CN106636348A - Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method - Google Patents
Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method Download PDFInfo
- Publication number
- CN106636348A CN106636348A CN201610979995.XA CN201610979995A CN106636348A CN 106636348 A CN106636348 A CN 106636348A CN 201610979995 A CN201610979995 A CN 201610979995A CN 106636348 A CN106636348 A CN 106636348A
- Authority
- CN
- China
- Prior art keywords
- loop
- zymomonas mobilis
- mediated isothermal
- primer
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit, and a detection method. According to the zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, large scale genome analysis is carried out based on Bioinformatic Platform, four specific primers are designed based on glyceraldehyde-3-phosphate dehydrogenase gene gap of zymomonas mobilis, combination with LAMP technology is adopted, the rapid, sensitive, accurate detection method on zymomonas mobilis is established, and the rapid detection kit based on the detection method is established. Application of the zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit and the detection is capable of realizing visual inspection identification after reaction, no other analysis steps such as electrophoresis are needed, detection time is short, specificity is high, equipment requirement is low, operation is simple and convenient, and the zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit and the detection method can be used for rapid detection of zymomonas mobilis.
Description
Technical field
The present invention relates to a kind of utilize loop-mediated isothermal gene magnification（loop-mediated isothermal
Amplification of DNA, LAMP）Technology carries out the kit of bacterium sample quick detection, and in particular to a kind of motion fermentation list
Born of the same parents' collarium mediated constant temperature gene amplification fast detecting kit and detection method.
Background technology
In recent years as the quick continuous growth of population and industry has greatly accelerated energy resource consumption, the whole world is caused to face potential
Energy crisis.The continuous improvement of simultaneous fuel price and the drastically reduction of fossil fuel, this promotes the whole world and seek
Look for alternative regenerative resource.Wherein bio-fuel is considered as the topmost substitute of conventional fossil fuel.Bio-ethanol
It is a kind of regenerative resource, its process of consumption not only solves the problem of environmental pollution of traditional fuel, solves agriculture and forestry product
The huge pollution that brings to environment of leftover bits and pieces, and be also greatly reduced the cost for obtaining the mineral matter energy.Biological fermentation process
Production ethanol is widely used in some countries and regions, and Brazil produces 11,000,000 tons of fuel second every year using sugarcane as raw material
Alcohol；The U.S. then about produces every year more than 5,500,000 tons of alcohol fuel；China's bio-ethanol annual production at present is more than 300 ten thousand tons,
It is only second to Brazil, U.S. row third place in the world.
Zymomonas mobilis（Zymomonas mobilis,Zm）For the gramnegative bacterium of amphimicrobian, mainly lead to
Cross Entner-Doudoroff（ED）Approach metabolizable glucose, fructose and sucrose etc., its unique metabolic pathway and efficient second
Alcohol fermentation characteristic causes the bacterial strain to there is huge application potential in fields such as food, medicine, chemical industry and bioenergies, thus right
The research of zymomonas mobilis is also deepening continuously.What zymomonas mobilis had a high-yield quick converts glucose into second
Alcohol, can to tolerate high temperature, concentration of alcohol and sugared concentration, the non-growth for coupling and fermentation i.e. alcohol production process uncorrelated to growth etc.
Feature so as to which the application in terms of alcohol is produced especially is paid attention to.
There are various detection methods currently for zymomonas mobilis.Traditional Zengjing Granule method generally require 10 days with
On, the cycle is longer, and needs to use animal used as test, relatively costly；Immunology detection（Immunoassay, IA）It is a kind of root
According to antigen, the principle of antibody response, unknown antibody is detected or using known antibody test unknown antigen using known antigen
Technology, mainly including Enzyme-linked Immunosorbent Assay（ELISA）, radio-immunity（RIA）, reverse indirect blood coagulation（RPHA）With reverse breast
Gelling collection experiment（RPLA）Deng, such method cycle is short, great amount of samples is once can detect, and be not required to animal used as test, but it lacks
Point is the antibody that must have high-affinity；Real time fluorescence quantifying PCR method can be used in the detection of pathogen, but to instrument and equipment
It is higher with the requirement of the level professional technology of personnel, and complex operation, it is time-consuming longer, limit the popularization of the technology.
DNA circle mediated constant temperature nucleic acid amplification technology（LAMP）It is a kind of new constant temperature nucleic acid amplification method, this technology gram
The deficiency of conventional gene amplification method is taken, the amplification of nucleic acid can have been carried out under constant temperature, with simple, quick, cost
The advantages of low and high specificity, Site Detection is suitable to, there is preferable application.At present, motion fermentation list also it is not specifically designed for
The loop-mediated isothermal gene amplification fast detecting kit of born of the same parents bacterium and the related record of detection method.
The content of the invention
It is an object of the invention to provide a kind of accurate zymomonas mobilis loop-mediated isothermal gene of rapid sensitive expands
Increase quick detection kit and detection method.
The present invention is adopted the following technical scheme that for achieving the above object：Zymomonas mobilis loop-mediated isothermal gene magnification
Quick detection kit, it is characterised in that include：
（1）Reactant liquor 1：By 10mmol/L deoxynucleoside triphosphates, 10 × ThermoPol Buffer reaction buffers,
150mmol/L magnesium sulfate, 5mol/L glycine betaines and sterilizing distilled water composition；
（2）Reactant liquor 2：By in 10 μm of 1,10 μm of ol/L outer primers, 2,40 μm of ol/L outer primers ol/L inner primers 1 and 40 μm of ol/L
Primer 2 is constituted, and primer sequence is as follows：
Outer primer 1：GTGCAAGATGCGTTGGAAAC,
Outer primer 2：GGCGTTGATATCGTGATGGA,
Inner primer 1：GCGATGTTGATCGCACCGTTGT-CTTGTCATCTGCGGTCAGG,
Inner primer 2：AGCCGGAGCAGAAATCAGAACC-CGGGTATCTTCACCAACACC；
（3）8U/ μ L Bst archaeal dna polymerases；
（4）Developer：Mass concentration is 10% SYBR Green I fluorescent dyes；
Reactant liquor 1 is equivalent per the μ L of sample 19 in above-mentioned loop-mediated isothermal gene amplification fast detecting kit, consisting of：
The μ L of 10mmol/L deoxynucleoside triphosphates 4, μ L, 150mmol/L magnesium sulfate of 10 × ThermoPol Buffer reaction buffers 2.5
The μ L of 1 μ L, 5mol/L glycine betaine 5 and sterilizing μ L of distilled water 6.5；Reactant liquor 2 is equivalent per the μ L of sample 3, consisting of：Outside 10 μm of ol/L
The μ L of primer 1 0.5,10 μm of the μ L of ol/L outer primers 2 0.5,40 μm of μ L of ol/L inner primers 11 and 40 μm of μ L of ol/L inner primers 21.
The detection method of zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit of the present invention,
It is characterized in that concretely comprising the following steps：
Step（1）, extract the genomic DNA of measuring samples；
Step（2）, loop-mediated isothermal amplification reaction takes 2 μ L measuring samples DNA solutions, adds 19 μ L reactant liquors 1,3 μ L reactant liquors
2 and 1 μ L 8U/ μ L Bst archaeal dna polymerases, the reaction system for having configured are taken out after 65 DEG C of amplified reaction 50-70min and are treated
Inspection；
Step（3）, analyze and judge reaction result, 1 μ L developers are added in the reaction product, mix, 2min is stood, if reactant liquor
Shows green is the positive, and orange is then feminine gender.
Glyceraldehyde-3-phosphate dehydrogenase gene of the present invention according to zymomonas mobilisgapDevise four specificity
Primer, the gene order be zymomonas mobilis it is common, with ensure detect separate sources zymomonas mobilis can
By property.The present invention adopts LAMP technology, and for zymomonas mobilis the accurate detection method of rapid sensitive is established, and builds
For the quick detection kit of the method.Using the quick detection kit and detection method of the present invention, can lead to after the reaction
Cross and visually observe identification, without the need for other any analytical equipments such as electrophoresis, with detection time is short, high specificity, instrument and equipment will
The advantages of asking low and easy to operate, can be used for the quick detection of zymomonas mobilis.
Description of the drawings
Fig. 1 is the positive amplification result comparison diagram of different strains.
Specific embodiment
With reference to specific embodiment, the foundation and application to kit in the present invention and detection method is made furtherly
It is bright, but present disclosure is not limited in any form.
Embodiment 1
The foundation of zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit and detection method
Step（1）, the design of primer, the assembling of synthetic agent box
The present embodiment determines as follows for the primer sequence of detection：
Outer primer 1：GTGCAAGATGCGTTGGAAAC,
Outer primer 2：GGCGTTGATATCGTGATGGA,
Inner primer 1：GCGATGTTGATCGCACCGTTGT-CTTGTCATCTGCGGTCAGG,
Inner primer 2：AGCCGGAGCAGAAATCAGAACC-CGGGTATCTTCACCAACACC；
Zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit, the kit are designed on this basis
Including following reagent：
（1）Reactant liquor 1：By 10mmol/L deoxynucleoside triphosphates（dNTP）, 10 × ThermoPol Buffer reaction buffers,
150mmol/L magnesium sulfate（MgSO4）, 5 mol/L glycine betaines and sterilizing distilled water（ddH2O）Composition；
（2）Reactant liquor 2：By 10 μm of ol/L outer primers 1（F3）, 10 μm of ol/L outer primers 2（B3）, 40 μm of ol/L inner primers 1（FIP）
With 40 μm of ol/L inner primers 2（BIP）Composition；
（3）8U/ μ L Bst archaeal dna polymerases；
（4）Developer：Mass concentration is 10% SYBR Green I fluorescent dyes；
Reactant liquor 1 is equivalent per the μ L of sample 19 in above-mentioned loop-mediated isothermal gene amplification fast detecting kit, consisting of：
10mmol/L deoxynucleoside triphosphates（dNTP）4 μ L, 10 × ThermoPol Buffer reaction buffers 2.5 μ L, 150mmol/L
Magnesium sulfate（MgSO4）The μ L of 1 μ L, 5mol/L glycine betaine 5 and sterilizing distilled water（ddH2O）6.5μL；Reactant liquor 2 is equivalent per the μ L of sample 3,
Consisting of：10 μm of ol/L outer primers 1（F3）0.5 μ L, 10 μm of ol/L outer primers 2（B3）0.5 μ L, 40 μm of ol/L inner primers 1
（FIP）1 μ L and 40 μm of ol/L inner primers 2（BIP）1μL.
Step（2）, the preparation of measuring samples
Measuring samples genomic DNA is prepared using isolation kit method
Detection bacterial classification zymomonas mobilis（Zymomonas mobilis, Zm）From He'nan Normal University's microbe
The bacterial classification of Laboratories Accession.The bacterial genomes extracts kit produced using Beijing Tiangeng bio-engineering corporation extracts sample base
Because of a group DNA.
Step（3）, carry out loop-mediated isothermal amplification reaction
（1）2 μ L measuring samples DNA solutions are taken, 19 μ L reactant liquors 1,3 μ L reactant liquors 2 and 1 μ L 8U/ μ L Bst DNA polymerization is added
Enzyme；
（2）The reaction system for preparing is taken out into be checked after 65 DEG C of amplified reaction 50min.
Step（4）, analyze and judge reaction result
1 μ L developers being added in the reaction product, being mixed, stand 2min, visual color change, reactant liquor color is changed into green
Color, illustrates that bacterial strain to be checked is zymomonas mobilis.
Embodiment 2
Negative control
Step（1）, the design of primer, the assembling of synthetic agent box
The present embodiment determine for detection primer sequence with embodiment 1.
Zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit, the examination are designed on this basis
Agent box includes following reagent：
（1）Reactant liquor 1：By 10mmol/L deoxynucleoside triphosphates（dNTP）, 10 × ThermoPol Buffer reaction buffers,
150mmol/L magnesium sulfate（MgSO4）, 5mol/L glycine betaines and sterilizing distilled water（ddH2O）Composition；
（2）Reactant liquor 2：By 10 μm of ol/L outer primers 1（F3）, 10 μm of ol/L outer primers 2（B3）, 40 μm of ol/L inner primers 1（FIP）
With 40 μm of ol/L inner primers 2（BIP）Composition；
（3）8U/ μ L Bst archaeal dna polymerases；
（4）Developer：Mass concentration is 10% SYBR Green I fluorescent dyes；
Reactant liquor 1 is equivalent per the μ L of sample 19 in above-mentioned loop-mediated isothermal gene amplification fast detecting kit, consisting of：
10mmol/L deoxynucleoside triphosphates（dNTP）4 μ L, 10 × ThermoPol Buffer reaction buffers 2.5 μ L, 150mmol/L
Magnesium sulfate（MgSO4）The μ L of 1 μ L, 5mol/L glycine betaine 5 and sterilizing distilled water（ddH2O）6.5μL；Reactant liquor 2 is equivalent per the μ L of sample 3,
Consisting of：10 μm of ol/L outer primers 1（F3）0.5 μ L, 10 μm of ol/L outer primers 2（B3）0.5 μ L, 40 μm of ol/L inner primers 1
（FIP）1 μ L and 40 μm of ol/L inner primers 2（BIP）1μL.
Step（2）, the preparation of measuring samples
Measuring samples genomic DNA is prepared using isolation kit method
The bacterial genomes extracts kit produced using Beijing Tiangeng bio-engineering corporation extracts pseudomonas aeruginosa, green Wei
This Salmonella, Listeria monocytogenes, staphylococcus aureus, Escherichia coli, Klebsiella Pneumoniae and Salmonella
The genomic DNA of 7 kinds of bacteriums such as bacterium.
Step（3）, carry out loop-mediated isothermal amplification reaction
（1）2 μ L measuring samples DNA solutions are taken, 19 μ L reactant liquors 1,3 μ L reactant liquors 2,1 μ L 8U/ μ L Bst DNA polymerizations is added
Enzyme；
（2）The reaction system for preparing is taken out into be checked after 65 DEG C of amplified reaction 50min.
Step（4）, analyze and judge reaction result
1 μ L developers are added in the reaction product, is mixed, stand 2min, visual color change, if reactant liquor shows green
As positive, orange is then feminine gender.
As shown in figure 1, the reaction tube that numbering is 1-8 corresponds to respectively pseudomonas aeruginosa, zymomonas mobilis, green Wei
This Salmonella, Listeria monocytogenes, staphylococcus aureus, Escherichia coli, Klebsiella Pneumoniae and Salmonella
Bacterium.
Described embodiment 1 compares with each negative control group in embodiment 2, positive amplification result is produced in embodiment 1, such as
No. 2 reaction tubes in Fig. 1, and do not carrygapThe negative control bacterial strain of embodiment 2 of gene does not produce positive amplification result, such as Fig. 1
In No. 1,3-8 reaction tubes, so as to prove that this kit and detection method have stronger specificity, to not carryinggapGene
Other bacterial strains will not produce false positive results.
Have been shown and described above the general principle of the present invention, principal character and advantage, without departing from spirit of the invention and
On the premise of scope, the present invention also has various changes and modifications, and these changes and improvements both fall within claimed invention
Scope.
SEQUENCE LISTING
<110>He'nan Normal University
<120>Zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit and detection method
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
gtgcaagatg cgttggaaac 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
ggcgttgata tcgtgatgga 20
<210> 3
<211> 41
<212> DNA
<213>Artificial sequence
<400> 3
gcgatgttga tcgcaccgtt gtcttgtcat ctgcggtcagg 41
<210> 4
<211> 42
<212> DNA
<213>Artificial sequence
<400> 4
agccggagca gaaatcagaa cccgggtatc ttcaccaacacc 42
Claims (2)
1. zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit, it is characterised in that include：
（1）Reactant liquor 1：By 10mmol/L deoxynucleoside triphosphates, 10 × ThermoPol Buffer reaction buffers,
150mmol/L magnesium sulfate, 5mol/L glycine betaines and sterilizing distilled water composition；
（2）Reactant liquor 2：By in 10 μm of 1,10 μm of ol/L outer primers, 2,40 μm of ol/L outer primers ol/L inner primers 1 and 40 μm of ol/L
Primer 2 is constituted, and primer sequence is as follows：
Outer primer 1：GTGCAAGATGCGTTGGAAAC,
Outer primer 2：GGCGTTGATATCGTGATGGA,
Inner primer 1：GCGATGTTGATCGCACCGTTGT-CTTGTCATCTGCGGTCAGG,
Inner primer 2：AGCCGGAGCAGAAATCAGAACC-CGGGTATCTTCACCAACACC；
（3）8U/ μ L Bst archaeal dna polymerases；
（4）Developer：Mass concentration is 10% SYBR Green I fluorescent dyes；
Reactant liquor 1 is equivalent per the μ L of sample 19 in above-mentioned loop-mediated isothermal gene amplification fast detecting kit, consisting of：
The μ L of 10mmol/L deoxynucleoside triphosphates 4, μ L, 150mmol/L magnesium sulfate of 10 × ThermoPol Buffer reaction buffers 2.5
The μ L of 1 μ L, 5mol/L glycine betaine 5 and sterilizing μ L of distilled water 6.5；Reactant liquor 2 is equivalent per the μ L of sample 3, consisting of：Outside 10 μm of ol/L
The μ L of primer 1 0.5,10 μm of the μ L of ol/L outer primers 2 0.5,40 μm of μ L of ol/L inner primers 11 and 40 μm of μ L of ol/L inner primers 21.
2. the detection of the zymomonas mobilis loop-mediated isothermal gene amplification fast detecting kit described in a kind of claim 1
Method, it is characterised in that concretely comprise the following steps：
Step（1）, extract the genomic DNA of measuring samples；
Step（2）, loop-mediated isothermal amplification reaction takes 2 μ L measuring samples DNA solutions, adds 19 μ L reactant liquors 1,3 μ L reactant liquors
2 and 1 μ L 8U/ μ L Bst archaeal dna polymerases, the reaction system for having configured are taken out after 65 DEG C of amplified reaction 50-70min and are treated
Inspection；
Step（3）, analyze and judge reaction result, 1 μ L developers are added in the reaction product, mix, 2min is stood, if reactant liquor
Shows green is the positive, and orange is then feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610979995.XA CN106636348A (en) | 2016-11-08 | 2016-11-08 | Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610979995.XA CN106636348A (en) | 2016-11-08 | 2016-11-08 | Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636348A true CN106636348A (en) | 2017-05-10 |
Family
ID=58806058
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610979995.XA Pending CN106636348A (en) | 2016-11-08 | 2016-11-08 | Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636348A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1633500A (en) * | 2002-02-20 | 2005-06-29 | 希森美康株式会社 | Primers for nucleic acid amplification in detecting housekeeping gene mRNA and test method using these primers |
| CN104561263A (en) * | 2014-11-24 | 2015-04-29 | 河南师范大学 | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification |
-
2016
- 2016-11-08 CN CN201610979995.XA patent/CN106636348A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1633500A (en) * | 2002-02-20 | 2005-06-29 | 希森美康株式会社 | Primers for nucleic acid amplification in detecting housekeeping gene mRNA and test method using these primers |
| CN104561263A (en) * | 2014-11-24 | 2015-04-29 | 河南师范大学 | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification |
Non-Patent Citations (4)
| Title |
|---|
| T. CONWAY ET AL: "Glyceraldehyde-3-Phosphate Dehydrogenase Gene from Zymomonas mobilis: Cloning, Sequencing, and Identification of Promoter Region", 《JOURNAL OF BACTERIOLOGY》 * |
| TSUGUNORI NOTOMI ET AL: "Loop-mediated isothermal amplification of DNA", 《NUCLEIC ACIDS RESEARCH》 * |
| 吴瑞 等: "《生物工程新进展》", 31 October 1985, 科学技术文献出版社 * |
| 李莉 等: "水产动物气单胞菌鉴定方法研究进展", 《水产科学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Past, present and future applications of flow cytometry in aquatic microbiology | |
| Garcia-Bernalt Diego et al. | AS imple, A ffordable, R apid, S tabilized, Co lorimetric, V ersatile RT-LAMP Assay to Detect SARS-CoV-2 | |
| Li et al. | Immunocapture magnetic beads enhanced the LAMP-CRISPR/Cas12a method for the sensitive, specific, and visual detection of Campylobacter jejuni | |
| CN103436608B (en) | Rapid detection method based on nucleic acid aptamers and kit | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| Loukas et al. | Detection and quantification of the toxic microalgae Karenia brevis using lab on a chip mRNA sequence-based amplification | |
| CN103882105A (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| CN115786582A (en) | Method and kit for detecting monkeypox virus by combining CRISPR/Cas12a and RPA and preparation method thereof | |
| CN102912037B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection method for transmissible gastroenteritis of swine TGE | |
| CN101570780A (en) | Detection kit and detection method for brucellae in meat products | |
| Zhang et al. | A naked-eye visual reverse transcription loop-mediated isothermal amplification with sharp color changes for potential pen-side test of foot-and-mouth disease virus | |
| CN103146841B (en) | Kit capable of synchronously detecting eighteen kinds of fever with eruption pathogens and detection method thereof | |
| CN102994650B (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| CN108277290A (en) | The dry powdered LAMP quick detection kits of staphylococcus aureus | |
| CN104561263A (en) | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification | |
| CN106636348A (en) | Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method | |
| CN101974621B (en) | LAMP detection method for babesia bovis | |
| CN103740839B (en) | The botulinal universal test kit of fluorescence quantitative PCR detection and nondiagnostic detection method | |
| CN105331740A (en) | PCR-HRM primer and method for quickly distinguishing DHAV-1 from DHAV-3 | |
| CN102994649A (en) | Multi-gene detection method of rash pathogens based on capillary electrophoresis | |
| CN102643924B (en) | Primer group and kit for rapidly detecting Listeria monocytogenes by utilizing LAMP (Loop-mediated Isothermal Amplification) technology | |
| CN102643923B (en) | Primer group and kit for rapidly detecting Listeria monocytogenes by utilizing LAMP (Loop-mediated Isothermal Amplification) technology | |
| LU505160B1 (en) | Crrna and kit for detecting salmonella | |
| CN101768632A (en) | Method for detecting aspergillus by polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170510 |
|
| WD01 | Invention patent application deemed withdrawn after publication |