CN106676117A

CN106676117A - Construction and authentication of newcastle disease virus overall-length cDNA clone

Info

Publication number: CN106676117A
Application number: CN201610984552.XA
Authority: CN
Inventors: 袁小远; 王友令; 张玉霞; 杨金兴; 金维江; 于可响; 宋敏训
Original assignee: Poultry Research Institute Shandong Academy of Agricultural Sciences
Current assignee: Poultry Research Institute Shandong Academy of Agricultural Sciences
Priority date: 2016-11-09
Filing date: 2016-11-09
Publication date: 2017-05-17

Abstract

The invention relates to the technical field of biology, in particular to construction and authentication of a newcastle disease virus overall-length cDNA clone. The construction method of the newcastle disease virus overall-length cDNA clone comprises the following steps: extracting a total RNA of a separated newcastle disease virus; synthesizing a cDNA through reverse transcription by taking the total RNA as a template; designing a specific primer with an enzyme digestion site according to the total RNA of the newcastle disease virus, carrying out segmented amplification on all segments of the cDNA, and respectively cloning the segments into a plasmid vector; and connecting all the segments of the cDNA to form a plasmid vector with a genome overall-length cDNA, so as to obtain a newcastle disease virus overall-length cDNA. The overall-length cDNA and the construction method can be applied to researches on gene structures and functions of newcastle disease viruses, and the overall-length cDNA can be also used as a newcastle disease virus vaccine vector or prepared into a vaccine or a preparation for preventing or treating the newcastle disease viruses.

Description

The structure of Avian pneumo-encephalitis virus full length cDNA clone and identification

Technical field

The present invention relates to biological technical field, and in particular to a kind of structure of Avian pneumo-encephalitis virus full length cDNA clone and mirror It is fixed.

Background technology

Reverse genetics manipulation technology is referred to rna virus cdna group RNA reverse transcription into cDNA, prominent by gene in vitro The methods such as change, gene insertion, gene knockout, gene substitution artificially build it is new with infective virus studying virus Interaction between genome organization and function and virus host etc., is also full-length infectious CDNA clones technology, and is claimed For " virus rescue ".This technology solves the unworkable difficult problem of rna virus cdna group, while the research and development for new generation vaccine are carried New thinking is supplied.Build full-length genome clone be the key technology step and core for carrying out reverse genetic manipulation decision because Element.

Carry out the functional genomicses of virus and the research of new generation vaccine using reverse genetic method, to effectively preventing and treating virus Disease is significant.But external rescue system also has many problems to need further to improve, and needs to overcome existing method Some shortcomings, such as：The infectivity of external rna transcription sheet is usually weaker than viral RNA；The structure of full-length clone is time-consuming to be taken Power；And the RNA for preparing easily degrades, the RNA for causing transfection has polymorphism and heterogeneity, is difficult to recover complete in the cell The infectivity of RNA；Mutation and chimera RNA viruses activity may be very weak.

Avian pneumo-encephalitis virus (Newcastle disease virus, NDV) is the minus-stranded rna virus of sub-thread, non-segmented negative, Belong to Paramyxoviridae member.It is (medium that virus can be divided into anaphylactic type (strong poison), middle hair style by the pathogenic index according to standard Virulence) and delayed type (weak poison).Genome length about 15kb, its structure is 3 '-leader-NP-P-M-F-HN-L- Trailer-5 ', encodes successively 6 kinds of structural protein：Nucleocapsid protein（NP）, phosphoprotein（P）, stromatin（M）, fusion protein （F）, hemagglutinin-neuraminidase albumen（HN）And high molecular weight protein（L）.Because single NDV RNA in the cell can not Transcription and translation albumen is carried out, it needs nucleocapsid protein, phosphoprotein and high molecular weight protein composition RNP（Ribonucleoprotein is combined Thing）The function of transcription and translation could be exercised.

The content of the invention

For the research for further carrying out Avian pneumo-encephalitis virus GM0811 functional genomicses, first goal of the invention of the present invention There is provided a kind of Avian pneumo-encephalitis virus full length cDNA sequence.

Another goal of the invention of the present invention there is provided a kind of construction method of above-mentioned Avian pneumo-encephalitis virus full length cDNA sequence.

A kind of Avian pneumo-encephalitis virus full-length cDNA, the nucleotide of described full-length cDNA is shown in SEQ ID NO.1.

A kind of construction method of above-mentioned Avian pneumo-encephalitis virus full-length cDNA, concrete operation method adopts following steps：

（1）The total serum IgE for separating Avian pneumo-encephalitis virus is extracted, with the total serum IgE as template, reverse transcription synthesis cDNA；

（2）With step（1）Described cDNA is template, and with a pair of specific primers performing PCR amplification is entered, and obtains amplified production NDV- 1PCR, electrophoresis is carried out to amplified production and cuts glue reclaim genes of interest fragment NDV-In-PCR1, and genes of interest fragment is built into into enzyme In cutting rear plasmid pVAX, and expand in competent escherichia coli cell HST08, obtain positive plasmid NDV-IN1-5；

（3）With step（1）Described total cDNA is template, and with a pair of specific primers performing PCR amplification is entered, and obtains amplified production NDV- 2PCR, electrophoresis is carried out to amplified production and cuts glue reclaim genes of interest fragment NDV-In-PCR2, and genes of interest fragment is built into into enzyme In positive plasmid NDV-IN1-5 after cutting, and expand in escherichia coli dam-/dcm competent cell HST04, obtain plasmid NDV-IN2-2；

（4）With step（2）Described amplified production NDV-1PCR and step（3）Described amplified production NDV-2PCR is template, Enter performing PCR amplification with a pair of specific primers, electrophoresis is carried out to amplified production and cuts glue reclaim genes of interest fragment, by purification Genetic fragment is built in the plasmid NDV-IN2-2 after enzyme action, and is expanded in competent escherichia coli cell HST08, is obtained Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8.

With step（4）Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8 for obtaining is template, with two pairs of specific primers Respectively segmentation amplification is carried out to Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8, electrophoresis is carried out to amplified production and cuts glue reclaim Genes of interest fragment obtains NDV-IN3-8-PCR2 and NDV-IN3-8-PCR3, to NDV-IN3-8-PCR2 and NDV-IN3-8-PCR3 It is sequenced respectively, the splicing of NDV-IN3-8-PCR2 and NDV-IN3-8-PCR3 total lengths may make up the total length of Avian pneumo-encephalitis virus cDNA。

Further, step（2）The nucleotide of described specific primer is：SEQ ID NO.2 and SEQ ID NO.3； Step（3）The nucleotide of described specific primer is：SEQ ID NO.4 and SEQ ID NO.5；Step（4）Described is special The nucleotide of property primer is：SEQ ID NO.6 and SEQ ID NO.7.

Further, the nucleotide of the specific primer used by described NDV-IN3-8-PCR2 is: SEQ ID NO.8 With SEQ ID NO.9；The nucleotide of the specific primer used by described NDV-IN3-8-PCR3 is:SEQ ID NO.10 and SEQ ID NO.11；The reaction condition of segmentation amplification is 94 DEG C of 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C 3min totally 30 circulations.

Further, step（2）, step（3）And step（4）The reaction condition of described PCR amplifications is：94℃ 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 3min totally 30 circulations.

Further, step（2）The restriction endonuclease used by plasmid pVAX after described enzyme action is ClaI；Step（2）It is described Endonuclease reaction system condition be 30 DEG C reaction 16h；Step（2）Described genes of interest fragment is built into plasmid after enzyme action Reaction condition in pVAX is 50 DEG C of reaction 15min.

Further, step（3）The restriction endonuclease used by positive plasmid NDV-IN1-5 after described enzyme action is ClaI；Step Suddenly（3）The condition of described endonuclease reaction system is 30 DEG C of reaction 16h；Step（3）Described genes of interest fragment is built into enzyme It is 50 DEG C of reaction 15min to cut the reaction condition in rear positive plasmid NDV-IN1-5.

Further, step（4）The restriction endonuclease used by plasmid NDV-IN2-2 after described enzyme action is ClaI；Step（4） The condition of described endonuclease reaction system is 30 DEG C of reaction 16h；Step（4）Described genes of interest fragment is built into sun after enzyme action Reaction condition in property grain NDV-IN1-5 is 50 DEG C of reaction 15min.

Beneficial effect

The present invention designs 11 primers, using RT-PCR on the basis of whole genome sequence is determined according to corresponding restriction enzyme site Method amplifies covering gene group full-length cDNA fragment, and full length cDNA clone is entered into PAVX carriers with segmentation method, is finally completed The structure of NDV full length cDNA clone NDV-IN3-8, is capable of achieving to obtain infective clonal virus in vitro.With prior art phase Than the reconstruction virus saved out carries the molecular marker of design.The cDNA clone transfection of structure can cause complete virus Infection, and produce ripe progeny viral particles.Due to introducing eukaryotic promoter system, the step of so as to eliminate in vitro transcription, The operation for making infection clones seems very convenient.Constructed Avian pneumo-encephalitis virus full length cDNA clone, can pass through Jing after rescue Carry out necessary modification to gene, and then study gene structure and application of function grinding in newcastle disease virus gene structure and function Study carefully, can act also as Newcastle Disease Virus Vaccine or be prepared into prevention or treat the vaccine or preparation of Avian pneumo-encephalitis virus.

Description of the drawings

Fig. 1 amplified production NDV-In-PCR1 electrophoretograms；

Fig. 2 digested plasmid pVAX-ClaI electrophoretograms；

Fig. 3 amplified production NDV-In-PCR electrophoretograms；

Fig. 4 digested plasmid NDV-IN1-5-Cla I electrophoretograms；

Fig. 5 amplified production NDV-In3-PCR2 electrophoretograms；

Fig. 6 digested plasmid NDV-In2-PCR2 electrophoretograms；

Fig. 7 amplified production NDV-IN3-8-PCR2 and NDV-IN3-8-PCR3 electrophoretograms.

Specific embodiment

In conjunction with the embodiments the present invention is further illustrated, it should explanation, and the description below is merely to explain this Invention, is not defined to its content.

Material and instrument

1. experiment material RNA extracts kit, RT-PCR kit, DNA QIAquick Gel Extraction Kits, plasmid extraction kit, connection examination Agent box, DNA Marker DL2000 etc. are purchased from Dalian TaKaRa companies.

2. key instrument equipment DYY-2 types agarose gel electrophoresiies groove（Liuyi Instruments Plant, Beijing）, PCR amplification instrument （TaKaRa INC, Dice TP600）, gel imaging system（Alpha Innotech companies）, High speed refrigerated centrifuge （Beckman, AvantiTMJ-30I）, DNA sequencer（ABI, PRISMTM 3730XL DNA Sequencer）

Embodiment 1

1. the extraction of viral RNA

RNA is extracted：The Trizol of 200ul Newcastle Diseases venom and 1ml is added in the EP pipes without RNase of 1.5ml, it is fully mixed Place 5 minutes in room temperature after even, to be completely separated nucleoprotein complex.Add the chloroform of 0.2 ml, plus acutely concussion after covering 15 seconds, 2-3min is placed in room temperature, be then centrifuged for, the condition of centrifugation is 4 DEG C, and 12,000rpm 15 min of centrifugation are managed after centrifugation Inside it is divided into three layers, redness below is phenol-chloroform phase, and an intermediate layer, the above is colourless water phase.

RNA precipitate：Carefully upper strata aqueous phase is transferred in another EP pipes without RNase, adds the pre-cooling of equivalent volumes different Propanol, is stored at room temperature 10 min, centrifugation, and the condition of centrifugation is 4 DEG C, 12,000rpm 15 min of centrifugation.Can be in pipe after centrifugation Cotton-shaped glue sample precipitation is seen in side wall and bottom.

RNA is washed：Supernatant is removed, the washing with alcohol RNA precipitate of the pre-coolings of 1ml 75% is added in precipitation, gently mixed, from The heart, the condition of centrifugation is 4 DEG C, 12,000rpm 15 min of centrifugation.RNA dissolves：Supernatant is removed, RNA precipitate is air-dried in super-clean bench, plus Enter 10ul DEPC water and fully dissolve RNA.

2. the acquisition of genes of interest fragment 1

（1）Reverse transcription is carried out to the total serum IgE that step 1 is extracted, its bare bones is：Template, reactant liquor, primer are added in reactant liquor With RT reactions are carried out after enzyme reaction.Contain buffer, enzyme and primer in reactant, reaction cumulative volume is 20 ul.

Reaction system is：

Total RNA 1ul

d NTP Mixture (10 mM each) 1ul

Ran dom 6 mers (20 uM) 1ul

Oligo dT Primer (2.5 uM ) 1ul

RNase Free dH₂O 1ul

The reaction condition of above-mentioned reaction system is after 65 DEG C of reaction 5min, 2min on ice to be positioned over immediately.

Then following component is added in above-mentioned reaction system：

5× PrimeScript RT Buffe 4 ul

RNase Inhibitor (40 U/ul) 0.5 ul

PrimeScript RTase 0.5 ul

RNase Free dH₂O 10 ul

Total 20 ul

Add said components after reaction condition be：30 DEG C of reaction 10min, 45 DEG C of reaction 30min, 95 DEG C of reaction 5min, obtain cDNA。

（2）Enter performing PCR to product cDNA obtained above, reaction cumulative volume is 50 ul, and reaction system is：

cDNA 1ul

2×Gflex PCR Buffer（Mg²⁺, dNTP plus） 25ul

Tks Gflex DNA Polymerase (1.25 units/μl) 1ul

NDV INF1 (20 pmol/ul) 1ul

NDV INR1 (20 pmol/ul) 1ul

dH₂O 21ul

Total 50ul

Reaction condition is：94 DEG C of 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 3min totally 30 circulations.

The aminoacid of reaction primer is SEQ ID NO.2 and SEQ ID NO.3, and its sequence is shown in Table 1.

Taking the PCR product NDV-1PCR 5ul that above-mentioned reaction obtains carries out 1% sepharose electrophoresis identification, attached in 5.5kb Closely there is a band to be purpose genetic fragment band, see accompanying drawing 1.

Cut in glue reclaim using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 PCR primer purpose fragment is stated, NDV-In-PCR1 is named as.

（3）The preparation of carrier DNA

Endonuclease reaction system is as follows：

The ul of pVAX plasmids 2.5

10×M Buffer 5 ul

Cla I（10 U/ul） 1.5 ul

dH₂O Up to50 ul

Endonuclease reaction condition is 30 DEG C and reacts 16 hours.

Taking the above-mentioned ul of endonuclease reaction product 5 carries out 1% agarose gel electrophoresiies identification, has the band to be near 2900bp The genetic fragment band of purpose, is shown in accompanying drawing 2.

Glue reclaim DNA is cut using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Fragment is named as pvax-ClaI carrier DNAs.

（4）It is built into plasmid pvax：Genetic fragment NDV-In-PCR1 identified is built into into pvax-ClaI carriers In the multiple clone site of DNA, the linked system and condition of contact are：

Linked system：

pBR322-Cla I Vector DNA (50 ng/ul ) 1.5 ul

NDV-In-PCR1 (50 ng/ul ) 2 ul

5×In-Fusion HD Enzyme Premix 2 ul

dH₂O Up to10 ul

Condition of contact is 50 DEG C of reaction 15min.

Connection product is taken into 2ul thermal transitions into competent escherichia coli cell HST08, spread plate, 37 DEG C are overnight trained Support, picking positive colony plant bacterium, extract plasmid be named as NDV-IN1-5, NDV-IN1-6, using primer NDV-VP1, NDV P7, NDV P8, NDV P9, NDV R6, NDV L-YF, NDV L-YR, NDV F7, NDV P16, NDV P19, NDV-VP2 are to above-mentioned matter Grain sequencing, confirmation proceeds subsequent experimental using NDV-IN1-5 plasmids.

3. the acquisition of genes of interest fragment 2

（1）To step 2（1）The cDNA that step is obtained enters performing PCR amplification, and amplification system is as follows：

cDNA 1ul

2×Gflex PCR Buffer（Mg²⁺, dNTP plus） 25ul

Tks Gflex DNA Polymerase (1.25 units/μl) 1ul

NDV INF2 (20 pmol/ul) 1ul

NDV INR2 (20 pmol/ul) 1ul

dH₂O 21ul

Total 50ul

The aminoacid of reaction primer is SEQ ID NO.4 and SEQ ID NO.5, and its aminoacid sequence is shown in Table 1.

Taking the PCR product NDV-2PCR 5ul that above-mentioned reaction obtains carries out 1% sepharose electrophoresis identification, attached in 5.5kb Closely there is the genetic fragment band for the purpose of a band, see accompanying drawing 3.

Cut in glue reclaim using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 PCR primer purpose fragment is stated, NDV-In-PCR2 is named as.

（2）The preparation of carrier DNA

Endonuclease reaction system is as follows：

NDV-IN1-5 plasmid 2.5ul

10×M Buffer 5ul

Cla I（10 U/ul） 1.5ul

dH₂O Up to50ul

The reaction condition of above-mentioned endonuclease reaction is 30 DEG C and reacts 16 hours.Taking above-mentioned endonuclease reaction product 5ul carries out 1% agarose Gel electrophoresiss identify there is the genetic fragment band for the purpose of a band near 5.7kb, see accompanying drawing 4.

Glue reclaim DNA is cut using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 Fragment is named as NDV-IN1-5-ClaI carrier DNAs.

（3）It is built into positive plasmid NDV-IN1-5：Genetic fragment NDV-In-PCR2 identified is built into into NDV- IN1-5-ClaIn I carrier DNAs, the linked system and condition of contact are:

Linked system is：

NDV-IN1-5-Cla I Vector DNA (50 ng/ul ) 1.5 ul

NDV-In-PCR2 (50ng/ul) 2 ul

5×In-Fusion HD Enzyme Premix 2 ul

dH₂O Up to10 ul

Condition of contact is 50 DEG C of reaction 15min.

Connection product is taken into 2 ul thermal transitions extremelyE.coliIn HST04 dam-/dcm- Competent Cell, coating Flat board, 37 DEG C of incubated overnight, picking positive colony plants bacterium, extracts plasmid and is named as NDV-IN2-2.Using NDV-IN2-2 plasmids Proceed subsequent experimental.

4. genes of interest fragment 3 is obtained

（1）Newcastle disease virus gene fragment prepared by newcastle disease virus gene fragment NDV-1PCR prepared with step 2 and step 3 NDV-2PCR is template, and amplified reaction is carried out to newcastle genetic fragment, reacts laggard performing PCR reaction, and reaction system is：

NDV-1PCR product 1ul

NDV-2PCR product 1ul

2×Gflex PCR Buffer（Mg²⁺, dNTP plus） 25ul

Tks Gflex DNA Polymerase (1.25 units/μl) 1ul

NDV INF3 (20 pmol/ul) 1ul

NDV INR3 (20 pmol/ul) 1ul

dH₂O 20ul

Total 50ul

Reaction condition is 94 DEG C of 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 3min totally 30 circulations.

The nucleotide of reaction primer is SEQ ID NO.6 and SEQ ID NO.7.

Taking above-mentioned endonuclease reaction product 5ul carries out 1% agarose gel electrophoresiies identification, has a band to be mesh near 4.0kb Genetic fragment band, see accompanying drawing 5.

Cut in glue reclaim using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 PCR primer purpose fragment is stated, NDV-IN3-PCR2 is named as.

（2）The preparation of carrier DNA

Endonuclease reaction system is as follows：

NDV-IN2-2 plasmid 2.5ul

10×M Buffer 5ul

Cla I（10 U/ul） 1.5ul

dH₂O Up to50ul

Reaction condition is 30 DEG C and reacts 16 hours.Taking above-mentioned endonuclease reaction product 5ul carries out 1% agarose gel electrophoresiies identification, There is the genetic fragment band for the purpose of a band near 6.0kb, see Fig. 6.

Cut in glue reclaim using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 PCR primer purpose fragment is stated, NDV-IN2-2-C is named aslaI carrier DNAs.

（3）It is built into positive plasmid NDV-IN2-2 plasmids：Step is built into genetic fragment NDV-IN3-PCR2 identified The rapid 3 positive plasmid NDV-IN2-2-C for preparinglaIn the multiple clone site of I plasmids, the linked system and condition of contact are：

NDV-IN2-2-Cla I Vector DNA (50ng/ul) 1.5ul

NDV-IN3-PCR2 (50ng/ul) 2.5ul

5×In-Fusion HD Enzyme Premix 2ul

dH₂O Up to10ul

Condition of contact is 50 DEG C of reaction 15min.

Connection product is taken into 2 ul thermal transitions extremelyE.coliHST08 Premium Competent Cell（Code No.9128）In, spread plate, 37 DEG C of incubated overnight, picking positive colony plant bacterium, extract plasmid be named as NDV-IN3-3, NDV-IN3-8, using primer NDV-VP1, NDV F1, NDV P1, NDV P2, NDV P20, NDV F2, NDV R1, NDV P3, NDV P4, NDV F3, NDV R2, NDV-VP2 are to above-mentioned plasmid order-checking.NDV-IN3-8 plasmids are selected to carry out after sequence analysis Follow-up full-length gene sequencing.

5. segmented-PCR amplifying target genes

（1）Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8 with step 4 preparation is entered as template to newcastle genetic fragment Row segmentation is expanded, and reaction system is：

NDV-IN3-8 1ul

2×Gflex PCR Buffer（Mg2+, dNTP plus） 25ul

Tks Gflex DNA Polymerase(1.25 units/μl) 1ul

Primer F (20 pmol/ul)^* 1ul

Primer R (20 pmol/ul)^*1ul

dH₂O 21ul

Total 50ul

Reaction condition is 94 DEG C of 1min；Then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 3min totally 30 circulations.

Above-mentioned reaction is SEQ ID NO.8 and SEQ ID NO.9 with two pairs of specific primers, one pair of which；It is another to for SEQ ID NO.10 and SEQ ID NO.11；Its aminoacid sequence is shown in Table 1.

Take above-mentioned two pairs of specific primers expand respectively each 5 ul of PCR primer carries out 1% agarose gel electrophoresiies identification, Two PCR primers about have the genetic fragment band for the purpose of a band near 6Kb.

Glue is cut respectively using Takara MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 to return Above-mentioned NDV-IN3-8-PCR2, NDV-IN3-8-PCR3 product purpose fragment is received, NDV-IN3-8-PCR2, NDV-IN3- is named as 8-PCR3。

Respectively gene sequencing is carried out to NDV-IN3-8-PCR2, NDV-IN3-8-PCR3,

Sequencing result finds, undergos mutation at NDV whole genome sequences only 2 on NDV-IN3-8 plasmids, shows successfully to build entirely Long cDNA clone, sequencing sequencing primer used is shown in Table respectively 2.

Full length cDNA clone transfectional cell, obtains external Revive virus：When BNK cells length is to 90%, total length is carried out CDNA plasmid transfections.According to transfection reagent（Lipoefenatline 2000, Invitrogen) description transfected.Plasmid The supernatant of transfectional cell is passed on, and Jing after 5 times pass on, is detected using RT-PCR method.Meanwhile, if the cell conduct of untransfected Negative control.Confirm after testing successfully to build Avian pneumo-encephalitis virus full-length infectious CDNA clones plasmid, and Successful transfection DHK is thin Born of the same parents, obtain in vitro infective clonal virus.

The construction cDNA of table 1 clone primer used

The sequencing primer of table 2

<110>Academy of agricultural sciences of Shandong Province poultry institute

<120>The structure of Avian pneumo-encephalitis virus full length cDNA clone and identification

<160> 37

<210> 1

<211> 15192

<212> DNA

<213>Artificial sequence

accaaacaga gattctgtga gttacgataa aaagcgaagg agcaatcgaa gtcgcacggg 60

tagaaggtgt gaatctcgag tgcgagatcg aagctcaaac tcgagagagc cttctgccga 120

aatgtcttcc gtatttgatg agtacgagca gctccttgcg gcacagactc gccctaatgg 180

agctcatgga gggggagaga acgggagcac cttaaaagtt gaagtcccag tattcactct 240

caacagtgac gacccagaag atagatggaa ctttgcggta ttctgccttc ggattgctgt 300

tagcgaggat gccaacaagc cactcagaca aggtgctctc atatctctct tatgttccca 360

ctctcaagtg atgaggaacc atgttgctct tgcagggaaa caggatgaag ccacactggc 420

cgttcttgag atcgatggct ttaccaacag cgtgccccag ttcaacaaca ggagtggagt 480

gtctgaagag agagcacaga gattcatgat gatagcaggg tctctccctc gggcgtgcag 540

caatggtacc ccgttcatca cggctggggt tgaagatgat gcaccagaag atatcactga 600

tactctagag agaatcctct ctatccaggc tcaaatatgg gttacggtag caaaggccat 660

gactgcatat gagacagcag atgagtcgga aacaagaaga atcaataaat atatgcagca 720

aggcagagtc cagaagaggt acatccacca ccccgtgtgc aggagtgcaa ttcaactcac 780

aatcagacag tctctagcag tccgcatctt cttggttagc gagcttaaga gaggccgcaa 840

cacggcaggt gggagctcca catattacaa cctagtaggg gatgtagact catacatcag 900

gaacaccgcg cttactgcat tcttcctgac actcaagtat ggaatcaaca ccaagacttc 960

agccctcgca ctcagcagcc ttgcaggcga tatccaaaaa atgaaacagc tcatgcgttt 1020

atatcggatg aaaggagata atgcgccgta catgacattg ctaggtgaca gtgaccaaat 1080

gagctttgca ccagctgagt atgcacaact ttactctttt gccatgggta tggcatcagt 1140

cctggataaa gggactggca agtaccaatt cgccatagac tttatgagca catcattctg 1200

gagacttgga gtagagtatg ctcaggccca gggaagtagc attaatgagg atatggctgc 1260

cgagctaaag ctaaccccag cagcaaggag gggcctggca gccgctgccc aacgagtgtc 1320

tgaggagact ggcagcatgg atattcctac tcaacaagcc ggggtcctca ccgggctcag 1380

cgacaaaggc ccccaagccc cacaaggcgg atcgaacagg ccgcaaggac aaccggacgc 1440

cggggacggg gagacccaat ttttggacct tatgagagcg gtagcaaaca gtatgagaga 1500

agcgccgagc tctgcgcaga gcaccaccca gccagagccc ccctcaactc ctggaccatc 1560

tcaagataac gacaccgact gggggtattg accggcaaca ctcagcctgc ctctatagga 1620

ccatcccaac ccccttgcac gcaccccccc cccacccccc gatccacagc cccacatggc 1680

caaacccaca aacgagcccc cctctctctc ctctctcttc cagccccacg accccacccg 1740

cccaaagcaa cacaggcaca acttgaccca tcaacaatcc acacagaacc aaagacatta 1800

gaaaaaaata cgggtagaag agagatactc agagatcagg aagagtcacc agggtctctg 1860

ttctaccttc tacccagcag accagggcga atatggccac ctttacagac gcggagattg 1920

acgatctatt tgaaaccagt gggactgtca ttgacagcat aattacggcc cagggcaacc 1980

cagcggggac cgttggaagg agcgcaatcc cacaaggcaa aaccaaagca ttgagtgcag 2040

catgggagaa acatgagagc atccaaccat cggccagcca agacacccct gatagacaag 2100

acagaccaga caaacaaccg tccacaccta gacaggcgac tccacacaac aattcgccag 2160

ccacatctac tgaccagcct cctaccaagg ccgcagacga agccggcgac acacaactca 2220

agaccggagc aagcagctct cttctgtcga tgcttgacaa gcttaacaat aaatcgtcca 2280

atgctaaaaa gggcccatgg ttgagtcccc aggaagggca tcatcaactt ccaacccaac 2340

agcaggggag tcgaccgagc cgcagaaaca gtcaggagag accgcagaac caggtcaagg 2400

ccgcccctgg agaccggggc acagacgcga acacagcata tcatggacaa tgggaggagt 2460

cacaactatc agctggtgca atccctcatg ctctccggtc agggcagagc caagacaata 2520

ctcctgcacc tgtggatcat gcccagctac ctgtggactt tgtgcaggcg atgatgtcta 2580

tgatggaggc gatatcacag agggtaagta aagttgacca tcagctagac cttatcttaa 2640

aacaaacatc ctctatcccc atgatgcggt ctgaaatcca acagctgaaa acatccgttg 2700

cggtcatgga agccaattta ggcatgatga aaattctgga ccctggttgt gctaatgttt 2760

catctctaag tgatctacgg gcagtcgctc gatcccaccc agttttagtt tcaggccccg 2820

gagacccatc cccttatgtg acacaagggg gtgaaatggc actcaataaa ctttcacaac 2880

cagtgcaaca tctgtctgag ttgattaaac ctgccacggt aagcgggcct gatataggag 2940

tggagaggga cactgtccgt gcattgatca cctcacgtcc aatgcatccg agctcttcag 3000

ctaacctcct gagtaagctg gatgcagccg ggtcgatcga agaaatcaga aaaatcaagc 3060

gccttgcgct gaatggctga tcaccaccat cacctgcaac gggttcccgt tcattcagtg 3120

ccgcaagaga cccgccccga gccctcctcc ataaactcaa gctttaatac tccaagtgat 3180

aaccctctct tgcctcctct atctcattaa ataatcgcgc aaccgcaatt aatcctgcaa 3240

cattaatgat taagaaaaaa tacgggtaga atcggagtgc ccagactgtg ccaagatgga 3300

ctcatctagg acaatcgggc tatactttga ttctgccctt ccttctagca gcctgttagc 3360

attcccgatc atcctacaag acacaggtga cgggaagaag caaatcgccc cacaatatag 3420

gatccagcgt cttgacttgt ggacagatag taaagaagac tcggtattca tcaccaccta 3480

tggattcatc ttccaggtta gggatgaaga agtcgctgtc ggcatgatca atgataatcc 3540

caagcgcgag ttactttcct ctgcgatgct ctgcctagga agcgtcccga atatcggaga 3600

tcttgtcgag ctggcaaggg cctgcctcac tatggtggta acatgcaaga agagtgcaac 3660

caatactgag agaatggtct tctcggtagt gcaggcaccc caggtgctac agagctgtat 3720

ggtcgtggcg aacaaatatt cgtcagtgaa tgcagttaag catgtgaaag caccagagaa 3780

gatccctgga agcggaaccc tagagtacaa ggtgaatttt gtttctttga ctgtggtgcc 3840

gaagaaggac gtctacaaga tcccgaccgc agtgttgaag gtatctggct cgagcctgta 3900

caatctcgca ctcaatgtca ctattgatgt ggaggtagac ccaaagagcc cattagtcaa 3960

atttctttcc aggtccgaca gtggatacta tgctaatctc ttcttacata tcggacttat 4020

gtccactgta gataagaggg gaaggaaagt gacatttgac aagctggaga ggaagataag 4080

gagactcgat ctgtctgtcg ggcttagtga tgtgcttgta ccctctgtgc tcgtgaaggc 4140

gagaggtgca cgaactaggc tgctggcacc gttcttctct ggcagtggga cagcttgcta 4200

tcctatagca aatgcctctc ctcaggtagc caagatactc tggagtcaaa ccgcgtgcct 4260

gcggagtgta aaagtcatta tccaagcggg cacccaacgc gctgtcgcag tgactgctga 4320

ccatgaggtt acttctacta agatagagaa ggggcatacc atcgctaaat acaatccttt 4380

caagaaatag gctgcatctc tgaggctgca atccgcccgc ttccccgaat caccacggcg 4440

ccaaataatg atctgtctcg attacttata gttagctcac ctgtctatcg agttagaaaa 4500

aacacgggta gaagagtttg gatcccggtc ggcgcattca aagtgcaaga tgggccccaa 4560

atcttctacc aatgtcccag cacctctgat gctgaccgtc aggattgcgc tggcactgag 4620

ctgtgtccgt ctgacaaatt ctctcgatgg aaggcctctt gcagctgcag ggattgtagt 4680

aacgggagac aaagcagtca acatatacac ctcatctcag acagggtcaa taatagtcaa 4740

gttactccca aatatgccta aggataaaga ggcgtgtgca aaagccccgt tggaggcata 4800

caacaggaca ctgactactt tgctcacccc ccttggtgat tctatccgca ggatacaaga 4860

gtctgcgact acgtccggag gaaggaggca gagacgcttt ataggtgcca ttatcggcag 4920

tgtagctctt ggggttgcca cagctgcaca gataacagca gcctcagctc tgatacaagc 4980

caaccagaat gctgccaaca tcctccggct taaagagagc attgctgcaa ctaatgaagc 5040

tgtacatgaa gtcactgacg gattatcgca actagcagtg gcagttggga agatgcagca 5100

gtttgttaat gaccagttta ataacacagc tcaggaattg gactgtataa aaattacaca 5160

gcaggttggt gtagaactca acctgtacct aactgaattg actatagtat tcgggccaca 5220

aatcacttcc cctgccttaa ctcagctgac tatccaggcg ctttacaatc tagctggtgg 5280

taatatggat tatttgttga ctaagttagg tgttgggaac aaccaactca gctcattaat 5340

cggtagcggc ttgatcaccg gtaaccctat tctgtacgat tcacagactc aactcttggg 5400

tatacaggta actttaccct cagtcggtaa cctaaataat atgcgtgcta cctacttgga 5460

gaccttgtct gtaagcacaa ccaagggatt tgcctcagca cttgtcccaa aagtggtgac 5520

acaggtcggg tctgtgatag aggaacttga cacctcatac tgtgtagaga ccgatttgga 5580

tttatattgt acaagaatag tgacattccc tatgtctcct ggtatttatt cctgtctgag 5640

cggtaataca tcagcttgca tgtattcaaa gactgaaggt gcacttacta cgccatatat 5700

gactatcaag ggctcagtta ttgccaattg caagatgaca acatgcagat gtgcagaccc 5760

tccgggtatc atatcgcaaa attatggaga agctgtgtct ctaatagata ggcactcatg 5820

caatgtctta tccttagacg ggataacttt gaggctcagt ggagaatttg acgtaactta 5880

tcaaaagaat atctcaatat tagattctca ggtaatagtg acaggcaatc tcgatatctc 5940

aactgaactt gggaatgtca acaactcgat aagtaatgct ttggataagt tagaggaaag 6000

caatagcaaa cttgacaaag tcaatgtcaa gctgaccggc acgtctgctc tcattatcta 6060

tatagtttta actatcatat ctcttgtttg tggtatactt agcctggttc tagcatgcta 6120

tctgatgtat aaacaaaagg cgcaacaaaa gaccttatta tggcttggga ataataccct 6180

aaatcagatg agggccacta caagaatgtg aatgcagaca agaggcagag gtatctccaa 6240

gagcaatttg tgtgtgaatt caggcagcct gtcaattaga agaattaaga aaaaactacc 6300

ggatttgggt gatcaaaggg caacatacgg gtagaacggc cagagaggcc actccttagc 6360

caggaatcgg gcctcacacc atccgttcta ccgcatcacc aatagcggtt tttagtcatg 6420

gaccgtgtag ttagccaagt tgcgctagag aacgatgaaa gagaggcgaa aaatacatgg 6480

cgcttggtat ttcggaccgc agtcttactt ttaatagtag tgaccttttc catctctgct 6540

gccgccctga tgtacagtat ggaggctagc acacctggtg accttgtagg catactgact 6600

gcgatctcca gggcagaaga aaagattaca tctgcactcg gttccaatca agatgtagta 6660

gataggatat ataagcaggt ggccctcgaa tctccgttgg cattgctcaa caccgaatct 6720

ataattatga gtgcaataac gtccctctct taccagatca atggagctgc aaataacagt 6780

gggtgtgggg cacctgttca tgacccggat tatatcggag ggataggtaa agaactcatt 6840

gtggatgatg ctagtgatgt cacatcattc tatccctctg cgttccaaga acacctgaat 6900

tttatcccgg cgcccactac aggatcaggt tgcactcgga taccctcatt cgacatgagt 6960

gctacccact actgttacac tcataatgtg atattgtctg gctgcagaga tcactcacac 7020

tcacatcagt atttggcact tggtgtgctt cggacatctg caacagggag ggtattcttt 7080

tctactctgc gttccatcaa tttggatgac aaccaaaatc ggaagtcttg cagtgtgagt 7140

gcaactccct taggttgcga tatgttgtgc tctaaagtca cggaaactga ggaagaagat 7200

tataattcag ttatccccac accaatggta catgggaggc tggggtttga cggccaatac 7260

catgagaagg acctggatgt cgcaacatta tttggggact gggtggcaaa ttaccctggg 7320

gtgggaggag ggtcttttat tgacaaccgc gtatggttcc cagtctatgg agggctaaaa 7380

cccaattcgc ctagtgacac tgcacaagag gggagatatg taatatacaa gcggtacaat 7440

gacacatgcc cagatgagca agactaccag attcggatgg ctaagtcttc atataagcct 7500

gggcggtttg gtgggaaacg cgtacagcag gccatcctat ccatcaaggt atcaacatcc 7560

ttgggtgagg acccggtgct gactgtaccc cccaacacaa tcacacttat gggggccgaa 7620

ggcagagttc tcacagtagg gacatctcat ttcttttacc agcgagggtc atcatacttc 7680

tctcccgcct tattataccc tatgacagtc gacaataaaa cagccactct tcatagtcct 7740

tatgcattca atgctttcac tcggccaggt agtgtccctt gccaggcttc agccagatgc 7800

cctaactcgt gtgttactgg agtctacact gatccatacc ccttagtctt ccatagggac 7860

cacactttgc gaggggtatt cgggacaatg cttgatgata aacaagcaag actcaaccct 7920

gtatctgcag tatttgataa catatctcgc agtcgcataa cccgggtgag ttcaagcagt 7980

accaaggcag catacacgac atcaacatgt tttaaagttg tcaagaccaa taaaacctat 8040

tgcctcagca ttgcagaaat atccaatacc ctcttcgggg aattcaggat tgtcccttta 8100

ttagtcgaga ttctcaagga tgatgggatt taagaagcca ggtctggctg gttgagccag 8160

ctgtgaaagg gccgggaaga tgacactgcg ccacccatcc tttgtagcac caggaatcaa 8220

actgagaacc ggcacaggct caaatcatac gctgccggtc agccacaatc agctatcgcc 8280

aatgcgatta gtctggatct tgccaatagt cacttgatta agaaaaaata tagatggtag 8340

tgagatacga gacaaagcaa ctcacggtgg ataacacggg taggacatgg cgagctccgg 8400

tcccgagagg gcagagcacc agattatcct accagagtca catctgtctt caccattggt 8460

caagcacaaa ctgctctatt actggaaatt aacagggcta ccacttcctg acgaatgcga 8520

cttcgaccac cttattatca gtcgacaatg gaagaaagta cttgaatcgg ccactcctga 8580

cattgagaga atgataaaac tcgagcggtc agtacaccag actctcaacc acaattccag 8640

gataactgga gtactacatc ccagatgttt agaagaattg gctagtattg aggtccctga 8700

ttcaaccaac aaatttcgga agatcgaaaa gaagatccag attcacaaca caaggtatgg 8760

agaactattc actcggctgt gcacgcatgt agaaaagaaa ttattggggt cgtcttggtc 8820

tagcaatgtc ccacgatcag aggaattcag cagcatccgt acagatccgg cattctggtt 8880

tcattcaaaa tggtccacag ccaagtttgc atgtctccat ataaaacagg tccaaaggca 8940

tctaattgta gcagcaagaa caagatccgc agtcaacaaa ttagtaacgc tgacccataa 9000

ggtaggccaa gtatttgtta ctcctgagct tgttattgtg acacatacag atgagaacaa 9060

gttcacgtgt cttacccagg aacttgtgtt gatgtatgca gatatgatgg agggcagaga 9120

tatggtcaac ataatatcat ccacggcagc acatcttagg agcttatcag agaaaattga 9180

tgacattctg cggttgatag atgctttggc gaaagatttg ggcaatcagg tctacgatgt 9240

tgtagcacta atggagggat tcgcatacgg cgctgttcag ctgcttgagc cgtcaggtac 9300

atttgcaggg gatttctttg ccttcaacct gcaggagctc aaagatactc taatcggact 9360

cctccccaag gatatcacag aatctgtgac tcatgcaatc gccaccgtat tctctggctt 9420

agaacaaaat cacgcagccg agatgttgtg cttattgcgt ctgtggggcc atccactgct 9480

tgagtcccgc actgcagcaa aagcagttag gagccaaatg tgcgcaccaa aaatggtaga 9540

cttcgatatg atcctccagg tactgtcctt cttcaaagga acaatcatca atggatacag 9600

aaagaagaat gcaggtgtgt ggccacgtgt caaggtgaat acgatatatg ggaaggtcat 9660

tgggcaacta cacgctgatt cagcagagat ttcacatgat gtcatgttga gagagtgcaa 9720

aagtttatct gcacttgaat tcgagccatg tatagaatat gaccctgtca ccaatctgag 9780

catgtttcta aaagacaagg caattgcaca tccgaaagat aactggctcg cttcatttag 9840

gcgaaacctt ctctctgagg accagaagaa acatgtgaag gaggcaacct caactaatcg 9900

cctcttgata gagttcttag agtcaaatga ttttgatcca tataaggaga tggaatacct 9960

gacgaccctt gagtacctaa gagatgataa tgtggcagta tcatactcac tcaaagagaa 10020

ggaggtaaaa gttaatgggc ggattttcgc taaactaaca aagaaattaa gaaactgtca 10080

ggtaatggca gaagggatcc tagctgacca gattgcacct ttcttccagg gaaacggggt 10140

cattcaggat agcatatcct taactaagag tatgcttgcg atgagtcaac tgtctttcaa 10200

cagcaataag aaacgtatca ctgactgcaa ggaaagagta tcctcaagcc gcaatcatga 10260

tccgaagagc aagaatcgtc ggagagttgc cactttcata acaactgacc tgcaaaagta 10320

ttgtcttaat tggagatatc agacggtcaa gctgtttgct cacgccatca atcaactgat 10380

gggcctacct cacttcttcg agtggatcca tcttagacta atggacacta cgatgtttgt 10440

aggagaccct ttcaatcctc caagtgaccc aactgactgt gatctatcaa gagtcccaaa 10500

tgacgacata tacattgtca gtgctagggg gggcattgag ggattgtgtc agaagctgtg 10560

gacaatgatc tcaattgctg caatccaact tgctgcagca agatcacatt gtcgtgttgc 10620

ctgtatggta caaggtgaca atcaagtaat agctgtaacg agagaggtaa gatcagacga 10680

ctctccggag atggtattaa cgcaattgca tcaagccagt gataatttct tcaaggaatt 10740

gatccatgtc aatcatttaa ttggccataa tttgaaggat cgtgaaacca tcaggtcaga 10800

cacgttcttc atatacagca aacgaatatt caaggatgga gcaatactca gtcaggtcct 10860

caaaaactca tctaaattag tgctgatatc aggcgacctt agtgaaaaca ccgtaatgtc 10920

ttgtgccaac attgcatcta ctatagcgcg gctgtgcgag aacgggcttc ctaaggattt 10980

ctgttattac ttaaactacc taatgggttg cgtgcagaca tattttgatt ctgagttttc 11040

catcactaac aacccgcaac ccgattctaa ccagtcgtgg attgaggaca tctcttttgt 11100

gcattcatat gtcctgaccc ctgcccagct gggggggctg agcaaccttc aatactcaag 11160

gctctacaca aggaacatcg gtgatctagg aactactgct tttgcagaga tcaagcgatt 11220

agaggcagtg gggttactga gtcctagcat tatgactaac atcttaacta ggccacctgg 11280

taatggagat tgggccagtc tgtgcaatga tccgtactcc tttaattttg agactgtcgc 11340

aagcccgaat atcgtcctta agaagcatac acagagggtc ctatttgaaa cttgttcaaa 11400

tcccttatta tctggagtac atacagagga taatgaggca gaagaaaagg cattggctga 11460

attcttgctc aatcaagaag tgattcaccc acgcgtcgcg catgccatca tggaagcgag 11520

ctctgtaggc aggagaaaac aaattcaggg gcttgttgac acaacaaaca ccgtgattaa 11580

gatcgcactg actcggaggc ctctcggcat caagaggctg atgcggatag tcaattactc 11640

gaacatgcat gcaatgctat ttagagacga tgttttctca tccaacagat ccaaccaccc 11700

cttagtctct tctaatatgt gttctcttac gctggcagat tatgcacgga acagaagctg 11760

gtcacctttg acggggggca ggaagatact gggtgtatct aatcctgata ccatagaact 11820

tgtagagggt gagatcctta gtgtcagcgg agggtgcaca agatgtgata gcggagatga 11880

acagtttact tggttccatc ttccaagcaa tatagaactg accgctgaca ccagcaagaa 11940

tcctccaatg cgagtgccat atctcgggtc aaagacccaa gagaggagag ctgcctcgct 12000

tgcaaaaata gctcatatgt cgccacatgt gaaggcggct ctgagggcat catctgtgtt 12060

aatctgggct tatggggaca acgaagtaaa ttggactgct gctcttaaga ttgcaaggtc 12120

tcggtgcaac ataagctcag agtatcttcg actgttgtca cccttaccca cagctggtaa 12180

tctccaacat agactggatg atggcataac tcagacgaca ttcacccctg catctctata 12240

cagggtgtca ccttacattc acatatctaa tgattctcaa aggctattca ctgaagaagg 12300

agtcaaagaa gggaatgtga tttatcagca aatcatgctc ttgggtttat ctcttattga 12360

gtcactattc ccaatgacaa caaccaagac atatgatgaa atcacattac acctccacag 12420

taaatttagc tgctgtatca gggaagcatc tgttgcagtt ccattcgagc tactcggggt 12480

ggcaccagaa ctaagggcag taacctcaaa taagtttatg tatgatccta gccctgtatc 12540

agaaggagac tttgcgagac ttgacttagc tatctttaag ggttatgaac ttaatttaga 12600

gtcgtatccc acaatagagc taatgaacat tctttcaata tcctgtggga agttgattgg 12660

ccagtctgtg gtttcttatg acgaagatac ctctataaag aatgacgcta taatagtgta 12720

tgacaacaca cggaattgga tcagcgaagc tcagaattca gatgtggtcc gcctattcga 12780

gtatgcggca ctcgaagtgc tcctcgactg ttcttaccaa ctctactatc taagagtaag 12840

aggcctaaac aatattgtct tatatatgag tgatttatac aagaatatgc caggaattct 12900

actctccaat attgcagcta caatatctca ccccatcatc cattcgaggt tgaatgcagt 12960

aggtctggtc aaccatgacg gatcacacca acttgcagac acagatttca ttgaaatgtc 13020

tgcaaaactg ctagtatctt gcactcggcg cgtggcatca ggtttatatg cacgaaataa 13080

gtatgacctg ctgtttccat ctgtcttaga tgataacctg agtgagaaga tgcttcagtt 13140

gatatctcgg ttatgctgtc tgtacacggt gctctttgct acaacaagag aaatcccgaa 13200

aataagaggc ttatccgcgg aagaaaaatg ttcagtactc actgagtatc tactgtcaga 13260

tgctgtgaga ccattactta ggtccgagca agtgagctct atcatgtctc ccaacatagt 13320

tacgttccca gccaatctgt attacatgtc taggaagagc ctcaatttga tcagggaaag 13380

agaggacagg gatactatct tggcattgtt gttccctcaa gaaccactgc tcgagttacc 13440

ctcggtgcaa gatattggtg ctcgagtgaa ggatccattt acccgacaac ctgcggcgtt 13500

tttactagag ttggatttga gtgctccagc aaggtatgat gcatttacac ttaatcaggt 13560

tcattctgaa cacacattgc cgaacccaaa ggaagactac ttagtacgat acttgttcag 13620

aggaataggg accgcgtcat cctcttggta taaggcgtcc catcttcttt ctgtacccga 13680

ggtcagatgt gcaaggcatg gaaactcctt atacttagca gaaggaagtg gagccatcat 13740

gagtcttctc gaattgcatg tgccacatga gactatctat tacaatacgc ttttctcaaa 13800

tgagatgaac cccccacagc gacatttcgg accgaccccg acacagttcc tgaattcagt 13860

cgtttatagg aatttacagg cggaagtacc atgtaaggat ggatttgtcc aggaattccg 13920

tccattatgg agagagaata cagaggaaag cgacctgacc tcagataaag cagtggggta 13980

tatcacatct gcagtaccct acaggtccgt atcactgctg cattgtgaca ttgagattcc 14040

tccaggatcc agtcaaagct tactagatca attggctacc aatttgtccc tgattgccat 14100

gcattctgta agtgagggcg gggtcgtgat catcaaagta ctgtatgcaa tgggatacta 14160

cttccatcta ctcatgaact tgttcgctcc atgctctgcg aaaggatata ttctctctaa 14220

tggctacgca tgtagaggcg atatggagtg ttacctggta tttgtcatgg gctcccttgg 14280

cggacctaca tttgtgcatg aggtggtgag gatggcaaaa actctagtac agcggcacgg 14340

cacgcttttg tctaaatcgg atgaggttat actgactaag ttatttacct cacagcagca 14400

gcgtgtaata gaaatcctat ccagcccttt accgagacta atgaagttct tgagagagaa 14460

tattgatact gcgctgattg aagccggggg acagcctgtc cgtccattct gtgcagagag 14520

tttagtgagc acactaacag acatgactca gatgacccag atcattgcca gccacattga 14580

cacagtcatc cgatctgtga tctacatgga agctgagggt gatcttgctg acacagtatt 14640

cttatttacc ccttacaatc tctctgtaga cggaaaaaag aggacatcac ttaaacagtg 14700

cactagacag atcttagagg tcacaatact gggtctcaga gtcaaaaatc tcgataaggt 14760

aggtgatgta atcagcctag tgctcagagg tatgatttcc ctggaggacc tcatcccgct 14820

aagaacatac ttgaagcgta gtacctgccc taagtattta aagactgtcc taggtgttac 14880

taaactcaaa gaaatgttca cagacacttc tttattatac ttgacgcgtg ctcaacaaaa 14940

attgtacatg aaaactatag gcaatgcggt caagggatat tacagtagct gtgactctta 15000

aaggcgatca cacattaata ggctcctttt ttagccaatt gtatccttgt tgatttaatt 15060

ataccatatt agaaaaaagt tgaactccga ccctctagga ctcgtactcg gattcaaata 15120

attaccttag aaaaaaaatg cgcataattg ctcttgagtg tagttctgtc attcaccaaa 15180

tctttgtttg gt 15192

<210> 2

<211> 37

<212> DNA

<213>Artificial sequence

GACAGCTTAT CATCGATTGC AATCGCCACC GTATTCT 37

<210> 3

<211> 35

<212> DNA

<213>Artificial sequence

CATTAAAGCT TATCGACCAA ACAAAGATTT GGTGA 35

<210> 4

<211> 37

<212> DNA

<213>Artificial sequence

GACAGCTTAT CATCGATCTT ATGTCCACTG TAGATAA 37

<210> 5

<211> 35

<212> DNA

<213>Artificial sequence

ACGGTGGCGA TTGCATGAGT CACAGATTCT GTGAT 35

<210> 6

<211> 57

<212> DNA

<213>Artificial sequence

GACAGCTTAT CATCGATTAA TACGACTCAC TATAGGGACC AAACAGAGAT TCTGTGA 57

<210> 7

<211> 35

<212> DNA

<213>Artificial sequence

TACAGTGGAC ATAAGTCCGA TATGTAAGAA GAGAT 35

<210> 8

<211> 20

<212> DNA

<213>Artificial sequence

AGTGACTGCT GACCATGAGG 20

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence

ATGCCATCAT CCAGTCTATG 20

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence

CCTTCAACCT GCAGGAGCTC 20

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence

ACCAGCTGAGTATGCACAAC 20

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence

CATGATGATA GCAGGGTCTC 20

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence

ACCAGCTGAG TATGCACAAC 20

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence

ATCATGCCCA GCTACCTGTC 20

<210> 15

<211> 20

<212> DNA

<213>Artificial sequence

CCTAACCTGG AAGATGAATC 20

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence

AGTGACTGCT GACCATGAGG 20

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence

CTACCGATTA ATGAGCTGAG 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence

CTAATCGCCT CTTGATAGAG 20

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence

CGAGTGGATC CATCTTAGAC 20

<210> 20

<211> 20

<212> DNA

<213>Artificial sequence

CCGTAATGTC TTGTGCCAAC 20

<210> 21

<211> 20

<212> DNA

<213>Artificial sequence

GCAGAGGTATC TCCAAGAGC 20

<210> 22

<211> 20

<212> DNA

<213>Artificial sequence

AGACTGCGGT CCGAAATACC 20

<210> 23

<211> 20

<212> DNA

<213>Artificial sequence

ATGTTGCGAC ATCCAGGTCC 20

<210> 24

<211> 20

<212> DNA

<213>Artificial sequence

AGTCGAGATT CTCAAGGATG 20

<210> 25

<211> 20

<212> DNA

<213>Artificial sequence

CACTGCTCGA GTTACCCTCG 20

<210> 26

<211> 20

<212> DNA

<213>Artificial sequence

GAAATCATAC CTCTGAGCAC 20

<210> 27

<211> 20

<212> DNA

<213>Artificial sequence

GGCACAACTT GACCCATCAA 20

<210> 28

<211> 20

<212> DNA

<213>Artificial sequence

TTGTCTCATG AGCGGATACA 20

<210> 29

<211> 20

<212> DNA

<213>Artificial sequence

CATAGTGACT GGCGATGCTG 20

<210> 30

<211> 20

<212> DNA

<213>Artificial sequence

TGAGATATCG AGATTGCCTG 20

<210> 31

<211> 20

<212> DNA

<213>Artificial sequence

GGACACTACC TGGCCGAGTG 20

<210> 32

<211> 20

<212> DNA

<213>Artificial sequence

TGGAGGATCA TATCGAAGTC 20

<210> 33

<211> 20

<212> DNA

<213>Artificial sequence

ATGCCATCAT CCAGTCTATG 20

<210> 34

<211> 20

<212> DNA

<213>Artificial sequence

CCTTCAACCT GCAGGAGCTC 20

<210> 35

<211> 20

<212> DNA

<213>Artificial sequence

CCATTCGAGG TTGAATGCAG 20

<210> 36

<211> 20

<212> DNA

<213>Artificial sequence

AGAGTGCCAT ATCTCGGGTC 20

<210> 37

<211> 20

<212> DNA

<213>Artificial sequence

TGTGTACAGA CAGCATAACC 20

Claims

1. a kind of Avian pneumo-encephalitis virus full-length cDNA, it is characterised in that the nucleotide of described full-length cDNA is SEQ ID NO.1 It is shown.

2. a kind of construction method of the Avian pneumo-encephalitis virus full-length cDNA described in claim 1, it is characterised in that concrete operation method Using following steps：

（3）With step（1）Described cDNA is template, and with a pair of specific primers performing PCR amplification is entered, and obtains amplified production NDV- 2PCR, electrophoresis is carried out to amplified production and cuts glue reclaim genes of interest fragment NDV-In-PCR2, and genes of interest fragment is built into into enzyme In positive plasmid NDV-IN1-5 after cutting, and expand in escherichia coli dam-/dcm competent cell HST04, obtain plasmid NDV-IN2-2；

（4）With step（2）Described amplified production NDV-1PCR and step（3）Described amplified production NDV-2PCR is template, Enter performing PCR amplification with a pair of specific primers, electrophoresis is carried out to amplified production and cuts glue reclaim genes of interest fragment, by purification Genes of interest fragment is built in the plasmid NDV-IN2-2 after enzyme action, and is expanded in competent escherichia coli cell HST08, Obtain Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8.

3. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that with step（4）Obtain Avian pneumo-encephalitis virus full-length gene fragment NDV-IN3-8 is template, with two pairs of specific primers respectively to Avian pneumo-encephalitis virus total length base Because fragment NDV-IN3-8 carries out segmentation amplification, electrophoresis is carried out to amplified production glue reclaim genes of interest fragment is cut to obtain NDV-IN3- 8-PCR2 and NDV-IN3-8-PCR3, is sequenced respectively, NDV-IN3- to NDV-IN3-8-PCR2 and NDV-IN3-8-PCR3 The splicing of 8-PCR2 and NDV-IN3-8-PCR3 total lengths may make up the full-length cDNA of Avian pneumo-encephalitis virus.

4. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that step（2）Described spy The nucleotide of specific primer is：SEQ ID NO.2 and SEQ ID NO.3；

Step（3）The nucleotide of described specific primer is：SEQ ID NO.4 and SEQ ID NO.5；

Step（4）The nucleotide of described specific primer is：SEQ ID NO.6 and SEQ ID NO.7.

5. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 3, it is characterised in that described NDV-IN3-8- The nucleotide of the specific primer used by PCR2 is:SEQ ID NO.8 and SEQ ID NO.9；Described NDV-IN3-8-PCR3 The nucleotide of specific primer used is:SEQ ID NO.10 and SEQ ID NO.11；The reaction condition of segmentation amplification is 94 DEG C 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 3min totally 30 circulations.

6. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that step（2）, step（3） And step（4）The reaction condition of described PCR amplifications is：94 DEG C of 1min, then 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C 3min totally 30 circulations.

7. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that step（2）Described enzyme The restriction endonuclease used by plasmid pVAX after cutting is ClaI；Step（2）The condition of described endonuclease reaction system is 30 DEG C of reactions 16h；Step（2）Described genes of interest fragment is built into the reaction condition after enzyme action in plasmid pVAX for 50 DEG C of reaction 15min.

8. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that step（3）Described enzyme The restriction endonuclease used by positive plasmid NDV-IN1-5 after cutting is ClaI；Step（3）The condition of described endonuclease reaction system is 30 DEG C reaction 16h；Step（3）Described genes of interest fragment is built into the reaction condition after enzyme action in positive plasmid NDV-IN1-5 For 50 DEG C of reaction 15min.

9. the method for Avian pneumo-encephalitis virus full-length cDNA according to claim 2, it is characterised in that step（4）Described enzyme The restriction endonuclease used by plasmid NDV-IN2-2 after cutting is ClaI；Step（4）The condition of described endonuclease reaction system is 30 DEG C anti- Answer 16h；Step（4）Described genes of interest fragment is built into the reaction condition after enzyme action in positive plasmid NDV-IN1-5 for 50 DEG C reaction 15min.