CN106636379A - Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens - Google Patents
Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens Download PDFInfo
- Publication number
- CN106636379A CN106636379A CN201611111655.1A CN201611111655A CN106636379A CN 106636379 A CN106636379 A CN 106636379A CN 201611111655 A CN201611111655 A CN 201611111655A CN 106636379 A CN106636379 A CN 106636379A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- sequence
- detection method
- pseudomonas aeruginosa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting a plurality of types of pathogens. The triple PCR detection method comprises the following steps: firstly, screening conservative and specific genes with staphylococcus aureus, pseudomonas aeruginosa and klebsiella pneumonia and common genes for bacteria and taking the genes as target spots for PCR detection; synthesizing and amplifying specific primers corresponding to conservative sequences respectively; simultaneously putting four pairs of primers into the same PCR reaction system; and optimizing all items to establish the triple PCR detection method capable of simultaneously detecting staphylococcus aureus, pseudomonas aeruginosa and klebsiella pneumonia from excrement of living animals. Meanwhile, common primers for the bacteria, which are designed by 16Sr RNA (Ribonucleic Acid), are added into the reaction system and are used as internal quality control; and in a pathogen detection process, whether the reaction system is complete or not can be judged according to the condition of a common primer amplification band and the quality of a template added into an evaluation system can be judged. The detection method disclosed by the invention is rapid, sensitive, simple, accurate and non-invasive, and the requirements on detection personnel and the detection cost are reduced.
Description
Technical field
The present invention relates to a kind of PCR detection method of biological technical field, specifically one kind can simultaneously detect golden yellow Portugal
The triple PCR detection method of grape coccus, Pseudomonas aeruginosa and klebsiella pneumoniae.
Background technology
Existing national standard《Animal used as test microbiology grade and monitoring》To pathogen in GB 14922.2-2011
Detection method --- with it is traditional be separately cultured, based on biochemical identification, serum type analysis and special identification experiment.In clinical practice
In, staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae are the conditioned pathogens of zoonosis, and easily mixing sense
Dye.Traditional diagnostic techniques is such as separately cultured, immunological testing is wasted time and energy, and is unsuitable for clinical quick diagnosis, is also unsuitable for
The present situation of large-scale epidemiology survey.It is loaded down with trivial details to there is process in conventional method, time-consuming, and recall rate is low and the defect such as missing inspection.For
Meet the quick detection of the multiple pathogens of large sample, be badly in need of a kind of quick, multiplex PCR detection side that easy, accuracy rate is high
Method.
The content of the invention
It is an object of the invention to provide a kind of while detecting the triple PCR detection method of multiple pathogens, its step is simple
Single, detection is quick, and accuracy is high, it is easy to standardizes, overcomes the deficiencies in the prior art.
Idea of the invention is that such.With the successful application in fields such as clinical medicine of the nucleic acid Calibration Technology of PCR,
Set up the detection of multiplex PCR new technology to be possibly realized.Multiplex PCR（multiplex Polymerase Chain Reaction）It is
Improved on the basis of regular-PCR, multipair specific primer is added in a PCR reaction system, for multiple DNA profilings
Or the zones of different of same template amplifies the round pcr of multiple purpose fragments.It can simultaneously add in same PCR reaction systems
Enter the specific primer of multiple pathogens, enter performing PCR amplification, can be used to detect multiple pathogens or different shaped pathogen simultaneously.
Based on this, the present invention can just detect the target of three kinds of pathogen in sample in line with disposable detection, first from the text delivered
Gene and the bacterium of the conservative sequence with staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae are filtered out in offering
General gene, as the target spot of PCR detections, is respectively synthesized the specific primer of amplification correspondence conserved sequence, and 4 pairs of primers are same
When be placed in a PCR reaction system, by every optimization, set up directly disposable the three of three kinds of pathogen of detection from sample
Weight PCR detection method.The present invention is also improved by detection excrement and drawn materials, and further realizes quickly being examined using the triple PCR method
Survey the purpose of actual sample.
Specifically, the technical scheme that the present invention takes is as follows：
It is a kind of at the same detect multiple pathogens triple PCR detection method, comprise the following steps：
（1）Filter out the conservative sequence with staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae gene and
The general gene of bacterium, as the target spot of PCR detections, is respectively synthesized the specific primer of amplification correspondence conserved sequence；
（2）4 pairs of primers are placed in a PCR reaction system simultaneously, genes of interest fragment is amplified；
（3）By agarose gel electrophoresis Testing and appraisal pcr amplification product；Wherein, golden yellow Portugal is expanded
As shown in a of table 1, the sequence of downstream primer is as shown in the b of table 1 for the sequence of grape coccus upstream primer；On amplification Pseudomonas aeruginosa
As shown in the c of table 1, the sequence of downstream primer is as shown in the d of table 1 for the sequence of trip primer；Amplification klebsiella pneumoniae upstream primer
Sequence as shown in the e of table 1, the sequence of downstream primer is as shown in the f of table 1；The sequence such as g of table 1 of the general upstream primer of amplification bacterium
Shown, the sequence of downstream primer is as shown in the h of table 1.
Specifically it is shown in Table 1：
The primer sequence of table 1 and PCR primer
| Title | Primer sequence (5 ' -3 ') | Primer size |
| Staphylococcus aureus | ||
| a | CACCTGAAACAAAGCATCCTAA | 153bp |
| b | TATACGCTAAGCCACGTCCAT | |
| Pseudomonas aeruginosa | ||
| c | ATGATCGTACAAATTGGTCGG | 600bp |
| d | GTCATGAAACCGCCAGTC | |
| Klebsiella pneumoniae | ||
| e | TGGCCCGCGCCAGGGTTCGAAA | 368bp |
| f | GATGTCGTCATCGTTGATGCCCAG | |
| Universal primer | ||
| g | AGAGTTTGATCCTGGCTCAG | 520bp |
| h | GCGGCTGCTGCACG |
In the present invention, step（1）, because the annealing temperature to primer, fragment length etc. are required, finally select Staphylococcus aureus
The nuc genes of bacterium, the LasI genes of Pseudomonas aeruginosa, the PhoE genes of klebsiella pneumoniae, the general 16S rRNA bases of bacterium
Because designing specific primer.
In the present invention, step（2）, PCR reaction systems are 50 μ l, including：The μ l of Mix 25, the μ l of primer 6.5, golden yellow grape
The general upstream and downstream primer of coccus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium is respectively 1 μ l, 1 μ l, 1 μ l, 0.25 μ l, DNA
Each 1 μ l, remaining sterilized water is supplied；Reaction condition is：94 DEG C of min of denaturation 5；Into 94 DEG C of 30 s, 60 DEG C of 30s, 72 DEG C of 30s
Circulation, totally 30 circulation;72 DEG C extend eventually 7 min.
In the present invention, step（3）, PCR primer in 2.5% Ago-Gel, the min of 120 V electrophoresis 30.
In the present invention, first select artificial challenge's sample to verify system detectability before actually detected sample, then take to be detected
Sample excrement, extracts the DNA of tested pathogen, as template, carries out triple PCR detection, and overall process only needs 4h；And pass through
Detection excrement is improved draws materials, further up to the purpose using the noninvasive actual sample of the quick Non-invasive detection of triple PCR method.And
Conventional detection method needs culture medium inoculated, typically needs 24h to grow bacterium colony, and regenerationization inoculation, this process time is longer, and
It is high to the skill set requirements of testing staff.The more conventional method of the present invention shortens detection time, can further up to quick detection and
The purpose of standardized testing.
The present invention obtains following beneficial effect：
（1）Due to adding the bacterial universal primers designed by 16Sr rna genes in reaction system, as interior Quality Control, in pathogen
In detection can according to the situation of universal primer amplified band judge whether reaction system intact and evaluation system in the mould that adds
Plate quality.Therefore more conventional PCR and multi-PCR detection method, the triple PCR detection method of the present invention have it is quick, sensitive,
Easy, accurate the characteristics of, while reducing the requirement to testing staff, detection platform and testing cost, improve detection efficiency.
（2）Party's law system is improved by detection excrement and drawn materials, further up to quickly noninvasive using the triple PCR method
The purpose of detection actual sample.
Description of the drawings
Fig. 1 is that the general triple PCR system of staphylococcus aureus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium is drawn
The optimum results of thing concentration；Wherein：M is 100bp DNA Ladder；Staphylococcus aureus, Pseudomonas aeruginosa, kerekou pneumonia primary
Bacillus upstream and downstream primer is respectively 1 μ l, swimming lane 1-4：The general upstream and downstream primer of bacterium be respectively 1 μ l, 0.5 μ l, 0.25 μ l,
0.0125 μl。
Fig. 2 is that the general triple PCR system of staphylococcus aureus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium is moved back
The optimum results of fiery temperature；Wherein：M is 100bp DNA Ladder；Swimming lane 1：56℃；Swimming lane 2：58℃；Swimming lane 3：60℃；Swimming
Road 4：62℃.
Fig. 3 is general triple of staphylococcus aureus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium
The testing result of PCR artificial challenge's samples；Wherein：M is 100bp DNA Ladder；Swimming lane 1：Triple PCR positive control；
Swimming lane 2：Triple PCR negative control；Swimming lane 3,8：Excrement negative control；Swimming lane 4,9：Staphylococcus aureus；Swimming lane 5,10：It is green
Purulence bacillus；Swimming lane 6,11：Klebsiella pneumoniae；Swimming lane 7,12：The primary bar of staphylococcus aureus, Pseudomonas aeruginosa and kerekou pneumonia
Bacterium.
Fig. 4 is general triple of staphylococcus aureus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium
The testing result of PCR samples；Wherein：M is 100bp DNA Ladder；Swimming lane 1：Triple PCR positive control；Swimming lane 2：Three
Weight PCR negative controls；Swimming lane 3-12：The excrement of sample.
Specific embodiment
The present embodiment is implemented under premised on technical solution of the present invention, gives detailed embodiment and mistake
Journey, but protection scope of the present invention is not limited to following embodiments.
The triple PCR system annealing temperature of the staphylococcus aureus of embodiment 1, Pseudomonas aeruginosa and klebsiella pneumoniae
Optimization
（1）Sample pre-treatments
By the staphylococcus aureus of standard, Pseudomonas aeruginosa and klebsiella pneumoniae respectively in corresponding culture medium or nutrient solution
Middle culture, wherein staphylococcus aureus, Pseudomonas aeruginosa culture and klebsiella pneumoniae culture 24h, collect bacterium solution or bacterium colony
Extract corresponding DNA sample.
（2）DNA of bacteria is extracted
The present invention extracts DNA using bacterial genomes DNA extraction kit, and step is as follows：
Above-mentioned 3 kinds of pathogen bacterium solutions or bacterium colony are dissolved in into buffer solution GA, concussion suspends；
20 μ l Proteinase K solution are added, is mixed, add 220 μ l buffer solution GB, shake 15s, 70 DEG C of 10min, added
220 μ l absolute ethyl alcohols, fully shaking is mixed；
Solution and precipitation are all added in an adsorption column, 12000rpm centrifugation 30s abandon waste liquid；
To adsorption column plus 500 μ l buffer solution GD, 12000rpm centrifugation 30s, waste liquid is abandoned；
To adsorption column plus 600 μ l buffer solution PW, 12000rpm centrifugation 30s, waste liquid is abandoned；It is repeated once；
Collect precipitation, 30 μ l TE dissolvings.
（3）Multi-PRC reaction Establishing
In PCR reaction systems, especially in multi-PRC reaction system, primer concentration and annealing temperature be crucial impact because
Element.Primer concentration and annealing temperature in order to find suitable triple PCR system of the invention, is tested as follows：
The optimization of primer concentration：Reaction system：PCR reaction systems are 50 μ l, including：The μ l of Mix 25, Staphylococcus aureus
The general upstream and downstream primer of bacterium, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium is respectively 1 μ l, 1 μ l, 1 μ l, general upper of bacterium
Downstream primer is respectively 1 μ l, 0.5 μ l, 0.25 μ l, 0.0125 μ l, and each 1 μ l of DNA, remaining sterilized water is supplied, and reaction condition is：
94 DEG C of min of denaturation 5；Into 94 DEG C of 30 s, 60 DEG C of 30s, the circulation of 72 DEG C of 30s, totally 30 circulations;72 DEG C extend eventually 7
min.μ l are in 2.5% Ago-Gel for PCR primer 10, the min of 120 V electrophoresis 30.As a result as Fig. 1 shows that 3 swimming lanes are preferable.
The optimization of annealing temperature：PCR reaction systems are 50 μ l, including：The μ l of Mix 25, the μ l of primer 6.5（Golden yellow grape
The general upstream and downstream primer of coccus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium is respectively 1 μ l, 1 μ l, 1 μ l, 0.25 μ l）, DNA
Each 1 μ l, remaining sterilized water is supplied.Annealing temperature is only respectively set to 56 DEG C by reaction condition, and 58 DEG C, 60 DEG C, 62 DEG C, remaining is not
Become.As a result as Fig. 2 shows that 3 swimming lanes are preferable.
（4）As a result
PCR reaction systems are 50 μ l, including：The μ l of Mix 25, the μ l of primer 6.5, staphylococcus aureus, Pseudomonas aeruginosa, pneumonia gram
The primary bacillus of thunder and the general upstream and downstream primer of bacterium are respectively 1 μ l, 1 μ l, 1 μ l, 0.25 μ l, and each 1 μ l of DNA, remaining sterilized water is supplied,
Reaction condition：94 DEG C of min of denaturation 5；Into 94 DEG C of 30 s, 60 DEG C of 30s, the circulation of 72 DEG C of 30s, totally 30 circulations; 72℃
Extend 7 min eventually.
The inspection of the triple PCR artificial sample of the staphylococcus aureus of embodiment 2, Pseudomonas aeruginosa and klebsiella pneumoniae
Survey
（1）Sample pre-treatments
Take the sample excrement of animal to be detected.
（2）DNA of bacteria is extracted
With embodiment 1
（3）Multi-PRC reaction Establishing
PCR reaction systems are 50 μ l, including：The μ l of Mix 25, the μ l of primer 6.5, wherein, staphylococcus aureus, Pseudomonas aeruginosa, lung
Scorching klebsiella spp and the general upstream and downstream primer of bacterium are respectively 1 μ l, 1 μ l, 1 μ l, 0.25 μ l, and DNA is respectively the μ of positive control 3
L, the μ l of negative control 0, each 3 μ l of sample excrement, remaining sterilized water complements to 50 μ l.Reaction condition：94 DEG C of min of denaturation 5；Enter
Enter 94 DEG C of 30 s, 60 DEG C of 30s, the circulation of 72 DEG C of 30s, totally 30 circulations;72 DEG C extend eventually 7 min.The μ l of PCR primer 10 exist
In 2.5% Ago-Gel, the min of 120 V electrophoresis 30.
（4）As a result
The testing result of the triple PCR sample of staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae is as shown in Figure 3：1
Positive control；2 negative controls；3rd, the negative control of 8 excrement；4th, 9 staphylococcus aureus；5th, 10 Pseudomonas aeruginosa；6th, 11 pneumonia
Klebsiella spp；7th, 12 staphylococcus aureuses, Pseudomonas aeruginosa and klebsiella pneumoniae.Found out by result, the triple PCR inspection
Survey system can respectively detect staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae.
The detection of the triple PCR sample of the staphylococcus aureus of embodiment 3, Pseudomonas aeruginosa and klebsiella pneumoniae
（1）Sample pre-treatments
Take the sample excrement of living animal to be detected.
（2）DNA of bacteria is extracted
With embodiment 1
（3）Multi-PRC reaction Establishing
PCR reaction systems are 50 μ l, including：The μ l of Mix 25, the μ l of primer 6.5（Staphylococcus aureus, Pseudomonas aeruginosa, pneumonia gram
The primary bacillus of thunder and the general upstream and downstream primer of bacterium are respectively 1 μ l, 1 μ l, 1 μ l, 0.25 μ l）, DNA is respectively the μ l of positive control 3, cloudy
Property control 0 μ l, each 3 μ l of sample excrement, remaining sterilized water complements to 50 μ l.Reaction condition：94 DEG C of min of denaturation 5；Into 94
DEG C 30 s, 60 DEG C of 30s, the circulation of 72 DEG C of 30s, totally 30 circulations;72 DEG C extend eventually 7 min.μ l are 2.5% for PCR primer 10
In Ago-Gel, the min of 120 V electrophoresis 30.
(4) result
The testing result of the triple PCR sample of staphylococcus aureus, green pus and klebsiella pneumoniae is as shown in Figure 4：1 is positive
Control；2 negative controls；The excrement of 3-12 samples.Positive control and negative control are good, and 10 excrement are that Pseudomonas aeruginosa is positive, its
Remaining sample is detected as feminine gender, with the testing result of conventional method consistent.No. 10 amplified productions send sequence verification for the positive.
SEQUENCE LISTING
<110>Anticipate and Co., Ltd of medical test institute in Hebei
<120>A kind of triple PCR detection method that multiple pathogens can be simultaneously detected containing interior Quality Control
<130> 1
<160> 8
<170>PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Staphylococcus aureus
<400> 1
cacctgaaacaaagcatcct aa 22
<210> 2
<211> 21
<212> DNA
<213>Staphylococcus aureus
<400> 2
tatacgctaagccacgtcca t 21
<210> 3
<211> 21
<212> DNA
<213>Pseudomonas aeruginosa
<400> 3
atgatcgtacaaattggtcg g 21
<210> 4
<211> 18
<212> DNA
<213>Pseudomonas aeruginosa
<400> 4
gtcatgaaaccgccagtc 18
<210> 5
<211> 22
<212> DNA
<213>Klebsiella pneumoniae
<400> 5
tggcccgcgccagggttcga aa 22
<210> 6
<211> 24
<212> DNA
<213>Klebsiella pneumoniae
<400> 6
gatgtcgtcatcgttgatgcccag 24
<210> 7
<211> 20
<212> DNA
<213>Universal primer
<400> 7
agagtttgatcctggctcag 20
<210> 8
<211> 14
<212> DNA
<213>Universal primer
<400> 8
gcggctgctgcacg 14
Claims (4)
1. a kind of at the same detect multiple pathogens triple PCR detection method, it is characterised in that comprise the following steps：
（1）Filter out the conservative sequence with staphylococcus aureus, Pseudomonas aeruginosa and klebsiella pneumoniae gene and
The general gene of bacterium, as the target spot of PCR detections, is respectively synthesized the specific primer of amplification correspondence conserved sequence；
（2）4 pairs of primers are placed in a PCR reaction system simultaneously, genes of interest fragment is amplified；
（3）By agarose gel electrophoresis Testing and appraisal pcr amplification product；Wherein, staphylococcus aureus upstream primer is expanded
Sequence as shown in a of table 1, the sequence of downstream primer is as shown in the b of table 1；The sequence such as c of table 1 of amplification Pseudomonas aeruginosa upstream primer
Shown, the sequence of downstream primer is as shown in the d of table 1；Amplification klebsiella pneumoniae upstream primer sequence as shown in the e of table 1, under
The sequence of trip primer is as shown in the f of table 1；The sequence of the amplification general upstream primer of bacterium as shown in the g of table 1, the sequence of downstream primer
As shown in the h of table 1.
2. triple PCR detection method according to claim 1, it is characterised in that step（1）In,
The gene for filtering out is nuc genes, the LasI genes of Pseudomonas aeruginosa, the klebsiella pneumoniae of staphylococcus aureus
The general 16S rRNA genes of PhoE genes and bacterium.
3. triple PCR detection method according to claim 1, it is characterised in that step（2）In, PCR reaction systems are
50ml, including：Mix 25ml, primer 6.5ml, staphylococcus aureus, Pseudomonas aeruginosa, klebsiella pneumoniae and bacterium are general
Upstream and downstream primer is respectively 1ml, 1ml, 1ml, 0.25ml, and each 1ml of DNA, remaining sterilized water is supplied；Reaction condition is：94 DEG C pre-
The min of denaturation 5；Into 94 DEG C of 30 s, 60 DEG C of 30s, the circulation of 72 DEG C of 30s, totally 30 circulations;72 DEG C extend eventually 7 min.
4. triple PCR detection method according to claim 1, it is characterised in that step（3）In, PCR primer is in 2.5% fine jade
In sepharose, the min of 120 V electrophoresis 30.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611111655.1A CN106636379A (en) | 2016-12-06 | 2016-12-06 | Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611111655.1A CN106636379A (en) | 2016-12-06 | 2016-12-06 | Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636379A true CN106636379A (en) | 2017-05-10 |
Family
ID=58819527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611111655.1A Pending CN106636379A (en) | 2016-12-06 | 2016-12-06 | Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636379A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290119A (en) * | 2013-05-21 | 2013-09-11 | 南京师范大学 | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork |
| CN103667251A (en) * | 2012-09-03 | 2014-03-26 | 中国科学院上海生命科学研究院 | Method for detecting food-borne pathogenic bacteria at high throughput |
-
2016
- 2016-12-06 CN CN201611111655.1A patent/CN106636379A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667251A (en) * | 2012-09-03 | 2014-03-26 | 中国科学院上海生命科学研究院 | Method for detecting food-borne pathogenic bacteria at high throughput |
| CN103290119A (en) * | 2013-05-21 | 2013-09-11 | 南京师范大学 | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork |
Non-Patent Citations (4)
| Title |
|---|
| HOSSEINEAGHAMOLLAEI等: "Detection of Pseudomonas aeruginosa by a triplex polymerase chain reaction assay based on lasI/R and gyrB genes", 《JOURNAL OF INFECTION AND PUBLIC HEALTH》 * |
| 冯洁等: "3种条件性致病菌三重PCR检测方法的建立及初步应用", 《中国畜牧兽医》 * |
| 王鹏飞: "实验动物金黄色葡萄球菌、绿脓杆菌和肺支原体多重PCR检测方法的建立与初步应用", 《万方学位论文数据库》 * |
| 钟磊等: "多重聚合酶链反应检测儿童常见下呼吸道感染细菌", 《中华医院感染学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104862420B (en) | RPA Sidestream chromatographies detect primer, probe and the kit of foot and mouth disease virus aerosol | |
| CN105671197B (en) | A kind of detection method of food-borne pathogens Listeria monocytogenes | |
| RU2010144789A (en) | PROCESS AND METHOD FOR MONITORING GASTRICESTIC MICROFLORA | |
| CN104212901A (en) | Composition for detecting drug resistance of staphylococcus aureus | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| CN104263845B (en) | A kind of triple PCR method simultaneously detecting mycoplasma hyopneumoniae, pig pasteurella multocida and haemophilus parasuis | |
| CN103627812A (en) | Quadruple-PCR (polymerase chain reaction) quick detection kit for main pathogenic bacteria of cow mastitis | |
| JP5522820B2 (en) | Method for detecting pathogens of strawberry important diseases and primers for detection | |
| CN102154497A (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN106434935A (en) | Composition and method for identifying pasteurella multocida and/or haemophilus parasuis | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| CN103233078A (en) | Multi-gene detection method of Listeria monocytogenes based on quantum dot/graphene oxide nanometer platform | |
| CN103014174B (en) | MPS (Macoplasmal Pneumoniae of Swine) PCR (Polymerase Chain Reaction) diagnostic kit | |
| CN106520986A (en) | Quintuple PCR (polymerase chain reaction) detection method capable of detecting multiple pathogens simultaneously | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN110878337A (en) | Detection method of erysipelothrix rhusiopathiae, primers and probe thereof | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN106636379A (en) | Triple PCR (Polymerase Chain Reaction) detection method for simultaneously detecting plurality of types of pathogens | |
| CN102605069B (en) | Enterohemorrhagic Escherichia coli O104: H4 detection kit and use method thereof | |
| CN103740822B (en) | Fluorescence quantitative PCR (polymerase chain reaction) combined rapid detection kit and method for SPF (specific pathogen free) mice pathogenic bacteria nucleic acid | |
| CN102086475A (en) | Method for detecting drift treatment of target gene | |
| CN104313154A (en) | Double PCR (Polymerase Chain Reaction) method for simultaneously detecting mycoplasma hyopneumoniae and porcine pasteurella multocida | |
| CN105483211A (en) | Reagent for legionella pneumophila detection according to in-vitro nested loop-mediated isothermal amplification method and legionella pneumophila detection method | |
| CN105039516A (en) | Fluorescent PCR detection method for clostridium difficile toxin genes, as well as primer and kit of fluorescent PCR detection method | |
| KR101919190B1 (en) | 2 step analysis method of microorganism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170510 |