CN106636430B - Biomarker combinations, kits and methods of use for predicting breast cancer - Google Patents

Abstract

The invention provides a biomarker combination and a kit for predicting breast cancer, wherein a primer design gene is selected from four telomere genes with the most obvious methylation rate difference in breast cancer tissues and normal tissues. And respectively designing methylation primers and qPCR primers of the target gene according to the promoter regions and the coding regions of the four telomere genes to form a methylation primer combination and a qPCR primer combination. The biomarker combination provided by the invention is designed according to the telomere gene with the most obvious methylation rate difference in breast cancer tissues and normal tissues, and when a detection sample is breast cancer, the biomarker combination can specifically capture and amplify a specific DNA fragment in the detection sample, so that the detection sensitivity is improved, and the biomarker combination has better noise resistance, flexibility and accuracy, and can be used for early prediction of breast cancer, evaluation and detection of therapeutic drugs and prognosis recurrence detection. The method for predicting breast cancer provided by the invention is rapid in operation, simple and convenient, and has better feasibility and prediction effect.

Description

Biomarker combinations, kits and methods of use for predicting breast cancer

Technical Field

The invention relates to the technical field of biological detection, in particular to a biomarker combination, a kit and a use method for predicting breast cancer.

Background

With the development of the modern society, malignant tumors have become one of the main killers of people at present. In female malignant tumors, breast cancer is the first cause of female malignant tumors because breast cancer is a significant cause of morbidity and mortality of women worldwide. A large number of researches show that the causes of the breast cancer are mostly the result of the combined action of environmental factors and genetic factors, while the hereditary breast cancer accounts for only 5 to 10 percent of all the breast cancers, so that most of the breast cancers cannot determine whether the breast cancer lesions occur through mutation detection of susceptibility genes of the breast cancers.

Recent studies have found that the methylation state of DNA (deoxyribonucleic acid) is closely related to the occurrence and development of breast cancer. DNA methylation mainly occurs at cytosine (i.e. CpG sites) before guanine of a DNA chain, the CpG sites are added with methyl under the catalysis of methyltransferase, and the CpG sites are methylated, namely DNA methylation. When DNA methylation reaches a certain degree, the transition of conventional right-handed duplex B-DNA to left-handed duplex Z-DNA occurs. The structure of Z-DNA shrinks, spiraling deeper relative to B-DNA, which allows many elements capable of binding to proteins to sink into the helical groove, making DNA transcription difficult to initiate, thereby preventing normal expression of the gene, i.e., gene inactivation. The CpG sites are contained in a plurality of genes of cancer suppressor genes, oncogenes, DNA repair genes, cell cycle regulatory genes and the like existing in a human body, when the CpG sites in the cancer suppressor genes are highly methylated, the gene expression of the cancer suppressor genes is inhibited, the cancer suppressor genes are inactivated, and the cancer suppressor genes lose normal cancer suppression functions; when the methylation ratio of CpG sites in an oncogene is low, the oncogene is actively expressed, the expression level of a cancer cell increases, and canceration occurs when the expression level of the cancer cell increases to a certain extent. Meanwhile, demethylase opposite to the action of methyltransferase exists in human body, and the methylation state of DNA can be in a reversible state through the action of demethylase and methyltransferase, so that the methylation level or methylation rate of DNA in gene can be used as an index for measuring canceration. In addition, the content of demethylase and methyltransferase can be different according to different ways of living environment, diet, medicine and the like, so that the occurrence and development of breast cancer can be avoided and slowed down by changing the living environment, diet, medicine and the like.

The biomarker is a marker capable of reflecting the growth and proliferation characteristics of cells, and can reflect the abnormality of a human body on the biological level such as molecules and cells before a living body is seriously damaged, wherein the abnormality is mainly expressed by the change in the biochemical metabolic process, the content of abnormal metabolites, the abnormal expression of physiologically active substances and the like, and therefore, the current state of the human body can be known by detecting the biomarker. The biomarker can mark specific genes, such as cancer suppressor genes, oncogenes, DNA repair genes and the like related to breast cancer, so as to reflect whether the body is cancerated or not at present. Currently, most of the studies on DNA methylation and breast cancer focus on the study of a single gene, so that the biomarker is also a single biomarker. Because the daughter cells are genetically altered during the division growth of breast cancer tumors, the growth rate, invasive ability, treatment and prognosis of breast cancer tumors are different, i.e., breast cancer tumors have heterogeneity and complexity, and therefore, the mutation and complexity of genes make a single biomarker not accurately indicate the methylation state and methylation rate of DNA, and further, the study of a single gene cannot accurately indicate the relationship between DNA methylation and breast cancer. In addition, single biomarkers have serious problems of false positive and false negative when applied, and the detection sensitivity is low, so that the accuracy of the detection result is reduced.

Disclosure of Invention

The invention provides a biomarker combination, a kit and a use method for predicting breast cancer, and aims to solve the problems of low sensitivity and low accuracy of the existing biomarker when the methylation state and the methylation rate of DNA are indicated.

In a first aspect, the present invention provides a biomarker combination for predicting breast cancer, the combination being a methylated primer combination comprising:

designing a forward primer with a sequence of TTATATGTTATGTGATTATTGGAAATTAT and a reverse primer with a sequence of TTCCCAAAACTTAATCCTAAAACTC according to a telomere gene RAD 50;

designing a forward primer with the sequence of GGGTTGGGTGTTAGTGAGTGT and a reverse primer with the sequence of CAACTCCCATACCCCAAAAA according to the telomere gene RTEL;

designing a forward primer with a sequence of AAAATTTGTAGAGTAGGAATTAAGTTG and a reverse primer with a sequence of CCCCAAACCTAACTAACTAAAC according to the telomere gene TERC;

and/or, designing a forward primer with a sequence of TAGTAGAATAGGAATTTTGGGAGT and a reverse primer with a sequence of AATACAACCTTAACTAAAAC according to the telomere gene TRF 1.

In a second aspect, the kit includes a methylated primer combination.

In a third aspect, the present invention provides a method for detecting the methylation rate of a target gene location of a DNA fragment in a DNA sample, the method comprising:

treating the DNA sample by sulfite, and respectively performing targeted PCR amplification by adopting a methylation primer combination to obtain a targeted PCR amplification product containing a sequencing Tag sequence;

inserting an upstream general sequencing primer and a downstream barcoded sequencing primer into the targeted PCR amplification product containing the sequencing Tag sequence to distinguish the targeted PCR amplification products of different samples; wherein the target PCR amplification products of the same sample are inserted into an upstream universal sequencing primer and the downstream barcoded sequencing primer with the same barcode, and the target PCR amplification products of different samples are inserted into an upstream universal sequencing primer and the barcoded downstream sequencing primer with different barcodes;

the reaction systems are respectively subjected to PCR amplification to obtain PCR amplification products of different samples;

proportionally mixing the PCR amplification products of different samples to form an amplicon library;

purifying, quantifying and controlling the amplicon library to obtain a methylation sequencing library;

and performing double-end sequencing, sample splitting and methylation information analysis on the methylation sequencing library to obtain the methylation state and the methylation rate of each CpG site of the target gene in each sample DNA.

In combination with the third aspect, the amplification conditions for the targeted PCR amplification are: holding at 95 deg.C for 10 min, denaturation at 95 deg.C for 15 sec, annealing at 58 deg.C for 30 sec, and extension at 72 deg.C for 60 sec for 40 cycles;

the amplification conditions of the PCR amplification are as follows: the temperature of 95 ℃ is kept for 10 minutes, the temperature of 95 ℃ is kept for 15 seconds, the temperature of 60 ℃ is kept for 30 seconds, the temperature of 72 ℃ is kept for 60 seconds, 15 cycles are totally carried out, and after the cycles are finished, the extension reaction is carried out for 3 minutes at 72 ℃.

In a fourth aspect, the present invention provides a biomarker combination for predicting breast cancer, the combination being a qPCR primer combination comprising:

designing a forward primer with a sequence of TGGATATGCGAGGACGATG and a reverse primer with a sequence of TGTTGGCTCATCCAAGGCA according to a telomere gene RAD 50;

designing a forward primer with the sequence of CATCGATGCTGTTGAGCTGC and a reverse primer with the sequence of GGATGATCTGGTCCAGCGAG according to the telomere gene RTEL;

designing a forward primer with a sequence of CATGTGTGAGCCGAGTCCTG and a reverse primer with a sequence of GAAGAGGAACGGAGCGAGTC according to the telomere gene TERC;

designing a forward primer with a sequence of GTCTGCGGTAACTGAATCCTCA and a reverse primer with a sequence of TTGTTGCTGGGTTCCATGTT according to the telomere gene TRF 1;

and/or, a forward primer with a sequence of CCTCTCCCCAGCCAAAGAAG and a reverse primer with a sequence of TGACCCTTTTTGGACTTCAG designed according to the reference gene GAPDH.

In a fifth aspect, the present invention provides a kit for predicting breast cancer, the kit comprising a qPCR primer combination.

In a sixth aspect, the present invention provides a biomarker combination for predicting breast cancer, the combination comprising a methylation primer combination and a qPCR primer combination.

In a seventh aspect, the present invention provides a kit for predicting breast cancer, the kit comprising a biomarker combination comprising a methylation primer combination and a qPCR primer combination.

In an eighth aspect, the present invention provides a method for detecting the methylation rate and the expression level of a target gene at a target gene position in a nucleic acid sample, wherein the method comprises the step of using a biomarker combination comprising a methylation primer combination and a qPCR primer combination, wherein the methylation primer combination is used for detecting the methylation rate of the target gene, and the qPCR primer combination is used for detecting the expression level of the target gene.

In a ninth aspect, the present invention provides a use of the biomarker combination in the preparation of a reagent for predicting breast cancer, a reagent for detecting breast cancer recurrence, or a reagent for evaluating a drug for breast cancer treatment.

The technical scheme provided by the embodiment of the invention can have the following beneficial effects:

in the cell division process, the length of telomeres is continuously reduced along with the continuous replication of DNA molecules, when the telomeres are reduced to be nearly absent, cells can immediately activate an apoptosis mechanism, and the cells are subjected to apoptosis; telomerase, which is only present in hematopoietic cells, stem cells, germ cells and cancer cells, can extend the length of telomeres, so that cells do not die due to shortening of telomeres, and thus telomeres are associated with cell proliferation. The activity of telomerase in cancer cells is greater than that of telomerase in normal cells such as hematopoietic cells, so that the extension length of telomeres in cancer cells is greater than that of telomeres in normal cells such as hematopoietic cells, and the proliferation speed of cancer cells is faster.

In the biomarker combination and the kit for predicting breast cancer, provided by the invention, the primer design gene is selected from telomere genes related to cancer cell proliferation, and particularly from four telomere genes RAD50, RTEL, TERC and TRF1 which have the most significant methylation difference between breast cancer tissues and normal tissues. Designing methylation primers of target genes according to the promoter regions of the four telomere genes respectively to form methylation primer combinations for detecting the methylation state and the methylation rate of the promoter region of the target genes; and respectively designing qPCR primers of the target gene according to the coding regions of the four telomere genes to form a qPCR primer combination, and detecting the expression level of the target gene. The biomarker combination provided by the invention is designed according to the telomere gene with the most obvious methylation difference in breast cancer tissues and normal tissues, so that when a sample is detected to be breast cancer, the biomarker combination can specifically capture and amplify a specific DNA fragment in the detected sample, so that the detection sensitivity is improved, and the biomarker combination also has good noise resistance, flexibility and accuracy, has good repeatability, and can be applied to early prediction of breast cancer, evaluation and detection of therapeutic drugs, prognosis and relapse detection and the like. The method for predicting breast cancer provided by the invention is rapid in operation, simple and convenient, and has better feasibility and prediction effect.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and together with the description, serve to explain the principles of the invention.

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without inventive exercise.

Fig. 1 is a graph of ROC curve (receiver operating characteristic curve) for predicting breast cancer tumor tissue according to the embodiment of the present invention.

Detailed Description

Reference will now be made in detail to the exemplary embodiments, examples of which are illustrated in the accompanying drawings. When the following description refers to the accompanying drawings, like numbers in different drawings represent the same or similar elements unless otherwise indicated. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present invention. Rather, they are merely examples of apparatus and methods consistent with certain aspects of the invention, as detailed in the appended claims.

Telomeres are small DNA-protein complexes with highly repetitive TTAGGG sequences present at the end of eukaryotic linear chromosomes and have the property of maintaining chromosomal integrity and controlling the cell separation cycle. Telomeres exist in any human DNA sample which can be extracted, and the telomere length of each chromosome is gradually shortened because telomere genes cannot be completely copied during cell division each time the cells divide. When telomeres shrink to near, cells immediately activate apoptotic mechanisms and the cells go to apoptosis. Telomerase, which is only present in hematopoietic cells, stem cells, germ cells and cancer cells, can extend the length of telomeres, so that cells do not die due to shortening of telomeres, and thus telomeres are associated with cell proliferation. Research shows that activation of telomerase is a basic step of tumor occurrence, continuous expression of related proteins such as telomerase and the like can enable tumor cells to obtain unlimited propagation capacity, and the activity of the telomerase in cancer cells is greater than that of the telomerase in normal cells such as hematopoietic cells, so that the extension length of the telomere in the cancer cells is greater than that of the telomere in the normal cells such as the hematopoietic cells, and then the cell proliferation speed of the cancer cells is higher, so that the telomere has an important role in the occurrence and development of cancers.

DNA methylation detection technology has the characteristics of small damage and high sensitivity, and the change of the methylation state of DNA usually occurs before canceration, so whether normal cells cancerate or not can be measured by the methylation level or the methylation rate of DNA in a gene.

The sequences involved in the biomarkers, kits and methylation test methods provided in the embodiments of the invention are shown in table 1.

Table 1: sequence of

In the biomarker provided by the embodiment of the invention, a telomere gene design primer related to breast cancer is selected. When selecting the telomere gene, four telomere genes RAD50, RTEL, TERC and TRF1 with the most obvious methylation difference in breast cancer tissues and normal tissues are selected as basic genes for primer design. Specifically, methylation primers are designed according to promoter regions of telomere genes RAD50, RTEL, TERC and TRF1 respectively to form a methylation primer combination for detecting the methylation state and the methylation rate of the promoter region of the target gene. See table 2 for methylation primer sequences designed based on the four telomere genes RAD50, RTEL, TERC, and TRF 1.

Table 2: methylated primer sequences

Numbering	Name of Gene	Forward primer (5'-3')	Reverse primer (5'-3')
				1	RAD50	SEQ1	SEQ2
2	RTEL	SEQ3	SEQ4
				3	TERC	SEQ5	SEQ6
4	TRF1	SEQ7	SEQ8

In the methylation primer combination composed of the four sets of methylation primers and the four sets of methylation primers, each set of specific amplification primer sequence can specifically capture a specific DNA fragment, namely a target gene, in a sample to be detected, and amplify the target gene through a Polymerase Chain Reaction (PCR), so that the methylation level of the target gene can be obtained.

The embodiment of the invention also provides a kit for predicting breast cancer, which comprises a first round PCR amplification reagent and a second round PCR amplification reagent. The first round of PCR amplification reagent comprises buffer solution, sulfite, dNTP (deoxyribose-nucleotide triphosphate), enzyme mixture and first round of target PCR amplification primer. The second round PCR amplification reagent comprises a buffer solution, dNTP, an enzyme mixed solution and a second round PCR amplification primer. The kit can detect the methylation level of the target gene for the same reasons as the combination of the biomarkers provided by the embodiments of the present invention.

Further, the first round of targeted PCR amplification primers include methylated primers or a combination of methylated primers as shown in table 2. The 5 'end of each forward primer was added with the sequence SEQ19 and the 5' end of each reverse primer was added with the sequence SEQ 20. The second round PCR amplification primers included an upstream universal sequencing primer sequence P1 and a downstream barcoded sequencing primer sequence Index 1-6.

Specifically, the sulfite is used for treating the genomic DNA extracted from the sample to be tested so as to convert cytosine (C) in the genomic DNA into uracil (U), and methylated cytosine is not affected, thereby facilitating the knowledge of the methylation state and the methylation rate in the genomic DNA.

In the present example, the buffer solution is TE buffer for dissolving nucleic acid, which can stabilize and store DNA and RNA. The reaction premixed solution is a base solution of a PCR reaction system, and the enzyme mixed solution comprises DNA polymerase and MgCl₂(magnesium chloride) and the like.

The forward primers and the reverse primers in each pair of methylated primers comprise specific amplification sequences and sequencing joint sequences connected with the 5' ends of the specific amplification sequences, the specific amplification sequences are shown in table 2, the sequencing joint sequences are forward sequencing Tag sequences and reverse sequencing Tag sequences, and the forward sequencing Tag sequences and the reverse sequencing Tag sequences are necessary pre-steps for sequencing. The specific sequence of the forward sequencing Tag sequence is shown as SEQ19 in Table 1, and the specific sequence of the reverse sequencing Tag sequence is shown as SEQ20 in Table 1.

The upstream universal sequencing primer sequence and the downstream barcoded sequencing primer sequence are used to amplify and label the extracted DNA in different samples. The upstream universal sequencing primer sequence is shown in P1 in Table 1, and the downstream barcoded sequencing primer sequence is shown in Index1-6 in Table 1.

The embodiment of the invention also provides a method for detecting the methylation rate of the target gene position of the DNA fragment in the DNA sample, which comprises the following steps:

s101: and (3) carrying out targeted PCR amplification on the DNA sample by adopting a methylation primer combination after the DNA sample is treated by sulfite to obtain a targeted PCR amplification product containing a sequencing Tag sequence.

Extracting a DNA sample from a mammary tissue sample of a human body to be detected by adopting a DNA extraction reagent, and treating the DNA sample by sulfite so as to convert unmethylated cytosine in the DNA into uracil. The sulfite treated DNA sample was quantitated using a spectrophotometer to ensure that sufficient DNA sample was available for further reaction. In an embodiment of the present invention, the DNA extraction reagent may be a TIANAmp Genomic DNA Kit. The quantified DNA sample is subjected to targeted PCR amplification under the action of the methylation primer combination, namely, a first round of PCR amplification reaction is carried out, so that a specific DNA fragment in the DNA sample is captured through the specific methylation primer, namely, a target gene is captured, and the first round of PCR amplification is completed. In the first round of PCR amplification, the sequencing Tag sequences shown as SEQ19 and SEQ20 in Table 1 are connected to two ends of the amplification product while the target gene is captured.

The amplification conditions for targeted PCR amplification were: the temperature at 95 ℃ for 10 minutes, 95 ℃ denaturation for 15 seconds, 58 ℃ annealing for 30 seconds, 72 ℃ extension for 60 seconds, for 40 cycles.

The target PCR amplification product obtained after the first round of PCR amplification is diluted by 100 times by TE buffer solution, so that the DNA is convenient to stabilize and store.

S102: inserting an upstream general sequencing primer and a downstream barcoded sequencing primer into the targeted PCR amplification product containing the sequencing Tag sequence to distinguish the targeted PCR amplification products of different samples; wherein the target PCR amplification products of the same sample are inserted into the upstream universal sequencing primer and the downstream barcoded sequencing primer with the same barcode, and the target PCR amplification products of different samples are inserted into the upstream universal sequencing primer and the downstream barcoded sequencing primer with different barcodes.

And adding an upstream universal sequencing primer and a downstream barcoded sequencing primer with different barcodes according to the target PCR amplification products of different samples. All primers form a primer mixture due to the difference in barcoded sequencing primers for the different downstream barcodes. The sequence of the upstream universal sequencing primer is shown as P1 in Table 1, and the sequence of the downstream barcoded sequencing primer is shown as Index1-6 in Table 1. In the embodiment of the invention, the concentration of the upstream universal sequencing primer and the concentration of the downstream barcoded sequencing primer are both 2 mu M/L. 7 mul of the premixed solution, 1 mul of the target PCR amplification product inserted with the sequencing Tag sequence and 2 mul of the second round PCR primer mixed solution form a PCR amplification reaction system.

S103: and respectively carrying out PCR amplification on the reaction systems to obtain PCR amplification products of different samples.

And respectively carrying out PCR amplification on the reaction systems of different samples to obtain PCR amplification products of different samples. The amplification conditions for PCR amplification were: the temperature of 95 ℃ is kept for 10 minutes, the temperature of 95 ℃ is kept for 15 seconds, the temperature of 60 ℃ is kept for 30 seconds, the temperature of 72 ℃ is kept for 60 seconds, 15 cycles are totally carried out, and after the cycles are finished, the extension reaction is carried out for 3 minutes at 72 ℃.

S104: mixing different PCR amplification products in equal proportion to form an amplicon library;

PCR amplification products of different samples were mixed according to the ratio of 1: 1: …: 1 to ensure that the data for each sample is uniform. And forming an amplicon library by PCR amplification products after equal proportion mixing.

S105: and purifying, quantifying and controlling the quality of the amplicon library to obtain a methylation sequencing library.

The amplicon library was purified by Agencourt AMPure XP system to remove excess primers and non-specific amplification products. And detecting the size of the amplified product fragment in the purified amplicon library by using a chip bioanalyzer so as to avoid influencing the quality of the final sequencing data. Further, the library of amplicons is prepared by

The dsDNA HS Assaykit is used for accurate quantification and quality control, and a methylation sequencing library is formed.

S106: and performing double-end sequencing, sample splitting and methylation information analysis on the methylation sequencing library to obtain the methylation state and the methylation rate of each CpG site of the target gene in each sample DNA.

The methylation sequencing library adopts a MiSeq Reagent Kit v 2500 cycles Kit to complete the sequencing of double ends 2 × 250bp on a MiSeq sequencer so as to obtain more sequencing data and reduce subsequent analysis errors, wherein the sequencing data comprises methylation data. After double-end sequencing is finished, the sequencing data are divided into different sample data according to different sample barcodes, and the sequencing data of a plurality of different samples are compared with the human reference genome sequence by using Bismark software, so that the methylation rate of a single CpG locus on each gene of each sample can be obtained. And calculating the arithmetic mean of the methylation rate of the CpG sites on each gene to obtain the methylation rate of the target gene in each sample DNA.

The Logistic regression analysis method is a multivariate analysis method for researching the relationship between the two-classification observation result and some influencing factors. And establishing a Logistic regression model according to a Logistic regression analysis method, wherein the predicted value of the Logistic regression model is 0-1, and the default discrimination value of the Logistic regression model is 0.5, namely more than or equal to 0.5 or less than 0.5. During the disease study, the quantitative relationship between the disease and each risk factor can be analyzed by Logistic regression analysis. In the embodiment of the invention, a Logistic regression model is established by a Logistic regression analysis method, so that whether a sample is a breast cancer sample or not is analyzed according to the methylation rate of a target gene in DNA of each sample. Similarly, in the embodiment of the present invention, the predicted value is determined as a default determination value of the Logistic regression model. And when the predicted value is greater than or equal to 0.5, judging the sample as a breast cancer sample. And when the predicted value is less than 0.5, judging the sample as normal mammary tissue.

The embodiment of the invention also provides another biomarker combination, wherein the biomarker combination is designed as qPCR (Quantitative polymerase chain Reaction) primers according to the coding regions of the telomere genes RAD50, RTEL, TERC and/or TRF1, and four groups of qPCR primers are used alone or in combination to form a qPCR primer combination. The qPCR primer combination is based on RNA (Ribonucleic Acid), and can detect the expression level of a target gene. The GAPDH gene, called housekeeping gene, is expressed at a high level in almost all tissues, and the amount of protein expression in the same cell or tissue is generally constant, and thus is widely used as a standardized reference for gene expression tests. In the present example, GAPDH gene was also used as a normalization internal control. The sequences of qPCR primers designed from the telomere genes RAD50, RTEL, TERC, and TRF1 and the sequence of the GAPDH gene are referenced in table 3.

Table 3: qPCR primer sequence and GAPDH gene sequence

Numbering	Name of Gene	Forward primer (5'-3')	Reverse primer (5'-3')
				1	RAD50	SEQ9	SEQ10
2	RTEL	SEQ11	SEQ12
				3	TERC	SEQ13	SEQ14
4	TRF1	SEQ15	SEQ16
				5	GAPDH	SEQ17	SEQ18

The embodiment of the invention also provides a kit for predicting breast cancer, which comprises a qPCR primer combination shown in Table 3. The kit can detect the expression level of the target gene for the same reason as the combination of the biomarkers provided in the embodiments of the present invention.

Further, the kit also comprises reverse transcriptase, enucleated water and PCR premix. Among them, reverse transcriptase is used to reverse-transcribe all RNAs into cDNA (complementary deoxyribose nucleic acid) to facilitate qPCR amplification reaction. The enucleated Water (nucleic-free Water) can prevent other nucleic acids from contaminating the cDNA in the examples of the present invention, which affects the test results. The PCR premix is a basic solution of a PCR reaction system, and in the embodiment of the invention, 5 mu l of 2xSYBR Green PCR master mix is selected as the PCR premix.

The embodiment of the invention also provides a method for detecting the expression level of the target gene position of the RNA fragment in the RNA sample, which comprises the following steps:

s201: the total RNA of the sample is reverse transcribed into cDNA.

Total RNA in the tissue sample is extracted and reverse transcribed into cDNA using reverse transcriptase.

S202: the cDNA, the reference gene, the qPCR primer combination, the enucleated enzyme water and the PCR premix constitute a reaction system.

And 2 mu L of cDNA, 1 mu L of reference gene, a qPCR primer combination, 2 mu L of enucleated enzyme water and 5 mu L of PCR premixed solution form a reaction system, wherein the using amount of each group of qPCR primers in the qPCR primer combination is 1 mu L, and the concentration is 2 mu m/L.

S203: the reaction system qPCR is amplified to obtain a qPCR amplification product, and the qPCR amplification product is detected by a sequencing system to obtain a cycle threshold of the reference gene and a cycle threshold of a target gene in the cDNA;

and (5) carrying out qPCR amplification on the reaction system to obtain a qPCR amplification product. Wherein the amplification conditions of qPCR amplification are as follows: the temperature at 95 ℃ for 10 minutes, 95 ℃ denaturation for 15 seconds, 60 ℃ annealing for 30 seconds, 72 ℃ extension for 60 seconds, for 40 cycles. The reaction system can obtain a Melting Curve (Melting Curve) in the process of qPCR amplification reaction, and the purity of the qPCR amplification product is analyzed through the Melting Curve. In addition, the cycle Threshold (Ct) of the reference gene and the cycle Threshold of the target gene in the cDNA can be known through the detection of a sequencing system.

S204: and determining the average cycle threshold of the target gene expression quantity according to the cycle threshold of the reference gene and the cycle threshold of the target gene in the cDNA.

And testing the same tissue sample in parallel for three times, and calculating the arithmetic mean of the three Ct values of the target gene and the arithmetic mean of the three Ct values of the reference gene. Subtracting the arithmetic mean of the Ct values of the reference gene from the arithmetic mean of the Ct values of the target gene enables determination of the mean Cycle threshold (dCt, delta value of Cycle threshold) of the expression level of the target gene.

In the present example, after determining the expression level of the target gene, it is also determined whether the sample is a breast cancer sample by Logistic regression analysis. The judgment of the predicted value is the default judgment value of the Logistic regression model.

The embodiment of the invention also provides a group of biomarker combinations, wherein the biomarkers comprise a methylation primer combination and a qPCR primer combination, and specific primer sequences of the methylation primer combination and the qPCR primer combination are not described herein again. The biomarker combination provided by the embodiment of the invention is designed according to the telomere gene with the most obvious methylation difference in the breast cancer tissue and the normal tissue, so that when a sample is detected to be breast cancer, the biomarker combination can specifically capture and amplify a specific DNA fragment in the sample to be detected, so that the detection sensitivity is improved, and the biomarker combination also has good noise resistance, flexibility and accuracy, has good repeatability, and can be applied to early prediction of the breast cancer, evaluation and detection of therapeutic drugs, prognosis and relapse detection and the like.

The embodiment of the invention also provides a kit for predicting breast cancer, which comprises a methylation primer combination and a qPCR primer combination. The kit can simultaneously detect the methylation level of the target gene and the expression level of the target gene for the same reason as the combination of the biomarkers provided by the embodiment of the invention. Further, according to the kit for predicting breast cancer comprising a methylation primer combination and the kit for predicting breast cancer comprising a qPCR primer combination provided by the embodiments of the present invention, the kit further comprises a sulfite, a TE buffer, a reaction premix, a first round PCR primer, a second round PCR primer, a reverse transcriptase, an enucleated water, and a PCR premix.

Based on the methods for detecting the methylation rate of the target gene position of a DNA fragment in a DNA sample and the method for detecting the expression level of the target gene position of an RNA fragment in an RNA sample provided by the embodiments of the present invention, the embodiments of the present invention provide a method for detecting the methylation rate of the target gene and the expression level of the target gene at the target gene position in a nucleic acid sample. The method provided by the embodiment of the invention comprises a method for detecting the methylation rate of the target gene position of the DNA fragment in the DNA sample and a method for detecting the expression level of the target gene position of the RNA fragment in the RNA sample, so as to simultaneously detect the methylation rate of the target gene and the expression level of the target gene, and further facilitate the analysis of whether the sample is a breast cancer sample.

The biomarker combination comprising the methylation primer combination, the biomarker combination comprising the qPCR primer combination and the biomarker combination simultaneously comprising the methylation primer combination and the qPCR primer combination provided by the embodiment of the invention can be used for preparing a reagent for predicting breast cancer so as to predict whether a tissue sample is a breast cancer sample. Furthermore, the combination of the three biomarkers can also be used for preparing a breast cancer treatment reagent so as to detect and analyze the treatment efficacy and treatment progress of breast cancer in the process of breast cancer treatment. Furthermore, the combination of the three biomarkers can be used for preparing a breast cancer recurrence detection reagent so as to monitor whether the breast cancer is recurrent or not at the later stage of breast cancer treatment.

The kit comprising the methylation primer combination, the kit comprising the qPCR primer combination and the kit comprising the methylation primer combination and the qPCR primer combination provided by the embodiment of the invention can be used for preparing a reagent for predicting breast cancer so as to predict whether a tissue sample is a breast cancer sample. Furthermore, the three kits can be used for preparing a breast cancer treatment reagent so as to detect and analyze the treatment efficacy and treatment process of breast cancer in the breast cancer treatment process. Furthermore, the three kits can be used for preparing a breast cancer recurrence detection reagent so as to monitor whether breast cancer recurs at the later stage of breast cancer treatment.

In order to evaluate the predicted effect of the three biomarker combinations in preparing the reagent for predicting breast cancer, the regression model determined by Logistic regression analysis is combined, and the predicted effect of the three biomarker combinations is evaluated through four evaluation indexes, namely, auc (area Under curve) values of Sensitivity (Sensitivity), Specificity (Specificity), Accuracy (Accuracy) and ROC (Receiver Operating characteristic curve) curves. The Sensitivity calculation formula is TP/(TP + FN), the Specificity calculation formula is TN/(TN + FP), and the Accuracy calculation formula is Accuracy (TP + TN)/(TP + FP + TN + FN), wherein TP-true positive; FP-false positive; TN-true negative; FN-false negative. The ROC curve is composed of 1-specificity on the horizontal axis and sensitivity on the vertical axis and can reflect the relative relationship of two model values when different classification thresholds are adopted. The ROC curve can be used for evaluating the prediction performance of different biomarker groups, and the area AUC under the ROC curve is used as a measurement value to evaluate the prediction performance of the gene set. When the prediction effect of the three biomarker combinations is evaluated, the index values of the four evaluation indexes are all between [0 and 1], and the higher the index value is, the better the model prediction effect of the regression model determined according to the biomarker combinations is.

The following describes the performance evaluation of the combination of three biomarkers provided by the embodiment of the present invention and the prediction of the effect of breast cancer.

114 breast cancer patients who did not receive chemotherapy or radiotherapy were selected for tumor tissue and normal breast tissue, wherein the tumor tissue and normal tissue account for half of the total. Methylation and expression level of the target gene were simultaneously detected in 114 tissue samples. The model label established for the biomarker combination comprising both the methylated primer combination and the qPCR primer combination is 1, the model label established for the biomarker combination comprising the methylated primer combination is 2, and the model label established for the biomarker combination comprising the qPCR primer combination is 3. During the methylation detection and expression level detection, CV Error of the regression model (cross validation Prediction Error) was calculated by Leave-one-out cross validation (LOOCV). The lower the CV error value, the more accurate the simulation representing the regression model, and the over-fitting phenomenon can be excluded. The results of the performance evaluation of the Logistic regression model for the target gene are shown in table 4, and the results of the performance evaluation are shown in fig. 1.

In the methylation detection stage, the samples have better uniformity, and the sequencing depth of the target gene meets the average sequencing depth of 319X required by analysis. By methylation sequencing, 87% of sequencing data are compared with the sequence position of a PCR amplification product. Greater than 97% of the sample sequencing data falls within two-fold of the average sequencing reading. The average methylation rate of 4 target genes in tumor tissues obtained according to the 4 groups of methylation primers is obviously higher than that of normal tissues, and the P value is 3.54E-35.

In the expression amount detection stage, the dCt value of the target gene in the tumor tissue is obviously higher than that of the normal tissue, namely, the expression of the target gene in the tumor tissue is lower than that in the normal tissue. Relative to methylation primers designed for telomere genes RAD50, RTEL, TERC and TRF1, the P values corrected by the Holm method are respectively 1.07E-13, 1.03E-5, 2.38E-14 and 3.14E-13. The results show that the methylation primers designed according to the telomere genes RAD50, RTEL, TERC and TRF1 have good tumor specificity.

Table 4: result value of performance evaluation of target gene Logistic regression model

Model (model)	CV error	Sensitivity of the composition	Specificity of	Accuracy of	AUC
						1	0.110	0.832	0.89	0.861	0.947
2	0.137	0.794	0.862	0.829	0.897
						3	0.170	0.738	0.761	0.750	0.846

As can be seen from Table 4, the regression models 1-3 all have values of four indexes of sensitivity, specificity, accuracy and AUC higher than 0.7, and the higher the specificity, the lower the false positive, and the higher the sensitivity, the lower the false negative, thereby indicating that the breast cancer samples can be well identified by singly adopting the methylated primer combination, the qPCR primer combination and the combination of the methylated primer combination and the qPCR primer combination. As can be seen from the attached figure 1, the random fluctuation degree of the curve is low, so that the repeatability and the noise resistance are better. Among the regression models 1-3, the regression model 1 has the highest values in all four indexes of sensitivity, specificity, accuracy and AUC, and the CV error value is the lowest, which is only 0.110. Therefore, the biomarker combination comprising the methylation primer combination and the qPCR primer combination can be used for more accurately predicting whether the sample is a breast cancer sample.

The biomarker combination provided by the embodiment of the invention is designed according to the telomere gene with the most obvious methylation difference in the breast cancer tissues and the normal tissues, so that when a sample is detected to be breast cancer, the biomarker combination can specifically capture and amplify a specific DNA fragment in the sample to be detected, so that the detection sensitivity is improved, and the biomarker combination also has good noise resistance, flexibility and accuracy, has good repeatability, and can be applied to early prediction of the breast cancer, evaluation and detection of therapeutic drugs, prognosis and relapse detection and the like. The method for predicting breast cancer provided by the invention is rapid in operation, simple and convenient, has better feasibility and prediction effect, has potential application in the fields of breast cancer risk assessment and the like, and has greater clinical value and potential significance.

Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure herein. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

It is to be understood that relational terms such as "first" and "second," and the like, may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. The invention is not limited to the precise arrangements described above and shown in the drawings, and various modifications and changes may be made without departing from the scope thereof. The scope of the invention is limited only by the appended claims.

SEQUENCE LISTING

<110> Hunan Shengwei Gene science and technology Co., Ltd

<120> biomarker combinations, kits and methods of use for predicting breast cancer

<130>2016

<160>18

<170>PatentIn version 3.3

<210>1

<211>29

<212>DNA

<213> Artificial sequence

<400>1

ttatatgtta tgtgattatt ggaaattat 29

<210>2

<211>25

<212>DNA

<213> Artificial sequence

<400>2

ttcccaaaac ttaatcctaa aactc 25

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<400>3

gggttgggtg ttagtgagtg t 21

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

caactcccat accccaaaaa 20

<210>5

<211>27

<212>DNA

<213> Artificial sequence

<400>5

aaaatttgta gagtaggaat taagttg 27

<210>6

<211>22

<212>DNA

<213> Artificial sequence

<400>6

ccccaaacct aactaactaa ac 22

<210>7

<211>24

<212>DNA

<213> Artificial sequence

<400>7

tagtagaata ggaattttgg gagt 24

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<400>8

aatacaacct taactaaaac 20

<210>9

<211>19

<212>DNA

<213> Artificial sequence

<400>9

tggatatgcg aggacgatg 19

<210>10

<211>19

<212>DNA

<213> Artificial sequence

<400>10

tgttggctca tccaaggca 19

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

catcgatgct gttgagctgc 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence

<400>12

ggatgatctg gtccagcgag 20

<210>13

<211>20

<212>DNA

<213> Artificial sequence

<400>13

catgtgtgag ccgagtcctg 20

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<400>14

gaagaggaac ggagcgagtc20

<210>15

<211>22

<212>DNA

<213> Artificial sequence

<400>15

gtctgcggta actgaatcct ca 22

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<400>16

ttgttgctgg gttccatgtt 20

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<400>17

cctctcccca gccaaagaag 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<400>18

tgaccctttt tggacttcag 20

<210>19

<211>33

<212>DNA

<213> Artificial sequence

<400>19

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210>20

<211>34

<212>DNA

<213> Artificial sequence

<400>20

gtctcgtggg ctcggagatg tgtataagag acag 34

<210>21

<211>62

<212>DNA

<213> Artificial sequence

<400>21

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60

ag 62

<210>22

<211>68

<212>DNA

<213> Artificial sequence

<400>22

caagcagaag acggcatacg agatgtatcg tcgtgtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210>23

<211>68

<212>DNA

<213> Artificial sequence

<400>23

caagcagaag acggcatacg agatgtgtat gcgtgtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210>24

<211>68

<212>DNA

<213> Artificial sequence

<400>24

caagcagaag acggcatacg agattgctcg tagtgtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210>25

<211>68

<212>DNA

<213> Artificial sequence

<400>25

caagcagaag acggcatacg agatgtcgtc gtctgtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210>26

<211>68

<212>DNA

<213> Artificial sequence

<400>26

caagcagaag acggcatacg agatgtgcgt gtgtgtctcg tgggctcgga gatgtgtata 60

agagacag 68

<210>27

<211>68

<212>DNA

<213> Artificial sequence

<400>27

caagcagaag acggcatacg agatgcgtcg tgtagtctcg tgggctcgga gatgtgtata 60

agagacag 68

Claims (7)

1. A biomarker panel for predicting breast cancer, wherein the panel is a methylated primer panel comprising:

designing a forward primer with a sequence of TTATATGTTATGTGATTATTGGAAATTAT and a reverse primer with a sequence of TTCCCAAAACTTAATCCTAAAACTC according to a telomere gene RAD 50;

designing a forward primer with the sequence of GGGTTGGGTGTTAGTGAGTGT and a reverse primer with the sequence of CAACTCCCATACCCCAAAAA according to the telomere gene RTEL;

designing a forward primer with a sequence of AAAATTTGTAGAGTAGGAATTAAGTTG and a reverse primer with a sequence of CCCCAAACCTAACTAACTAAAC according to the telomere gene TERC;

and, a forward primer with a sequence of TAGTAGAATAGGAATTTTGGGAGT and a reverse primer with a sequence of AATACAACCTTAACTAAAAC designed based on the telomere gene TRF 1.

2. A kit for predicting breast cancer, comprising the methylated primer combination of claim 1.

3. A biomarker combination for predicting breast cancer, wherein the combination is a qPCR primer combination comprising:

designing a forward primer with a sequence of TGGATATGCGAGGACGATG and a reverse primer with a sequence of TGTTGGCTCATCCAAGGCA according to a telomere gene RAD 50;

designing a forward primer with the sequence of CATCGATGCTGTTGAGCTGC and a reverse primer with the sequence of GGATGATCTGGTCCAGCGAG according to the telomere gene RTEL;

designing a forward primer with a sequence of CATGTGTGAGCCGAGTCCTG and a reverse primer with a sequence of GAAGAGGAACGGAGCGAGTC according to the telomere gene TERC;

designing a forward primer with a sequence of GTCTGCGGTAACTGAATCCTCA and a reverse primer with a sequence of TTGTTGCTGGGTTCCATGTT according to the telomere gene TRF 1;

and, a forward primer of sequence CCTCTCCCCAGCCAAAGAAG and a reverse primer of sequence TGACCCTTTTTGGACTTCAG designed based on the reference gene GAPDH.

4. A kit for predicting breast cancer, comprising a qPCR primer combination of claim 3.

5. A biomarker combination for predicting breast cancer, the combination comprising: the methylation primer combination of claim 1 and the qPCR primer combination of claim 3.

6. A kit for predicting breast cancer, comprising the biomarker panel of claim 5.

7. Use of the biomarker combination according to claim 1, 3 or 5 for the preparation of a reagent for predicting breast cancer, a reagent for detecting breast cancer recurrence or a reagent for evaluating a drug for breast cancer treatment.

Images