-23 | Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106676118A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929854A (en) * | 2019-04-15 | 2019-06-25 | 厦门大学 | One plant is overexpressed the engineering bacteria and its construction method that catabolite controls albumin A encoding gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624080A (en) * | 2016-01-15 | 2016-06-01 | 厦门大学 | Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof |
| CN106244478A (en) * | 2015-06-05 | 2016-12-21 | 中国科学院微生物研究所 | Bacillus licheniformis, prepared the method for flocculant and the application of flocculant by it |
-
2017
- 2017-02-23 CN CN201710098833.XA patent/CN106676118A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244478A (en) * | 2015-06-05 | 2016-12-21 | 中国科学院微生物研究所 | Bacillus licheniformis, prepared the method for flocculant and the application of flocculant by it |
| CN105624080A (en) * | 2016-01-15 | 2016-06-01 | 厦门大学 | Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof |
Non-Patent Citations (2)
| Title |
|---|
| RACHINGER,M等: "CP005965.1", 《GENBANK》 * |
| ZHEN CHEN 等: "Identification of Key Genes Involved in Polysaccharide Bioflocculant Synthesis in Bacillus licheniformis", 《BIOTECHNOLOGY AND BIOENGINEERING》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109929854A (en) * | 2019-04-15 | 2019-06-25 | 厦门大学 | One plant is overexpressed the engineering bacteria and its construction method that catabolite controls albumin A encoding gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105624080B (en) | Produce the bacillus licheniformis genetic engineering bacterium and its construction method of polysaccharide flocculant | |
| CN105624176B (en) | It is overexpressed engineering bacteria and the building of UDPglucose pyrophosphorylase gene | |
| CN107354188A (en) | The technique of ETEC JL GlcN fermenting and producing N acetylglucosamines | |
| CN101948794A (en) | Engineering lactobacilli for producing plant flavonoid to synthesize related enzymes, construction and application thereof | |
| CN103403155A (en) | New saccharomyces cerevisiae strains | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN106636151A (en) | Engineering bacterium for over-expressing glycosyltransferase gene and construction method | |
| CN106635940A (en) | Construction method and applications of bacillus subtilis with high yield of glucosamine | |
| CN106916776A (en) | The engineering bacteria and construction method of overexpression phosphoglucomutase gene and UDPglucose pyrophosphorylase gene | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| CN106434587B (en) | Glucosansucrase and application thereof | |
| CN107937296A (en) | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application | |
| CN106676118A (en) | Bacillus licheniformis gene engineering bacterium with high polysaccharide flocculant yield and construction method for same | |
| CN110144318B (en) | Pigment-free low-molecular-weight welan gum production strain and construction method and application thereof | |
| Gan et al. | Exopolysaccharide production by salt-tolerant bacteria: Recent advances, current challenges, and future prospects | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain | |
| CN109929854A (en) | One plant is overexpressed the engineering bacteria and its construction method that catabolite controls albumin A encoding gene | |
| CN112725372B (en) | Multi-enzyme complex vector for improving expression of welan gum and recombinant bacterium for high yield of welan gum | |
| CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
| CN104480056B (en) | A kind of genetic engineering bacterium of high-yield extracellular polysaccharide and its preparation method and application | |
| CN107201375A (en) | Produce the construction method and its application of (R, R) 2,3 butanediol engineering strain | |
| CN103361390B (en) | Method for eliminating side product polysaccharide in fermentation production of pyrroloquinoline quinone, and application of method | |
| CN110343643A (en) | One plant of hydrogenlike silicon ion and its fermentation and hydrogen production methods and applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170517 |
|
| RJ01 | Rejection of invention patent application after publication |