CN106676107B - The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis - Google Patents
The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis Download PDFInfo
- Publication number
- CN106676107B CN106676107B CN201610279163.7A CN201610279163A CN106676107B CN 106676107 B CN106676107 B CN 106676107B CN 201610279163 A CN201610279163 A CN 201610279163A CN 106676107 B CN106676107 B CN 106676107B
- Authority
- CN
- China
- Prior art keywords
- bip1
- promoter
- rice
- expression
- analysis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to plant genetic engineering fields.It is related to separation clone and the functional analysis of the endogenous artificially fused bi-directional promoter of rice.RNA-seq data in present invention combination MSU and RAP database and the chip of expression spectrum data in CREP database have chosen candidate bidirectional promoter BIP1 in rice genome, are experimentally confirmed it with two-way expression activity.Then 5 ' and 3 ' deletion analysis are carried out to it, identify its two-way expression control region section and controls its active section of 5 ' and 3 ' direction primary expression.Then, conservative of the bioinformatics means analysis BIP1 in gramineae plant is utilized.The invention discloses the screening of bidirectional promoter and separation cloning process, the building process of conversion carrier, rice transformation process and the methods of GUS histochemical stain, gus protein Activity determination, GFP histologic analysis, GFP quantitative analysis and the conservative Analysis of bidirectional promoter that convert plant.
Description
Technical field
The invention belongs to technical field of rice gene engineering.More particularly to the separation gram of the endogenous artificially fused bi-directional promoter of rice
Grand and functional analysis.
Background technique
Promoter is the section of DNA sequence of promotor gene transcription, and as the important regulating and controlling element on transcriptional level, it can
Transcription of the Effective Regulation downstream gene under specific period, space and signal stimulus.With the process of crop genetic improvement
With the development of functional genome research, more and more crop characters attract attention, while more and more can be used for character improvement
Candidate gene identified that the efficient application of candidate gene must be pierced by them in privileged site, breeding time or signal
High efficient expression under swashing.Therefore, the diversity of promoter is in genetic engineering by urgent demand.
So far, more and more unilateral initiative are cloned and identify, can be divided into composition according to their expression patterns
Type promoter, tissue-specific promoter and inducible promoter (McElroy D, Zhang W, Cao J, Wu
R.Isolation of an efficient actin promoter for use in rice transformation.The
Plant Cell,1990,2:163-171；Cai M,Wei J,Li X,Xu C,Wang S.A rice promoter
containing both novel positive and negative cis-elements for regulation of
green tissue-specific gene expression in transgenic plants.Plant Biotechnol
J,2007,5:664-674；Vijayan J,Devanna BN,Singh NK,Sharma TR.Cloning and
functional validation of early inducible Magnaporthe oryzae responsive
CYP76M7promoter from rice.Front Plant Sci,2015,6:371).Bidirectional promoter refers to adjacent and turns
The sequence between the contrary gene pairs in " head to head configuration " is recorded, better application potential is shown in genetic engineering
(Trinklein ND et al.An abundance of bidirectional promoters in the human
genome.Genome Res,2004,14:62-66；Yang S,Sleight SC,Sauro HM.Rationally
designed bidirectional promoter improves the evolutionary stability of
synthetic genetic circuits.Nucleic Acids Res,2013,41:e33-e33).This advantage mainly obtains
Two expression of target gene can be driven simultaneously beneficial to bidirectional promoter, more convenient province during vector construction and gene pyramiding
When (Kumar S et al.A combinatorial bidirectional and bicistronic approach for
coordinated multi-gene expression in corn.Plant Mol Biol,2015,87:341-353).And
And while importing multiple foreign genes, generally require that them is made to maintain the same or similar expression pattern to reach to spy
Purpose (the Ha SH et al.Application of two bicistronic systems that qualitative shape is improved
involving 2A and IRES sequences to the biosynthesis of carotenoids in rice
endosperm.Plant Biotechnol J,2010,8:928-938；Ogo Y,Ozawa K,Ishimaru T,Murayama
T,Takaiwa F.Transgenic rice seed synthesizing diverse flavonoids at high
levels:a new platform for flavonoid production with associated health
benefits.Plant Biotechnol J,2013,11:734-746).However, the list with same or similar expression pattern
To promoter limited amount, the silencing that may cause biological gene expression in vivo is reused, while also in vector construction process
In cause bigger consumption (the Peremarti A et al.Promoter diversity in multigene of time and cost
transformation.Plant Mol Biol,2010,73:363-378).Because there is coexpression in many two-way gene pairs
Phenomenon, the expression pattern of bidirectional promoter 5 ' and 3 ' are similar (Huang Y, Xiao B, Xiong in many reports
L.Characterization of a stress responsive proteinase inhibitor gene with
positive effect in improving drought resistance in rice.Planta,2007,226:73-
85；Chen W,Meaux JD,Lercher MJ.Co-expression of neighbouring genes in
Arabidopsis:separating chromatin effects from direct interactions.BMC
Genomics,2010,11:178；Didych D et al.Human PSENEN and U2AF1L4genes are
concertedly regulated by a genuine bidirectional promoter.Gene,2013,515:34-
41).Therefore, bidirectional promoter can also overcome the problems, such as the shortage of identical expression pattern unilateral initiative.
Due to promoter unlike gene coding region has product that can limit its variation during evolution, it removes
Except conservative cis-regulating element, there is height variation (M ü ller F, Dem é ny MA, Tora in the sequence of promoter
L.New problems in RNA polymerase II transcription initiation:matching the
diversity of core promoters with a variety of promoter recognition factors.J
Biol Chem,2007,282:14685-14689).So the downstream base that the conservative for studying promoter can be regulated and controled by it
Because starting with.Early in 2002, Adachi et al. found that in human genome that the gene pairs of " head to head configuration " is generally existing
(Adachi N,Lieber MR.Bidirectional gene organization:a common architectural
feature of the human genome.Cell,2002,109:807-809).Thereafter, Li et al. people passes through system, discovery
There are higher conservative (Li Y et al.Systematic in different plant species for the gene pairs of " head to head configuration "
analysis of head-to-head gene organization:evolutionary conservation and
potential biological relevance.PLoS Comput Biol,2006,2:e74).2012, Xu et al. passed through
Structural conservation of the gene pairs of " head to head configuration " between different plant species come study bidirectional promoter conservative problem (Xu C,
Chen J,Shen B.The preservation of bidirectional promoter architecture in
Eukaryotes:what is the driving force? BMC Syst Biol, 2012,6:S21).
According to it has been reported that the identification method of bidirectional promoter can be divided into two kinds, one is utilize bioinformatics means
Identification method, it is on the other side, be the identification method using laboratory facilities.Bioinformatics identification method is not quite similar, this
It is all the binding site by developing transcription regulating region present in different language model prediction promoters, MOTIF in matter
Or nucleosome absent region, it screens qualified bidirectional promoter and carries out expression correlation and functional dependency analysis
(Wang Q et al.Searching for bidirectional promoters in Arabidopsis
thaliana.BMC Bioinformatics,2009,10:S29；Claeys M,Storms V,Sun H,Michoel T,
Marchal K.MotifSuite:workflow for probabilistic motif detection and
assessment.Bioinformatics,2012,28:1931-1932；Zhang W et al.High-resolution
mapping of open chromatin in the rice genome.Genome Res,2012,22:151-162).And it is real
Identification method is tested then to stop in this conventional promoter Analysis method of the expression pattern of detection promoter driving reporter gene
Face.Some researchs are to be identified (Huang Y, Xiao B, Xiong by the just anti-driven same reporter gene of promoter
L.Characterization of a stress responsive proteinase inhibitor gene with
positive effect in improving drought resistance in rice.Planta,2007,226:73-
85), it is some research be pass through promoter simultaneously driving two reporter genes identified (L é jard V, Rebours E,
Meersseman C,Rocha D.Construction and validation of a novel dual reporter
Vector for studying mammalian bidirectional promoters.Plasmid, 2014,74:1-8),
There is report (Mishra RC, the Grover A.Intergenic sequence in conjunction with both the above method while identification
between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock
protein100and choline kinase genes functions as a heat-inducible
bidirectional promoter.Plant Physiol,2014,166:1646-1658).It is cloned by laboratory facilities double
To promoter, the overwhelming majority depends on the research of its controlling gene.So far, rarely have bioinformatics means and experiment
Means combine, and the report of scale selection and identification is carried out according to the design feature of bidirectional promoter and expression pattern.
Rice is the main cereal crops in China.Therefore, the importance and necessity of rice genetic improvement is self-evident.It is more
The importing of gene is a wherein very crucial step.Advantage of the bidirectional promoter in polygenes importing, institute have been discussed in detail above
It is essential for rice genetic improvement with the excavation of rice bidirectional promoter.Meanwhile complete genome is believed in rice
Cease (Goff SA et al.A draft sequence of the rice genome (Oryza sativa
L.ssp.japonica).Science,2002,296:92-100；Yu J et al.A draft sequence of the
rice genome(Oryza sativa L.ssp.indica).Science,2002,296:79-92；Pan Y et
al.Comparative BAC-based physical mapping of Oryza sativa ssp.indica var.93-
11and evaluation of the two rice reference sequence assemblies.Plant J,2014,
77:795-805) and more clear gene expression information (Wang L et al.A dynamic gene expression
Atlas covering the entire life cycle of rice.Plant J, 2010,61:752-766) it is also two-way
The screening and identification of promoter provide a great convenience.
Summary of the invention
It is an object of the invention to be to overcome defect of the existing technology, establish a bidirectional promoter screening,
The complete method of clone and functional analysis, and efficient two-way startup child resource is provided for genetic engineering and molecular breeding.This hair
Bright combination MSU and the RNA-seq data in RAP database and the chip of expression spectrum data in CREP database are in paddy gene
Have chosen candidate bidirectional promoter BIP1 in group, and driven simultaneously using it two reporter gene green fluorescence protein genes (with
Lower abbreviation GFP gene) and beta-Glucuronidase gene (hereinafter referred to as gus gene) express in rice.To transgenic paddy rice
GUS and GFP analysis is the results show that BIP1 promoter has two-way expression activity.Then we carry out 5 ' and 3 ' missings point to it
Analysis, identifies its two-way expression control region section and controls its active section of 5 ' and 3 ' direction primary expression.Then, life is utilized
Object informatics means analysis conservative of the BIP1 in gramineae plant.The present invention is that the separation of rice bidirectional promoter is cloned
And functional analysis provides a successful method.
It is described that technical scheme is as follows:
It is with the RNA-seq data in MSU and RAP database and the chip of expression spectrum data in CREP database first
Basis has chosen a candidate bidirectional promoter BIP1 according to the location information and expressing information of bidirectional promoter controlling gene,
Its nucleotide sequence is as shown in sequence table SEQ ID NO:1.By designing special primer, expand from bright extensive 63 genome of rice
Increase BIP1, and construction of expression vector BIP1-DX2181.Pass through GUS to transgenic paddy rice and GFP analysis test, it has been found that
Promoter BIP1 shows composing type high efficient expression in both direction.Then 5 ' and 3 ' deletion analysis are carried out to it, identified
Its two-way expression control region section R1 and control its 3 ' direction direction primary expression active section R2 and 5 ' primary expression activity
Section R3.Then, conservative of the bioinformatics means analysis BIP1 in gramineae plant is utilized.
The invention discloses the screenings of bidirectional promoter and separation cloning process, the building process of conversion carrier, rice to lose
The GUS histochemical stain of biography conversion process and conversion plant, gus protein Activity determination, GFP histologic analysis, GFP quantitatively divide
The methods of the conservative Analysis of analysis and bidirectional promoter.
Of the invention comprises the concrete steps that:
It is with the RNA-seq data in MSU and RAP database and the chip of expression spectrum data in CREP database first
Basis has chosen a candidate bidirectional promoter BIP1 according to the location information and expressing information of bidirectional promoter controlling gene,
Its nucleotide sequence is as shown in sequence table SEQ ID NO:1.Pass through spy using bright extensive 63 genomic DNA as template using PCR method
Different primer (table 1) expands BIP1.The BIP1 that PCR amplification obtains utilizes SP6 and T7 after TA is cloned and (is purchased from Promega company)
Primer sequencing.BIP1 is imported carrier DX2181 (vector construction figure and more by Pst I single endonuclease digestion by clone by sequence verification
The information such as cloning site are shown in Fig. 2), the expression vector BIP1-DX2181 recombinated (see Fig. 3).By the expression vector of recombination
BIP1-DX2181 imports agrobacterium strains EHA105 by electrotransformation.
It will be after the mature seed disinfection that 11 (from Institute of Crop Science, Chinese Academy of Agricultural Science) be spent in rice varieties
Induced embryonic callus.By the agrobacterium strains EHA105 containing expression vector BIP1-DX2181 and embryo callus into
After row co-cultures, the screening of resistant calli is carried out on the screening and culturing medium containing 50mg/L hygromycin, by sieving twice
After choosing, picking kanamycin-resistant callus tissue, which is transferred on differential medium, to be broken up, and when the seedling of differentiation grows to 2-3cm, is cut away primary
Root is put on root media and takes root, and when new root to 2cm or so, is transplanted to greenhouse after hardening.These regeneration are small
Seedling is T0For transgenic seedling.
Obtain transgenic plant after, by GUS histochemical stain, gus protein Activity determination, GFP histologic analysis and
The expression pattern and expression intensity of BIP1 in rice are investigated in GFP quantitative analysis (see Fig. 4,5).Testing result shows: promoter
BIP1 shows two-way expression pattern in rice, and both direction is composing type high efficient expression.
It designs special primer (table 1), obtains the promoter in the different length at the 5 ' ends and 3 ' end missings of BIP1 with PCR method
(Fig. 6), and be building up on carrier DX2181 (source: the Australian laboratory CAMBIA) respectively.Water is converted in the same way
11 are spent in rice varieties.After obtaining transgenic plant, credit is organized by GUS histochemical stain, gus protein Activity determination, GFP
Analysis and GFP quantitative analysis (Fig. 7,8) identify its two-way expression control region section R1 and control its 3 ' direction primary expression activity
The direction section R2 and 5 ' the active section R3 of primary expression.
Then, utilize bioinformatics means analysis discovery: BIP1 six gramineae plants (rice, sorghum, millet,
Two fringe false bromegrass, corn and wheat) in rice, sorghum, show conservative in two fringe false bromegrass and corn.
The present invention has the advantages that
(1) present invention combines bioinformatics method and laboratory facilities, is believed according to the position of bidirectional promoter controlling gene
Breath and expressing information establish the complete method of the screening of a bidirectional promoter, clone and functional analysis.
(2) present invention obtains a bidirectional promoter BIP1 that composing type high intensity is expressed in rice, are gene work
Journey and molecular breeding provide efficient two-way startup child resource.
Detailed description of the invention
Sequence table SEQ ID NO:1 is the nucleotide sequence of bidirectional promoter BIP1 in the present invention；Sequence length is
2237bp。
Sequence table SEQ ID NO:2 is the nucleotide sequence of the promoter BIP1-1F2R in the present invention after BIP1 truncation；Sequence
Column length is 1240bp.Sequence table SEQ ID NO:3 is the nucleotide of the promoter BIP1-1F3R in the present invention after BIP1 truncation
Sequence；Sequence length is 1099bp.Sequence table SEQ ID NO:4 is the promoter BIP1-2F1R in the present invention after BIP1 truncation
Nucleotide sequence；Sequence length is 1540bp.Sequence table SEQ ID NO:5 is the promoter in the present invention after BIP1 truncation
The nucleotide sequence of BIP1-2F2R；Sequence length is 543bp.
Fig. 1: general technical route map of the invention.
Fig. 2: being DX2181 carrier structure schematic diagram, and the present invention utilizes its framework construction conversion carrier.
Fig. 3: being the conversion carrier BIP1-DX2181 structural schematic diagram that the present invention constructs.The carrier is the base in DX2181
It is transformed on plinth, the multiple cloning sites of promoter BIP1 insertion plasmid DX2181 are built-up.
Expression of Fig. 4: histologic analysis BIP1 the driving gus gene and GFP gene in rice different tissues.
Fig. 5: driven by BIP1 in the different tissues of the transformed plant of gus gene and GFP gene gus protein Activity determination and
GFP quantitative analysis results.GFP relative expression level represents the relative expression quantity of GFP；GUS activity
(pMol 4-MU/min/mg protein) represents GUS enzyme activity.
Fig. 6: being the schematic diagram that the present invention carries out 5 ' and 3 ' deletion analysis to BIP1.
Fig. 7: histologic analysis difference BIP1 deletion promoters drive gus gene and GFP gene in rice different tissues
Expression.
Fig. 8: gus gene and GFP gene is driven respectively to organize or device in transformed plant respectively by different BIP1 deletion promoters
Gus protein Activity determination and GFP quantitative analysis results in official.Description of symbols: A figure shows the result of blade in Fig. 8；Fig. 8
The result of leaf sheath is shown in middle B figure；The result of fringe is shown in C figure in Fig. 8；The result of stem is shown in D figure in Fig. 8；
The result in seed is shown in E figure in Fig. 8；The result of root is shown in F figure in Fig. 8.GFP relative expression
Level represents the relative expression quantity of GFP；GUS activity (pMol4-MU/min/mg protein) represents GUS enzyme activity.
Specific embodiment
Embodiment 1: the building of plant expression vector
Unless otherwise instructed, listed in this specification to refer to method and corresponding molecular biology routine operation, reference: [J.
Pehanorm Brooker etc., " Molecular Cloning:A Laboratory guide (second edition) ", Chinese translation, Science Press, Beijing, 1996 editions] correlation
Information.
The present invention is first with the RNA-seq data in MSU and RAP database and the chip of expression spectrum in CREP database
Data choose candidate bidirectional promoter.Selection principle is based on: 1, meet adjacent and transcriptional orientation is in " head to head to tie on the contrary
The gene pairs of structure "；2, in RNA-seq data, the maximum expression numerical value of gene pairs is simultaneously above 10；In chip of expression spectrum data,
The maximum expression numerical value of gene pairs is simultaneously above 5000；3, expression of the gene pairs in the RNA-seq data of 95 samples is related
Property be higher than 0.4.One group of gene pairs is had chosen according to the above principle, and separates their intergenic region, as candidate two-way startup
Son.It is named as BIP1, nucleotide sequence is as shown in sequence table SEQ ID NO:1.Using PCR method, with bright extensive 63 gene
Group DNA is template, expands BIP1 by special primer (table 1).(Promega is public by TA clone by the BIP1 that PCR amplification obtains
Department) it is sequenced afterwards using SP6 and T7 primer.BIP1 is imported carrier by Pst I single endonuclease digestion by the clone by sequence verification
DX2181 (information such as carrier figure and multiple cloning sites are shown in Fig. 2), the expression vector BIP1-DX2181 recombinated (see Fig. 3).It will
Expression vector BIP1-DX2181 imports agrobacterium strains EHA105 by electrotransformation, by the agrobacterium strains after conversion
EHA105 bacterial strain saves for use at -70 DEG C.
Primer sequence used in 1 present invention of table
The explanation of table 1:aUnderlined sequences indicate restriction enzyme site.
Embodiment 2: Agrobacterium-mediated genetic transformation
Agrobcterium-mediated transformation is tested referring especially to Hua Zhong Agriculture University's crop genetic improvement state key
Method shown in " the Agrobacterium-mediated genetic transformation operation manual " that room is delivered (woods is supported the army, 2002).Transformation receptor is water
The mature seed of 11 (for conventional variety, deriving from Institute of Crop Science, Chinese Academy of Agricultural Science) is spent to induce production in rice varieties
Raw embryo callus.By preculture, infect, co-culture, screen the callus for obtaining that there is hygromycin resistance, using point
Change, take root, practice seedling and transplanting, obtains transgenic plant.The key step of genetic transformation of the invention, culture medium and its preparation
Method is as described below:
(1) Agrobacterium-mediated genetic transformation step
1) callus induces
A. 11 rice paddy seed decladdings will be spent in maturation, then successively with alcohol treatment 1 minute of 70%, 0.15% chlorination
Mercury (HgCl2) the surface of the seed disinfection 15 minutes；
B. with sterilizing washing seed 4-5 times；
C. seed is put on the induction medium；
D. the culture medium after inoculation is placed at dark and is cultivated 4 weeks, 25 ± 1 DEG C of temperature.
2) callus subculture
The embryo callus subculture for selecting glassy yellow, consolidation and relatively dry is put on subculture medium dark lower culture 2 weeks, temperature
25 ± 1 DEG C of degree.
3) preculture
The embryo callus subculture for selecting consolidation and relatively dry is put on pre-culture medium dark lower culture 2 weeks, 25 ± 1 DEG C of temperature.
4) Agrobacterium is cultivated
A. (bacterial strain is public from CAMBIA by preculture Agrobacterium EHA105 on the LA culture medium with corresponding resistance selection
Take charge of commercialized agrobacterium strains) two days, 28 DEG C of temperature；
B. Agrobacterium is transferred in suspension medium, is cultivated 2-3 hours on 28 DEG C of shaking tables.
5) Agrobacterium is infected
A. the callus of preculture is transferred in the bottle for bacterium of having gone out；
B. the suspension of Agrobacterium is adjusted to OD6000.8-1.0；
C. callus is impregnated 30 minutes in agrobacterium suspension；
D. it is blotted in transfer callus to the filter paper to have sterilized；Then it is placed on to co-culture and be cultivated 3 days, 19-20 DEG C of temperature on base.
6) callus washing and selection culture
A. sterilizing water washing callus is to invisible Agrobacterium；
B. it is immersed in the aqua sterilisa of carbenicillin containing 400mg/L (CN) 30 minutes；
C. it is blotted in transfer callus to the filter paper to have sterilized；
D. selection culture 2-3 times, every time 2 weeks in callus to Selective agar medium is shifted.
7) break up
Eugonic kanamycin-resistant callus tissue is transferred in differential medium, is placed in illumination cultivation room and carries out illumination cultivation extremely
Differentiate regeneration seedling.
8) it takes root
The bud of seedling to be regenerated it is long to 2-3cm high when can take root.Regeneration plant is being broken up with scissors and tweezers
The root grown on culture medium is removed completely, by the lower part insertion root media of regeneration plant bud, is placed in illumination cultivation room
Culture is until grow the new root of white.
9) hardening and transplanting
When new root to 2cm or so, hardening can be carried out: the sealed membrane of root media is taken off, be added in right amount certainly
Water continues culture 3 days in illumination cultivation room.Transplanting: washing off the remaining medium on root, will turn with the seedling of good root system
Enter greenhouse, while wet in several days initial holding moisture.
(2) main solution formula
1)N6Culture medium a great number of elements mother liquor (is prepared) according to 10 times of concentrates (10X):
Mentioned reagent is dissolved one by one, is then settled to 1000ml with distilled water at room temperature.
2) N6 culture medium microelement mother liquor (prepared according to 100 times of concentrates (100X):
Mentioned reagent is dissolved at room temperature and is settled to 1000ml with distilled water.
3) molysite (Fe2-EDTA liquid (preparing according to 100X concentrate)) is stored:
By 3.73g disodium ethylene diamine tetraacetate (Na2EDTA·2H2) and 2.78g FeSO O4·7H2O dissolves respectively, mixing
And be settled to 1000ml with distilled water, until 70 DEG C warm bath 2 hours, 4 DEG C save backup.
4) vitamins stock liquid (being prepared according to 100X concentrate):
Distilled water is added to be settled to 1000ml, 4 DEG C save backup.
5) MS culture medium a great number of elements mother liquor (being prepared according to 10X concentrate):
Mentioned reagent is dissolved at room temperature, and is settled to 1000ml with distilled water.
6) MS culture medium microelement mother liquor (being prepared according to 100X concentrate):
Mentioned reagent is dissolved at room temperature, and is settled to 1000ml with distilled water.
7) 2,4-D stores the preparation of liquid (1mg/ml):
2,4-D 100mg is weighed, is dissolved 5 minutes with 1ml 1N potassium hydroxide, then plus after the dissolution completely of 10ml distilled water
It is settled to 100ml, is saved at room temperature.
8) 6-BA stores the preparation of liquid (1mg/ml):
6-BA 100mg is weighed, is dissolved 5 minutes with 1ml 1N potassium hydroxide, then plus after the dissolution completely of 10ml distilled water is determined
Hold to 100ml, room temperature preservation.
9) preparation of methyl α-naphthyl acetate (NAA) storage liquid (1mg/ml):
NAA 100mg is weighed, is dissolved 5 minutes with 1ml 1N potassium hydroxide, then plus after the dissolution completely of 10ml distilled water is determined
Hold to 100ml, 4 DEG C save backup.
10) preparation of heteroauxin (IAA) storage liquid (1mg/ml):
IAA 100mg is weighed, is dissolved 5 minutes with 1ml 1N potassium hydroxide, then plus after the dissolution completely of 10ml distilled water is determined
Hold to 100ml, 4 DEG C save backup.
11) preparation of glucose storage liquid (0.5g/ml):
Glucose 125g is weighed, then 250ml is settled to distilled water dissolution, is saved backup for 4 DEG C after sterilizing.
12) AS stores the preparation of liquid:
AS 0.392g is weighed, DMSO 10ml dissolution is added, dispenses to 1.5ml centrifuge tube, 4 DEG C save backup.
13) 1N potassium hydroxide storage liquid is prepared:
Potassium hydroxide 5.6g is weighed, is settled to 100ml with distilled water dissolution, room temperature preservation is spare.
(3) it is used for the culture medium prescription of rice transformation
1) induced medium
Add distilled water to 900ml, 1N potassium hydroxide adjusts pH value to 5.9, boils and is settled to 1000ml, be dispensed into 50ml
Triangular flask (25ml/ bottles), sterilize according to a conventional method after sealing (such as sterilize 25 minutes at 121 DEG C, following medium sterilization sides
Method is identical as the sterilizing methods of basal culture medium).
2) subculture medium
Add distilled water to 900ml, 1N potassium hydroxide adjusts pH value to 5.9, boils and is settled to 1000ml, be dispensed into 50ml
Triangular flask (25ml/ bottles), sealing, sterilizes according to the above method.
3) pre-culture medium
Add distilled water to 250ml, 1N potassium hydroxide adjusts pH value to 5.6, and sealing sterilizes according to the above method.
Using preceding heating for dissolving culture medium and 5ml glucose storage liquid and 250ul AS storage liquid is added, training is poured into packing
It supports in ware (25ml/ ware).
4) base is co-cultured
Add distilled water to 250ml, 1N potassium hydroxide adjusts pH value to 5.6, and sealing sterilizes according to the above method.
Using preceding heating for dissolving culture medium and 5ml glucose storage liquid and 250ul AS storage liquid is added, training is poured into packing
It supports in ware (the every ware of 25ml/).
5) suspension medium
Add distilled water to 100ml, adjusts pH value to 5.4, be dispensed into the triangular flask of two 100ml, seal, by above-mentioned side
Method sterilizing.
Liquid is stored using preceding addition 1ml sterile dextrose and 100ul AS stores liquid.
6) Selective agar medium
Add distilled water to 250ml, adjusts pH value to 6.0, sealing sterilizes according to the above method.
Using preceding dissolution culture medium, 250ul HN (50mg/ml) is added and training is poured into 400ul CN (250mg/ml) packing
It supports in ware (25ml/ ware).(note: first time Selective agar medium carbenicillin concentration is 400mg/l, second and selection later
Culture medium carbenicillin concentration is 250mg/l).
7) pre- differential medium
Add distilled water to 250ml, 1N potassium hydroxide adjusts pH value to 5.9, and sealing sterilizes according to the above method.
Using preceding dissolution culture medium, 250ul HN (50mg/ml) 250ul CN (250mg/ml), packing is poured into culture dish
(25ml/ ware).
8) differential medium
Add distilled water to 900ml, 1N potassium hydroxide adjusts pH value to 6.0.
It boils and is settled to 1000ml with distilled water, be dispensed into 50ml triangular flask (50ml/ bottles), seal, according to the above method
Sterilizing.
9) root media
Add distilled water to 900ml, adjusts pH value to 5.8 with 1N potassium hydroxide.
It boils and is settled to 1000ml with distilled water, be dispensed into pipe of taking root (25ml/ pipe), seal, go out according to the above method
Bacterium.
Embodiment 3: transgenic positive plant is detected using PCR method
After transformation seedlings are moved into greenhouse, turns green to it, single plant is then divided to take 1-2cm young leaflet tablet, extract its genome
DNA detects positive plant using PCR method using genomic DNA as template.Amplified fragments are the Partial Fragment of reporter gene gus,
Clip size is 699bp.Primer sequence is GUS-F:GGGCGAACAGTTCCTGATTA, GUS-R:
AACGTATCCACGCCGTATTC.PCR reaction condition: 94 DEG C of 5min, 94 DEG C of 50sec, 57 DEG C of 40sec, 72 DEG C of 50sec, 30
Circulation, 72 DEG C of 7min.PCR product is detected through 0.8% agarose gel electrophoresis.To all T0PCR detection is carried out for plant, according to inspection
Survey the transformed plant that result rejects false positive.
Genomic DNA is extracted using the extracting method of a small amount of leaves genomic DNAs: being taken appropriate young leaflet tablet, is added 800 μ l
1.5 × CTAB (1.5 × CTAB formula: 1.5%CTAB, 75mM Tris-HCl, 15mM EDTA and 1.05M NaCl) grinding, turns
Enter in 1.5ml centrifuge tube；65 DEG C of water-bath 30min；600 μ L chloroforms/isoamyl alcohol (volume ratio 24:1) is added to turn upside down for several times
(about 15min), until lower layer's liquid phase is dark green；12000r/min is centrifuged 10min at room temperature；Take 500 μ L supernatant Yu Yixin
95% ethyl alcohol 1mL of pre-cooling is added in 1.5ml centrifuge tube, mixes -20 DEG C of postposition, 30min；12000r/min is centrifuged at room temperature
10min removes supernatant, embathes precipitating with 75% ethyl alcohol, spontaneously dries；100 μ L ddH are added2O dissolution, it is spare.
Embodiment 4: expression pattern of the promoter BIP1 in rice is respectively organized
The different tissues for taking expression vector BIP1-DX2181 positive transformants plant (reference implementation example 3) (include: root, leaf
Piece, leaf sheath, stem, fringe and seed) it is cut into the appropriately sized of about 0.5CM length, immerse the GUS dye liquor of about 200 μ l, 37 DEG C of mistakes
Then night is decolourized with 75% alcohol, has seen whether blue appearance.Side of the formula of dyeing liquor referring to reports such as Jefferson
Method (fusions: β-glucuronidase as a of Jefferson, R.A., Kavanagh, T.A.and Bevan, M.W.GUS
sensitive and versatile gene fusion marker in higher plants.EMBO J.1987,6,
3901-3907)。
The GFP histologic analysis of expression vector BIP1-DX2181 positive transformants plant is carried out by fluorescence microscope.Take T0
For positive transformants plant each tissue (blade, leaf sheath, stem, root, fringe and seed) at fluorescence microscope (Leica MZ16F)
GFP2 shelves it is lower observe, and taken pictures using Leica Application Suite software.
Testing result is shown: the promoter BIP1 that the present invention separates shows two-way expression pattern, and two in rice
Direction is composing type high efficient expression (see Fig. 4).
Embodiment 5: expression intensity analysis of the promoter BIP1 in rice different tissues
The different tissues for taking expression vector BIP1-DX2181 positive transformants plant (include: root, blade, leaf sheath, stem, fringe
And seed) and extract total protein, then measure its GUS activity.The extracting of total protein and concentration mensuration refer to the side of Bradford
Method (Bradford, M.M.A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
Binding.Anal.Biochem.1976,72,248-254), GUS determination of activity refers to method (Xu, the L.et of Xu
al.Isolation of the endosperm-specific LPAAT gene promoter from coconut(Cocos
nucifera L.)and its functional analysis in transgenic rice plants.Plant Cell
Rep.2010,29,1061-1068)。
The GFP expression quantity of BIP1-DX2181 positive transformants plant different tissues utilizes quantitative real-time
PCR (qRT-PCR) is detected.The total serum IgE method for extracting of transgenic plant different tissues and specific step is as follows (use Beijing
The TransZol of Quan Shijin Biotechnology Co., Ltd, concrete operation step refer to its specification).Carry out quality analysis and concentration
After detection, cDNA the of the reverse transcription synthesis for real-time PCR is carried out using the SSIII kit of invitrogen company
One chain.QRT-PCR uses the SYBR Green Master Mix kit of precious bioengineering Dalian Co., Ltd.The primer
Sequence are as follows: target gene: GFP-F:5 '-ATCCGCCACAACATCGAGGA-3 '；GFP-R:5'-
TCGTCCATGCCGAGAGTGAT-3'；Reference gene: GAPDH-F:5 '-CTGCAACTCAGAAGACCGTTG-3 '；GAPDH-R:
5'-CCTGTTGTCACCCTGGAAGTC-3'.Reaction carries out on ABI 7500PCR instrument.Analysis of experimental results method uses 2-ΔΔC TMethod.
Result (Fig. 5) display of the GUS and GFP reporter gene quantitative detection of BIP1-DX2181 transgenic plant, promoter
The expression activity in the 3 ' directions of BIP1 highest in seed, GUS activity reach 17806 ± 2108pmol 4-MU/min/mg
protein；Followed by root, GUS activity are 14769 ± 1782pmol 4-MU/min/mg protein；Followed by stem, leaf
Sheath, fringe and blade, GUS activity are respectively 9825 ± 1510,8681 ± 834,7380 ± 895 and 6092 ± 875pmol 4-MU/
min/mg protein.The expression activity in the 5 ' directions of promoter BIP1 highest in fringe, is 3.4 of expression activity in blade
Times；And the expression quantity of GFP is 2.8,2.5,1.4 and 1.1 times in blade respectively in root, leaf sheath, stem and seed.
Embodiment 6: 5 ' and 3 ' deletion analysis of promoter BIP1
In order to find the two-way expression regulatory region of bidirectional promoter BIP1,5 ' and 3 ' deletion analysis are carried out to it.To survey
The TA-BIP1 of sequence verifying is template, using PCR method, designs special primer (table 1) to construct a series of 5 ' and 3 ' missings of BIP1
Promoter (Fig. 6).GUS the and GFP correlation analysis method of vector construction, rice transformation and transgenic plant with above-mentioned reality
It is identical to apply example.The expression of the different driving of BIP1 deletion promoters gus genes and GFP gene in rice different tissues is shown in figure
7.Gus protein Activity determination in the different tissues of the transformed plant of different BIP1 deletion promoters driving gus genes and GFP gene
Fig. 8 is seen with GFP quantitative analysis results.
The results show that the GUS activity that BIP1-1F2R transgenic plant is respectively organized is far below BIP1 transgenic plant, especially
It is root, stem, 10% of GUS activity lower than BIP1 transgenic plant respective organization of seed and fringe.It is possible thereby to infer,
Region 1 can significantly promote the transcriptional activity in the 3 ' directions of BIP1.At the same time, BIP1-1F2R transgenic plant each group
The GFP expression quantity knitted also is significantly lower than BIP1 transgenic plant.The above result shows that Region 1 is a bidirectional transcription enhancing
Section.3 ' the ends for further truncating BIP1 cause the GUS activity of BIP1-1F3R transgenic plant to completely lose, and BIP1-1F3R
The GFP expression quantity that transgenic plant is respectively organized has no compared with BIP1-1F2R transgenic plant to be substantially reduced.Should the result shows that,
Region 2 regulates and controls the basic transcription activity in the 3 ' directions of BIP1, and unrelated with the transcriptional activity in 5 ' directions.BIP1-2F1R and
BIP1-2F2R transgenic plant can't detect GFP expression, illustrate that the missing of Region 3 leads to the transcription in the 5 ' directions of BIP1
Activity completely loses.The GUS of BIP1-2F1R transgenic plant analyze the results show that Region 3 missing for BIP1 big
The expression activity in 3 ' directions influences faint in majority tissue, but the expression activity in 3 ' directions influences very in root on promoter
Greatly, the GUS activity of BIP1-2F1R transgenic plant root is significantly lower than BIP1 transgenic plant.The above results show Region 3
Regulate and control the basic transcription activity in the 5 ' directions of BIP1, meanwhile, it can also positive regulation BIP1 transcription of the 3 ' directions in root
Activity.
Embodiment 7: conservative Analysis of the promoter BIP1 in gramineae plant
Due to promoter unlike gene coding region has product that can limit its variation during evolution, it removes
Except conservative cis-regulating element, there is height and make a variation in the sequence of promoter.Therefore the conservative for studying promoter can lead to
The downstream gene for crossing its regulation is started with.The present invention using Ensembl Plants database (http: //
Plants.ensembl.org/index.html four groups of gene pairs of information analysis in) " are head to head tied in gramineae plant
The conservative of structure ".If one group of gene pairs has homologous gene in another species, and the arrangement mode of homologous gene is still in
Existing " head to head configuration ", then be considered as conservative bidirectional promoter (c-BIP) for the promoter for regulating and controlling them；Conversely, if homologous base
" head to head configuration " is not presented in the arrangement mode of cause, then the promoter for regulating and controlling them is considered as to non-conservative bidirectional promoter (n-
BIP)。
Conservative Analysis of the 2 promoter BIP1 of table between different gramineae plants
Table 2 the results show that 4 species of the promoter BIP1 that clones of the present invention in six gramineae plants: rice,
Be in sorghum, two fringe false bromegrass and corn it is conservative, show that two genes that it regulates and controls are relatively conservative during evolution, more
Such " head to head configuration " is maintained in number species.Meanwhile two genes regulated and controled by bidirectional promoter BIP1, LOC_
The functional annotation of Os02g42314 and LOC_Os02g42320 is respectively ubiquitin conjugate enzyme and protease, belongs to conservative structure
Gene.Moreover, they functionally there is also certain correlations, further prove the relationship of its coevolution.
Present invention obtains one in rice composing type high intensity expression bidirectional promoter BIP1, be genetic engineering and
Molecular breeding provides efficient two-way startup child resource.Meanwhile present invention combination bioinformatics method and laboratory facilities, root
According to the location information and expressing information of bidirectional promoter controlling gene, screening, clone and the function of a bidirectional promoter are established
The complete method that can be analyzed.
Claims (4)
1. the bidirectional promoter BIP1, its nucleotide sequence such as sequence table SEQ ID of the expression of a rice composing type high intensity
Shown in NO:1.
2. the bidirectional promoter BIP1-1F2R of a rice constitutive expression, its nucleotide sequence such as sequence table SEQ ID
Shown in NO:2.
3. the sub- BIP1-2F1R of unilateral initiative of rice composing type high intensity expression, its nucleotide sequence such as sequence table SEQ
Shown in ID NO:4.
4. application of the promoter described in claims 1 or 2 or 3 in rice modification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279163.7A CN106676107B (en) | 2016-04-28 | 2016-04-28 | The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610279163.7A CN106676107B (en) | 2016-04-28 | 2016-04-28 | The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106676107A CN106676107A (en) | 2017-05-17 |
| CN106676107B true CN106676107B (en) | 2019-04-05 |
Family
ID=58839646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610279163.7A Active CN106676107B (en) | 2016-04-28 | 2016-04-28 | The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106676107B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394385A (en) * | 2020-03-30 | 2020-07-10 | 扬州大学 | Method for rapidly identifying bidirectional promoter of rice |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6388170B1 (en) * | 2000-04-07 | 2002-05-14 | University Of Kentucky Research Foundation | Bidirectional promoters and methods related thereto |
| TWI361220B (en) * | 2005-08-02 | 2012-04-01 | Univ Nat Taiwan | A plant shsp gene bi-directional promoter and uses thereof |
| CN1936002A (en) * | 2005-09-19 | 2007-03-28 | 中国农业大学 | Method for separating bidirectional promoter and its use |
| CA2855902C (en) * | 2011-12-30 | 2022-06-21 | Dow Agrosciences Llc | Construct and method for synthetic bidirectional plant promoter ubi1 |
| CN104651359B (en) * | 2013-11-25 | 2017-07-11 | 中国农业科学院生物技术研究所 | The bidirectional promoter separated from corn and its application |
-
2016
- 2016-04-28 CN CN201610279163.7A patent/CN106676107B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106676107A (en) | 2017-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | CRISPR/Cas9 targeted mutagenesis of SlLBD40, a lateral organ boundaries domain transcription factor, enhances drought tolerance in tomato | |
| Cui et al. | miR156a‐targeted SBP‐Box transcription factor SlSPL13 regulates inflorescence morphogenesis by directly activating SFT in tomato | |
| Schnabel et al. | The ROOT DETERMINED NODULATION1 gene regulates nodule number in roots of Medicago truncatula and defines a highly conserved, uncharacterized plant gene family | |
| Karanja et al. | Genome-wide characterization of the AP2/ERF gene family in radish (Raphanus sativus L.): Unveiling evolution and patterns in response to abiotic stresses | |
| Khusnutdinov et al. | Anthocyanin biosynthesis genes as model genes for genome editing in plants | |
| BR112014016523B1 (en) | METHOD FOR PRODUCTION OF A PLANT WITH INCREASED STEM SIZE, INCREASED DRY WEIGHT, INCREASED GROWTH SPEED, INCREASED LEAF SIZE, INCREASED ROOT GROWTH, INCREASED DROUGHT TOLERANCE AND DELAYED SENESCENCE | |
| US20120198587A1 (en) | Soybean transcription factors and other genes and methods of their use | |
| CN105063085B (en) | The application of cabbage type rape gene BnMPK3 and its anti-sclerotinia sclerotiorum | |
| Yamasaki et al. | Arabidopsis thaliana cold-regulated 47 gene 5′-untranslated region enables stable high-level expression of transgenes | |
| CN107236744A (en) | The separation and application of the early real trifoliate orange PtAGL24 genes of controllable plant early blossoming | |
| CN106566825B (en) | The method for screening rice tissue specifically expressing cis-acting elements and its flanking sequence | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| BR112014002342A2 (en) | terminal molecules, method of identification and isolation of terminal molecules, method of production of recombinant terminal molecules, method of production of plants or their parts with amplified expression, construction of recombinant expression, recombinant expression vector, transgenic cell, transgenic plant or its part , cultivation of transgenic cells, transgenic seeds, parts or propagation material derived from a transgenic cell or plant or its part, use of the terminal molecule and production method of agricultural product | |
| CN107418957A (en) | Control rice cold tolerance gene C OLD2 and its application | |
| CN110117322A (en) | The MYB class transcription factor and its encoding gene that are separated from purple plague purpura Trifolium repense and application | |
| CN109266647A (en) | Rice-stem borer is caused harm inducible promoter and its application | |
| CN106676107B (en) | The separation clone of the endogenous artificially fused bi-directional promoter of rice and functional analysis | |
| CN104395467B (en) | Technique for regulating sugar cane flowering | |
| CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
| CN103421784A (en) | Identification and utilization of drought and high-salt induced paddy rice promoter PDS1 | |
| Moon et al. | Integrated omics analysis of root-preferred genes across diverse rice varieties including Japonica and indica cultivars | |
| CN113046374A (en) | Flower color regulating gene MaGT, application thereof and method for rapidly verifying function thereof | |
| CN102586247B (en) | Application of stress inducible promoter on controlling gene in drought induced expression | |
| CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
| CN106148344A (en) | A kind of have 5 ' UTR sequence and the application thereof strengthening gene expression in plants activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |