CN106636330A - Diagnosis and treatment of Alzheimer disease - Google Patents
Diagnosis and treatment of Alzheimer disease Download PDFInfo
- Publication number
- CN106636330A CN106636330A CN201610858835.XA CN201610858835A CN106636330A CN 106636330 A CN106636330 A CN 106636330A CN 201610858835 A CN201610858835 A CN 201610858835A CN 106636330 A CN106636330 A CN 106636330A
- Authority
- CN
- China
- Prior art keywords
- trem1
- mouse
- microglia
- app
- psen1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
Abstract
The invention discloses diagnosis and treatment methods of Alzheimer disease and a corresponding kit. Specifically, an expression level of TREM1 (Triggering Receptor Expressedon Myeloid 1) proteins directly influences a clearing-up capability of microglial cells on beta amyloid proteins, so that the beta amyloid proteins cannot be normally cleaned; and the TREM1 proteins can be used as diagnosis and treatment target spots of the Alzheimer disease.
Description
Technical field
The invention belongs to neuroscience field.In particular it relates to a kind of Alzheimer disease (Alzheimer ' s
Disease, AD) diagnosis and therapy target, and corresponding diagnosis, treatment method and related kit.
Background technology
AD is clinically modal nervous system degenerative disease, memory that it is in progress with progressive, visual space and is held
Row dysfunction is typical clinical manifestations[1].In recent years, with the quickening of aging degree, China AD patient populations significantly increase
Plus, thus bring very white elephant to patient, family and society[2].Up to now, the cause of disease is still not clear,
And without effective treatment means.
According to having studied, one of major pathologic features of AD be intracerebral accumulate a large amount of amyloid betas (Amyloid- β,
A β), and then a series of neurotoxicities are induced, ultimately result in cognition dysfunction[3].Therefore, A β are suitable one at this stage
Divide the AD main research target spots for the treatment of.A large amount of evidences show that brain tissue declines to the Scavenging activity of A β, is to cause course of disease early stage A β
The main cause of accumulation[4].Newly enter evidence prompting, after onset early stage removes the A β of AD model mice intracerebrals, the cognitive work(of mouse
Can recover, point out the progress that can delay the AD courses of disease for the early stage application of A β therapies[5]。
However, the shortage of AD early diagnosis means is using the maximum obstruction of such therapy.At present, carry out in AD patient
Brain Biopsy is more difficult, and passes through medical history and scale Evaluation Method diagnosis AD, its sensitiveness and specific and extremely limited.Cause
This, verifies a kind of more easy-operating, and the higher AD diagnostic methods of specificity and sensitiveness also become the task of top priority.
Summary of the invention
It is an object of the invention to provide a kind of early diagnosis and the method for treating AD.
Specifically, present invention firstly discovers that TREM1 albumen is an important ring in AD pathogenesis, it is thin in monokaryon-macrophage
Expression in born of the same parents' system is lowered and directly affects Scavenging activity of the system to A β, so as to cause A β to accumulate in intracerebral.One
In individual embodiment, the invention provides a kind of method of early diagnosis AD, its key point is in detection TREM1 outside Zhou Danhe
Expression.In a specific embodiment, detect TREM1 gene transcription levels to assess TREM1 by qRT-PCR
Expression.In another specific embodiment, by ELISA, Western blotting or ImmunohistochemistryMethods Methods direct detection
TREM1 protein expression levels.
Additionally, in another embodiment, the invention provides a kind of method for treating AD, its key point is to raise
TREM1 levels activate TREM1 paths to recover phagocytosis energy of the intracerebral monocytes/macrophages system (i.e. microglia) to A β
Power.In a specific embodiment, by proceeding to exogenous TREM1 genes to intracerebral microglia its expression is improved
Level.Its carrier can be plasmid, slow virus or other feasible nucleic acids.In another specific embodiment, to
The transcriptional control material that can improve TREM1 gene expression doses is introduced in body.In another specific embodiment, to
Intracerebral introduces predetermined substance with targeted activation TREM1 paths, and the predetermined substance can be agonistic antibody and its active tablet
The activator of section, Agonistic ligands or passage downstream molecule.
Description of the drawings
Fig. 1 .Trem1 can promote phagocytosis of the microglia of WT children mouse to A β.Under to understand fully physiological condition
TREM1 microglia swallow A β in effect, we using slow virus mechanism manipulate from WT children mouse in isolate it is primary
The expression of Trem1 in microglia.After transduction 72h, it is utilized respectively qRT-PCR and elisa technique confirms Trem1
The expression (a) of mRNA and the change of Trem1 protein levels (b).Afterwards, the isolated test for providing using Griciuc et al.
Method detects microglia to A β1-42Phagocytosis and degradation.C mouse primary microglia is placed in 5 μM of A β by ()1-42
Cultivate 6h.Using A β of the elisa technique to internalization1-42Quantity is detected (t=0h).D () then, will be remaining in culture medium
Aβ1-42Clear out, primary microglia is further cultivated into 6h so that A β1-42Fully degraded.Using elisa technique pair
Intracellular A β1-42Level is measured (t=6h).E () is by A β1-42Surplus (t=6h) and total A β1-42Internalization amount (t=0h)
Ratio be considered as A β1-42Degradation index.Degradation index is higher, represents degraded A β1-42Ability it is lower.Using single factor test variance point
Analysis and Tukey ' s post hoc inspections are analyzed to data.Block diagram represents average ± standard deviation (n=4, a formula three
Part), * P ＜ 0.05.
Fig. 2 .Trem1 can promote phagocytosis of the microglia of adult APP/PSEN1 mouse to A β.In order to enter one
Walk and confirm TREM1 under the related backgrounds of AD to the phagocytotic adjustment effects of A β, we manipulated for 7 monthly ages by slow virus mechanism
The expression of Trem1 in APP/PSEN1 mouse microglias.After transduction 72h, qRT-PCR and elisa technique card are utilized respectively
The expression (a) of real Trem1 mRNA and the change of Trem1 protein levels (b).Afterwards, provide using Griciuc et al.
Isolated test method detect microglia to A β1-42Phagocytosis and degradation.C () puts mouse primary microglia
In 5 μM of A β1-42Cultivate 6h.Using A β of the elisa technique to internalization1-42Quantity is detected (t=0h).D () then, will cultivate
Remaining A β in base1-42Clear out, primary microglia is further cultivated into 6h so that A β1-42Fully degraded.Utilize
Elisa technique is to intracellular A β1-42Level is measured (t=6h).E () is by A β1-42Surplus (t=6h) and total A β1-42It is interior
The ratio of change amount (t=0h) is considered as A β1-42Degradation index.Degradation index is higher, represents degraded A β1-42Ability it is lower.Using list
Analysis of variance and Tukey ' s post hoc inspections are analyzed to data.Block diagram represents average ± standard deviation (n=
4, triplicate), * P ＜ 0.05.
Fig. 3. knocking out Trem1 can promote A β europathologies in APP/PSEN1 mouse to occur.By containing the slow of Trem1shRNA
Virus or its control group slow virus inject the bilateral cerebral of 7 monthly age APP/PSEN1 mouse and the WT mouse matched with its age
In cortex and hippocampus.A () injects 2 months after, confirmed in APP/PSEN1 mouse brains in microglia by qRT-PCR
The change that the expression of Trem1mRNA occurs.B () injects 2 months after, confirmed by ELISA little in APP/PSEN1 mouse brains
The change that the expression of Trem1 albumen occurs in spongiocyte.C () represents and receives carrier, control group is viral or contains
The amyloid plaques photo of the APP/PSEN1 Cerebral Cortexes of the slow virus injection of Trem1shRNA.According to immuno-chemical method,
Amyloid plaques are detected using anti-amyloid beta antibodies.In these patches of × 200 basis of microscopic observation.Engineer's scale=200 μm.D () is in note
2 months are penetrated afterwards, using the A β of soluble in ELISA method detection APP/PSEN1 Cerebral Cortexes and insoluble form1-42。
E () is injecting 2 months afterwards, using soluble in ELISA method detection APP/PSEN1 Hippocampus of Mice and insoluble form
Aβ1-42.Data are analyzed by one-way analysis of variance and Tukey ' s post hoc inspections.Block diagram represents average
± standard deviation.Every group of n=12, * P ＜ 0.05.
Fig. 4. overexpression Trem1 can weaken A β Pathological levels in APP/PSEN1 mouse.By containing the slow of Trem1 cDNA
Virus or its control group slow virus inject the bilateral cerebral of 7 monthly age APP/PSEN1 mouse and the WT mouse matched with its age
In cortex and hippocampus.A () injects 2 months after, confirmed in APP/PSEN1 mouse brains in microglia by qRT-PCR
The change that the expression of Trem1mRNA occurs.B () injects 2 months after, confirmed by ELISA little in APP/PSEN1 mouse brains
The change that the expression of Trem1 albumen occurs in spongiocyte.C () represents and receives carrier, control group virus or contain Trem1
The amyloid plaques photo of the APP/PSEN1 Cerebral Cortexes of the slow virus injection of shRNA.According to immuno-chemical method, use
Anti-amyloid beta antibodies detect amyloid plaques.In these patches of × 200 basis of microscopic observation.Engineer's scale=200 μm.D () is in injection 2
After month, using the A β of soluble in ELISA method detection APP/PSEN1 Cerebral Cortexes and insoluble form1-42.E () exists
2 months are injected afterwards, using the A of soluble in ELISA method detection APP/PSEN1 Hippocampus of Mice and insoluble form
β1-42.Data are analyzed using one-way analysis of variance and Tukey ' s post hoc inspections.Block diagram represents average
± standard deviation.Every group of n=12, * P ＜ 0.05.
Fig. 5. expression Trem1 can save the spatial cognition infringement of the AD correlations of APP/PSEN1 mouse.Trem1 will be contained
The slow virus of cDNA or its control group slow virus inject 7 monthly age APP/PSEN1 mouse and the WT mouse that match with its age
In bilateral cerebral cortex and hippocampus.It is short to mouse using Y- maze tests detection Trem1 overexpression after slow virus is injected 2 months
The impact of phase spatial memory.In exposure period, mouse is placed on into " starting " arm end, and allows it freely to explore in 5 minutes
First arm section (being defined as " starting " arm) in Y- labyrinths and the second arm section (being defined as " other " arm).The stage, we will
Towards the entrance Basilar artery of the arm section of labyrinth the 3rd (being defined as " new " arm).We are calculated relative to " starting " arm, mouse
The time (a) spent in " other " arm region.Using single-sample t-test (compared with 50% chance, with red dotted line table
Show) or one-way analysis of variance and Tukey ' s post hoc inspection (group difference) data are analyzed.Afterwards, mouse quilt
It is transferred to from labyrinth in the cage of its inhabitation and treats upper 2min.In experimental stage, mouse is placed again into " starting " arm in labyrinth
It is interior.Meanwhile, " new " arm entrance is opened, and allows mouse that 1min is freely explored in labyrinth.B () is for experimental period, Wo Menji
An index of discrimination=[new arm time/(new arm time+other arm times)] × 100 are calculated.Using one-way analysis of variance and
Tukey ' s post hoc inspections are analyzed to data.Block diagram represents average ± standard deviation, * P ＜ 0.05.It is little putting to death
Last 5 days before mouse, are measured by Morris water maze tests to the spatial cognition function of mouse.C () represents test in 5 days
The swimming rate of middle each group.Data are analyzed using one-way analysis of variance and Tukey ' s post hoc inspections.(d) generation
Path of the table each group in water maze test.Using two factor duplicate measurements variance analyses and Bonferroni Multiple range tests
Inspection is analyzed to path length data.# is relative to control group WT mouse, P ＜ 0.05；* it is viral relative to control group is received
The APP/PSEN1 mouse of injection, P ＜ 0.05.E the appearance form of () exploratory experiment the data obtained is：Relative at other three
The time spent in quadrant (A.O.), mouse is in the time scale spent in target quadrant (Q1).Using independent samples t test
Data are analyzed.* relative to the time spent in other three quadrants (A.O.), P ＜ 0.05.Column diagram represents average
Number ± standard deviation.Every group of n=24.
Fig. 6. excitability Trem1 antibody activation Trem1 signal pathways can weaken APP/PSEN1 mouse intracerebral A β pathology and
Save its spatial cognition infringement.In order to be further characterized by protective effects of the TREM1 in AD progressive stages, we use osmotic minipumps
Pump continues 6 circumferential 7 monthly age APP/PSEN1 mouse brain diacele dorsal parts and pours into a kind of excitability Trem1 antibody to activate
Trem1 signal pathways.Afterwards, we determine impact of the activation of Trem1 signal pathways to A β pathology.A () utilizes ELISA method
The A β of soluble and insoluble form in detection APP/PSEN1 Cerebral Cortexes1-42.Using one-way analysis of variance and
Tukey ' s post hoc inspections are analyzed to data, every group of n=12 of P ＜ 0.05..B () utilizes ELISA method detection APP/
The A β of soluble and insoluble form in PSEN1 Hippocampus of Mice1-42.Using one-way analysis of variance and Tukey ' s post
Hoc inspections are analyzed to data, every group of n=12 of P ＜ 0.05..Then, the short-term sky of mouse is assessed using Y- maze tests
Between memory function.C (), for experimental period, we calculate an index of discrimination=[new arm time/(during new arm time+other arms
Between)] × 100.Using single-sample t-test (compared with 50% chance, being represented with red dotted line) or one-way analysis of variance and
Tukey ' s post hoc inspections (group difference) are analyzed to data, every group of n=24.D (), for experimental period, we calculate
One index of discrimination=[new arm time/(new arm time+other arm times)] × 100.Using one-way analysis of variance and
Tukey ' s post hoc inspections are analyzed to data.Block diagram represents average ± standard deviation, * P ＜ 0.05, every group of n=
24.Just put to death last 5 days before mouse, the spatial cognition function of mouse is measured by Morris water maze tests.(e)
Represent the swimming rate of each group in test in 5 days.Data are entered using one-way analysis of variance and Tukey ' s post hoc inspections
Row analysis, every group of n=24.F () represents path of each group in water maze test.Using two factor duplicate measurements variances point
Analysis and Bonferroni multiple comparative tests are analyzed to path length data.# is relative to control group WT mouse, P ＜
0.05；* relative to the APP/PSEN1 mouse for receiving control group virus injection, P ＜ 0.05, every group of n=24.(g) exploratory experiment institute
The appearance form of data is：Relative to the time spent in other three quadrants (A.O.), mouse is at target quadrant (Q1)
Interior spent time scale.Data are analyzed using independent samples t test.* relative in other three quadrants
(A.O.) time spent in, P ＜ 0.05.Column diagram represents average ± standard deviation.Every group of n=24.
Specific embodiment
The TREM1 of indication in the present invention, English full name is triggering receptor expressed on
Myeloid cells-1, i.e. 1 type myeloid cell trigger acceptor, be a kind of acceptor for being expressed in mononuclear macrophage surface, its with
Receptor tyrosine protein kinase is coupled, and then regulates and controls immune response.
The present invention is found that first the TREM1 on microglia film surface for microglia swallows the key rush of A β
Enter effect.Downward TREM1 expression directly result in microglia phagocytic activity decline, even if some A β formation speed simultaneously
Under the physiology situation do not accelerated, still A β can not be removed so that the latter accumulates in a large number in central nervous system, and then produces god
There is Alzheimer disease (AD) to a certain extent in Jing toxic actions, progress.Although the cause of disease of Alzheimer disease is very multiple
It is miscellaneous, it is difficult to single reason or inducement it is general in it, but if detection monocyte in TREM1 expressions significantly lower, this
The possible Ahl tribulus sea silent sickness of one situation has very strong association.
Meanwhile, the present invention is, it was also found that for the situation of A β accumulations, raising the expression of TREM1 or activating its path, energy
The ability that microglia swallows A β is enough significantly increased, accelerates the A β for removing accumulation, eliminate its toxic action to nervous system,
And the symptom for having occurred may be improved.Therefore, new discovery of the present invention TREM1 be Alzheimer disease diagnosis and
The target spot for the treatment of.
The expression of the detection TREM1 of indication of the present invention, refers to according to detection technique commonly used in the art, including but not
It is limited to qRT-PCR, ELISA, Western blotting, immunohistochemistry etc. method, detects the mRNA of TREM1 and/or the table of albumen
Can be designed, designed, or commercialization up to level, its specific primer/probe/antibody/conjugate etc..
The expression of the rise TREM1 of indication of the present invention, refers to by proceeding to TREM1 gene sheets to mononuclear macrophage
Body, or its upstream strong promoter is proceeded to, or corresponding transcription factor, or the factor for suppressing its expression is eliminated, or other can reach
To similar effect, known other means or scheme, the effect of TREM1 developed by molecule quantity increase is actually reached.At one
In specific embodiment, by realizing to live body intracerebral injection TREM1- carrier granulars, described carrier is preferably virus and carries
Body, more preferably slow virus carrier.
The activation TREM1 paths of indication of the present invention, refer to be lived by Agonistic ligands, agonistic antibody or model molecule
Change TREM1, and and then activation downstream signal transduction.The activation TREM1 paths of indication of the present invention, also including well known in the art
, downstream molecules of direct activation TREM1, such as DAP12 etc..
The experiment material of the present invention of embodiment 1 and method
Human subjects
This research follows Declaration of Helsinki and the examination ＆ approval of Ethics Committee of Jing Nanjing Medical University pass through.Research object is originated
In Nanjing No.1 Hospital is on-job and retired employee in healthy young people and the elderly, all participation objects are China of Han nationality
People, and each other without any genetic connection.Each participant endorsed written consent book.
Monocytic purifying and culture in human circulation blood
According to the described method of Zondler and its colleague[6], the isolated monocyte from human vein whole blood.Greatly
Body process is：Use(Sigma-Aldrich companies) instrument, using density gradient centrifugation and CD-14 positive magnetic
Pearl isolation technics (Miltenyi Biotec companies) realizes cell separation.Adding 10% hyclone (FBS) and 1% disk Buddhist nun
The settling flux of cell is carried out in the culture mediums of RPMI 1640 in XiLin/streptomysin (P/S).By immunocytochemistry control
Isolated monocytic purity.Then, by monocyte with 1 × 106The density of cell/mL is transferred in naked 96 orifice plate,
24 hours are placed in case functional analysis.
Animal
Applicant from Nanjing Medical University's Experimental Animal Center obtain male APP/PSEN1 transgenic mices and with its year
Wild type (WT) mouse that age matches.Whole research approach Jing Nanjing Medical University Animal Care and administration committee's approval.
All experiments that this research institute is carried out are observed NIH animal used as test and are shown loving care for and instruction suggestion.
The separation of mouse microglia
According to the previously described method of applicant[7], from wild type children's murine brain in 1 day postpartum little colloid is isolated
Cell.The purity of microglia is confirmed using immunocytochemistry method.
Applicant is to Bliederhaeuser and its method for colleague's description[8]After being finely tuned, using it from APP/
Microglia is isolated in PSEN1 adult mices and wild-type mice brain tissue.General procedure is：Mouse is by deep anaesthesia
Afterwards, Jing orifice of the stomach pours into the Ringer solution of ice.Mouse brain is shredded with scalpel, in 37 DEG C of temperature and 5%CO2The bar of concentration
Under part, brain tissue is placed in the enzyme solutions containing papain and is incubated 60min.Subsequently Hanks of the addition containing 20%FBS puts down
Weighing apparatus salting liquid (HBSS) carries out acid-base neutralization to enzyme solutions, and 4min is centrifuged under 200g (rotating speed).Toward the graininess being centrifuged out
Add HBSS solution of the 2ml containing 0.5mg/mlDNA enzymes to realize settling flux in thing again, and continue to be incubated 5min at room temperature.Profit
The pasteur pipet polished with Jing fire carries out light damage to brain tissue, and then 70 μm of cell sieves of Jing filter (Thermo Fisher
Scientific companies), and 4min is centrifuged under 200g (rotating speed).Then resulting granular substance is contained into 20% in 20mlSettling flux is realized in the HBBS isotonic solution of (Sigma-Aldrich companies).Carefully pure HBSS (20ml) is put
In the top of percoll layers, then 20min is centrifuged under 200g (rotating speed).Abandon the boundary containing myelin and cell fragment
Layer, will contain mixing spongiocyte group granular material be eluted with HBSS, and contain 10%FBS, 1%P/S, 1 ×
Acetonate, 1 × GlutaMAXTM (Thermo Fisher Scientific companies) and the carrier-free mouse of 5ng/mL
In the Du Shi improved culture mediums of restructuring granulocyte and macrophage colony stimulatory factor (GM-CSF, R＆D systems companies) again
Suspend.In 37 DEG C of temperature, 5%CO2Under concentration conditions, cell suspending liquid is transferred into 15cm2Many poly-1-lysine clad plates
Upper culture.A matrix was changed every 3 days until whole bottom surface is covered by one layer of cells.After spongiocyte layer is formed, little glue
Cell plastid can form one layer (with bottom) NA suspension cell layer.Applicant relatively easily can receive to these cells
Collection, transfer and further culture.After having collected suspension cell layer, microglia is placed in without being incubated 3 under conditions of GM-CSF
My god, then carry out transduce operation or functional analysis.The purity of collected microglia is entered using immunocytochemistry
Row confirms.
Aβ1-42Phagocytosis and Degrading experiment
Using the isolated test method of Griciuc et al. offers to monocyte or microglia to A β1-42Phagocytosis
It is measured with degradation capability[9].By the A β of person monocytic cell or mouse microglia with 5 μM1-42Common incubation 6h, utilizes
EUSA (ELISA) determines internalization A β1-42Quantity, to assess cell to A β1-42Phagocytosis.First by people
A β of the microglia of monocyte or mouse with 5 μM1-42Common incubation 6h, is then eluted down in cell with fresh medium
To be placed in without A β1-42Serum in continue cultivate 6h, to determine cell to A β1-42Degradation capability.Afterwards, using ELISA method
Determine intracellular A β1-42Remaining level.Use A β1-42The ratio of surplus and internalization total amount represent cell to A β1-42Degraded
Ability.Ratio is higher to mean cell to A β1-42Degradation capability it is lower.
The preparation of lentiviral particle
In order that microglia optionally overexpression Trem1 albumen, applicant utilizes existing method[10], construct
Can be with the slow virus carrier of encoding murine WT Trem1 cDNA (NM_021406.5) under myeloid differentiation CD11b promoter regulations
And control group virus.In order to knock out Trem1, applicant utilizes existing method[11], synthesize in slow virus carrier and opened using U6
Mover has cloned following short hairpin (Trem1：5 '-AATTCAAAAAAGACCAAGGGTTCT-3 ' and control sequence：5’-
TTCTCCGAACGTGTCACGT-3’).Slow virus carrier after purification is intracellular to 293FT with suit carrier cotransfection.48
Supernatant is collected after hour, then lentiviral particle concentration in supernatant 1: 100 is concentrated into using supercentrifugation, phosphoric acid is used
Salt buffer salt solution carries out suspension recovery.Virus titer is carried out using business titration ELISA kit (Takara Bio companies)
Determine, do not find exist in titre between the lentiviral particle containing Trem1 cDNA or Trem1 shRNA and its control group
Significant difference.
Microglia is transduceed
With regard to microglia transductive process, by microglia after purification with 4 × 105Cell/mL density plant in
On 24 orifice plates.Add lentiviral particle and 8 μ g/mL polybrenes in culture medium, and 90min is centrifuged.On removing immediately after transfection
Clear liquid is simultaneously substituted for the basal medium containing 10%FBS and 50% colloid culture supernatant (obtaining from culture medium before transfection).
After 72h, quantitative polyase chain reaction (qRT-PCR) and ELISA method are measured to transfection efficiency during utilization.
Lentiviral particle intracerebral injection
Injection process is followed " blind ", that is, be responsible for the technical staff of stereotaxis intracranial injection lentiviral particle to experimental group
Situation is ignorant.General procedure is：It is fixed on after the WT mouse anesthesias matched by age in July APP/PSEN1 and with its age
On stereotaxis crosshead (David Kopf Instruments companies).Using the 30- being connected with Hamilton syringe
Gauge micropipettes (Sigma-Aldrich companies) are by slow virus preparation (2 μ l) injection mouse per the Interhemispheric brain in side
Cortex (injection point at two) and hippocampus (injection point at).The stereotaxis coordinate of injection position starts to be followed successively by from bregma：(1)
Cerebral cortex：In front and back：- 0.3, middle outside：2, carry on the back veutro：- 1.5mm and in front and back：- 2, middle outside：1.2, carry on the back veutro：-
1.2mm；And (2) hippocampus：In front and back：-2；Middle outside：1.2；Back of the body veutro：-2mm.Complete injection 2 months after to knock out efficiency and
Trem1 overexpression situations are verified.
Ventricles of the brain interior antibody is conveyed
The operation that antibody is conveyed into the ventricles of the brain is completed according to existing method[12].By excitability Trem1 antibody (100 μ g,
catalog#：MAB1187-100, R＆D Systems companies) or its IgG2AIsotype control Ab (100 μ g, catalog#：
MAB006, R＆D Systems companies) settling flux in 200 μ L synthetic cerebrospinal fluids is added to, and inject Osmotic minipumps (model
2006, ALZET companies) in.With regard to the operation of pump transplanting：The WT matched by age in July APP/PSEN1 mouse and with its age
It is fixed on after mouse anesthesia on stereoscopic localized crosshead (David Kopf Instruments companies).Will by means of vinyl tube with
The connected brain perfusion cannula (ALZET companies) of osmotic pumps is transplanted into diacele dorsal part (bregma rear 0.5mm, under skull surface
Square 3mm).Subcutaneous position osmotic pumps being placed in simultaneously between the shoulder blade of mouse both sides.Afterwards in 6 time-of-weeks, with 0.15 μ L/h
Pump degree, persistently antibody is pumped into intracerebral.It is postoperative, operative incision is carefully sutured closing.In whole surgical procedure, do not observe
There is any neurotoxicity performance to mouse.
Y- labyrinths are tested
Last day before animal is condemned to death, the method according to describing before[10], Y- labyrinths have been carried out using " blind "
Test to assess the short-term spatial memory function of animal.In exposure period, mouse is placed on into " starting " arm end, and allow its
The first arm section (being defined as " starting " arm) and the second arm section that Y- labyrinths are freely explored in 5 minutes (is defined as " other "
Arm).The stage, will be towards the entrance Basilar artery of the arm section of labyrinth the 3rd (being defined as " new " arm).Afterwards, mouse is by from labyrinth
In be transferred to its inhabitation cage in treat 2min.In experimental stage, mouse is placed again into " starting " arm in labyrinth.Together
When, " new " arm entrance is opened, and allows mouse that 1rnin is freely explored in labyrinth.UtilizeTracing system
(Noldus Information Technology companies) records each mouse within two stages in each arm area in labyrinth
The time of interior cost.For exposure period, we calculate mouse and stay in the total time of " other " arm and stay in the total of " starting " arm
The ratio of time.For experimental period, we calculate an index of discrimination=[new arm time/(during new arm time+other arms
Between)] × 100.
Morris water mazes are tested
In last 6 days before animal used as test is put to death, according to preceding method[7], water maze examination has been carried out using " blind "
Test.The test training of 4 times/day of mouse was given in continuous 5 days.And record mouse from section start to find under water hide platform
Between route total length, while calculating the mean value of four tests time used.In last day, one is carried out to mouse
The exploratory experiment after platform is removed, and is utilizedTracing system (Noldus Information Technology
Company) record its swimming path.
QRT-PCR (real-time quantitative-polymerase chain reaction)
Extracted from person monocytic cell or mouse microglia using Trizol reagents and obtain total serum IgE.Utilize
PrimeScriptTMRT Master Mix (Takara Bio companies) make at the standard conditions the total serum IgE of equivalent take a turn for the worse
Record reaction.Then according to manufacturers instruction, using SYBR Green Premix Ex Taq (Takara Bio companies) and specific
Mouse primer (GAPDH forward direction chains：GGTGGTCTCCTCTGACTTCA, GAPDH reverse strand：TCCTTGGAGGCCATGTGGGC；
Gapdh forward direction chains：CAACAGCAACTCCCACTCTTC, Gapdh reverse strand：GGTCCAGGGTTTCTTACTCCTT；TREM1 is just
To chain：AGTGGGGAGGATCATACTAGAAGAC, TREM1 reverse strand：AGGCTGGTAGATCACACACTGATAC；Trem1 is just
To chain：TGCTGTGCGTGTTCTTTGTCT, Trem1 reverse strand：CTTCTGGCTGTTGGCATACTT；TREM2 forward direction chains：
CTATGACTCCATGAAGCA, TREM2 reverse strand：GATTCCGCAGCGTAATGG；Trem2 forward direction chains：
GACCTCTCCACCAGTTTCTCC, Trem2 reverse strand：TACATGACACCCTCAAGGACTG；TYROBP forward direction chains：
AGCGATTGCAGTTGCTC, TYROBP reverse strand：GTGATACGCTGTTTCCGGGT；Tyrobp forward direction chains：
CGTACAGGCCCAGAGTGAC, Tyrobp reverse strand：CACCAAGTCACCCAGAACAA) real-time quantitative-polymerase chain has been carried out
Reaction.
ELISA (enzyme linked immunosorbent assay (ELISA))
To determine level of the total length TREM family protein on cell membrane, collect human monocyte and the little colloid of mouse is thin
Born of the same parents, and according to the described method of Geumann and its colleague[13]It is extracted epicyte protein.According to the handbook that manufacturer provides, I
Using special ELISA kit (for mankind TREM1：catalog#：EHTREM1, Thermo Fisher
Scientific companies；For mouse Trem1：catalog#：EMTREM1, Thermo Fisher Scientific companies；It is right
In mankind TREM2：catalog#：MBS2022102, MyBioSource, Inc.；For mouse Trem2：catalog#：
MBS2023874, MyBioSource, Inc.) total length TREMs albumen is detected.
In order to assess intracellular A β1-42Level, we with reference to before method[7]Collect and cracked human monocyte
With mouse microglia.To detect intracerebral solubility and insolubility A β1-42Level, we under the conditions of 4 DEG C, using 10
The TBS (TBS) of the ethylenediamine tetra-acetic acid containing 5mM (EDTA) of volume, inhibitors of phosphatases, no
Protease inhibitor cocktail containing EDTA and 2mM 1,10- phenanthrolene are independently carried out to cerebral cortex and hippocampal tissue
Homogenize process.The homogenate for obtaining is centrifuged 1h at 4 DEG C under the conditions of 100,000g (rotating speeds).We are received to supernatant
Collect to determine soluble A β1-42Content.The particulate material for obtaining adds 70% formic acid, and (FA, the volume of formic acid used is equal to
The volume of the TBS homogenate for being centrifuged) make homogenize process.Sample is centrifuged 1h at 4 DEG C, under the conditions of 100,000g (rotating speeds) and receives
Collection supernatant.The supernatant containing FA is neutralized with 1Mtris alkali, gained sample is used for determining the content of insolubility A β 1-42.Root
Handbook is provided according to manufacturer, using A β 1-42 ELISA kits (Thermo Fisher Scientific companies) A β 1-42 are determined
Level.
Immunohistochemical analysis
We have prepared brain tissue slice so that immunohistochemical analysis are used at the method according to before[7].By brain tissue and mouse
The monoclonal antibody (Covance companies) of anti-A β is incubated together, is subsequently adding biotinylated goat anti-mouse igg antibody
(Zhongshan Golden Bridge companies).Immune response is detected using diaminobenzidine.Afterwards, will organize
Dehydration, film-making are placed in optical microphotograph Microscopic observation.Method according to describing before us[7], using " blind " to total starch
Sample protein level is measured.
Statistical analysis
Data analysis is carried out using GraphPad Prism 6 (GraphPad Software companies).Examined using single sample t
Test, independent samples t test or one-way analysis of variance (ANOVA) and Tukey ' s post hoc are checked between average
Difference is compared.For this hiding platform test of Morris water mazes, with two factor duplicate measurements variance analyses and
Bonferroni multiple comparative tests are analyzed to path length data.In this research, data representation form is：Average ±
Standard deviation.P ＜ 0.05 are considered as with statistical significance.
The Trem1 of embodiment 2 can adjust phagocytosis of the mouse microglia to A β
Used as the unique MNP of central nervous system (CNS), microglia participates in A β by phagocytosis activity
Removing.To understand fully that TREM1 swallows the effect in A β in microglia, we are manipulated from WT children mouse using slow virus mechanism
The expression of Trem1 in the microglia isolated.After transduction 72h, qRT-PCR and elisa technique are utilized respectively to Trem1
The change of the expression and Trem1 protein levels of mRNA is measured.Afterwards, the in vitro examination for providing using Griciuc et al.
Proved recipe method detects microglia to A β1-42Phagocytosis and degradation.Knocking out Trem1 causes WT children's mouse microglia internalizations
Aβ1-42Level declines 52% (P ＜ 0.05), and Trem1 overexpression causes microglia internalization A β1-42Level increase nearly 1.7
Again (P ＜ 0.05).It should be noted that：Manipulate Trem1 expressions and do not significantly affect WT children mouse microglias to A
β1-42Degradation index.
Research past according to this finds：APP/PSEN1 occurs significant AD Relevant phenotypes during 7 monthly age of mouse[7].Therefore, it is
Find more than further confirming under the related backgrounds of AD, we are by slow virus mechanism 7 monthly age APP/PSEN1 mouse of manipulation
The expression of Trem1 in microglia.After transduction 72h is completed, respectively using qRT-PCR and ELISA method to Trem1mRNA tables
It is measured up to changing with Trem1 protein levels.Knocking out Trem1 makes 7 monthly age APP/PSEN1 mouse microglia internalizations A
β1-42Level be remarkably decreased 46% (P ＜ 0.05).Conversely, Trem1 overexpression causes microglia internalization A β1-42Level increases
Plus nearly 1.5 times (P ＜ 0.05).However, manipulating the change of Trem1 expressions not to the little glue of 7 monthly age APP/PSEN1 mouse
Cell plastid is to A β1-42Degradation rate cause to significantly affect.
Embodiment 3 is in the progression of disease phase of APP/PSEN1 mouse, and expressions of the Trem1 on microglia is relative
It is stable.
Because TREM1 can promote the A β phagocytosis of microglia mediation under the conditions of AD, we reasonably make
Hypothesis below：TREM1 may play a crucial role in AD progress.In order to verify this it is assumed that we explore first APP/
PSEN1 mouse in Isosorbide-5-Nitrae, 7 and during 10 monthly age, the dynamic change of microglia Trem1 and its adapter protein Tyrobp levels.
During APP/PSEN1 mouse diseases are in progress, there is no significant changes (Trem1 mRNA in the expression of Trem1 or Tyrobp
Level：P=0.31；Trem1 protein levels：P=0.4；Tyrobp mRNA level in-sites：P=0.77).Meanwhile, we do not have found yet
APP/PSEN1 mouse and the WT mouse matched with its age exist on microglia Trem1 or Tyrobp expression
Any significant difference.
Embodiment 4 knocks out Trem1 can promote A β europathologies to occur
Further to explore effect of the TREM1 albumen in AD progress, we knocked out for 7 monthly ages using slow virus mechanism
In APP/PSEN1 mouse brains in microglia Trem1 expression, and observe its impact to A β pathology.Slow virus injection 2
After individual month, we confirm the table of Trem1 in microglia in APP/PSEN1 mouse brains by RT-PCR and ELISA method
Change up to there occurs to lower.Total amyioid levels rise after Trem1 is knocked out in APP/PSEN1 mouse brains
1.66 times.Additionally, knocking out Trem1 makes insolubility and solubility A β in APP/PSEN1 Cerebral Cortexes1-42Level difference
Dramatically increase 2.48 times (n=12, P ＜ 0.05) and 1.57 times (n=12, P ＜ 0.05).And, knocking out Trem1 makes APP/
Insolubility and solubility A β in PSEN1 mouse brain hippocampus1-42Level dramatically increase 1.89 times of (n=12, P ＜ respectively
0.05) with 1.58 times (n=12, P ＜ 0.05).Result above shows：Knocking out Trem1 can increase APP/PSEN1 mouse brains
A β Pathological levels, it means that TREM1 can as protective factors suppress AD progress.
The overexpression Trem1 of embodiment 5 can weaken A β pathology and save the related spatial cognition infringements of AD
To verify protective effects of the TREM1 in AD progress, we are to little colloid in 7 monthly age APP/PSEN1 mouse brains
The Trem1 of cell has carried out selective overexpression.After slow virus is injected 2 months, we are confirmed by RT-PCR and ELISA method
The expression of Trem1 in APP/PSEN1 mouse brain microglias there occurs that rise changes.
First, we observe impact of the Trem1 overexpression to brain A β Pathological levels.Trem1 overexpression makes big intracerebral
Total starch sample protein level have dropped 65.4%.Meanwhile, Trem1 overexpression is made respectively in APP/PSEN1 Cerebral Cortexes not
Soluble and solubility A β1-42Level have dropped 61.7% (n=12, P ＜ 0.05) and 32.5% (n=12, P ＜ 0.05).This
Outward, Trem1 overexpression makes respectively insolubility and solubility A β in APP/PSEN1 hippocampus of mice1-42Level have dropped 58% (n
=12, P ＜ 0.05) and 35.9% (n=12, P ＜ 0.05).
Next step, we have detected impact of the Trem1 overexpression to short-term spatial memory using Y- maze tests.In exposure
Phase, each group mouse is similar in the time that two arm regions spend, it is believed that each group mouse is identical to the exploration degree in labyrinth.In examination
Test the phase, it has been found that (reflection is relative " other arm regions ", and animal explores the preference of " new arm region " for " index of discrimination " of WT mouse
Tendency) it is more than 50% (n=24, P ＜ 0.05).When compared with WT mouse, exploration of the APP/PSEN1 mouse to " new arm region "
There is impaired (n=24 in tendency；Compare with 50%：P ＜ 0.05；Compare with WT mouse：P ＜ 0.05).And overexpression Trem1 can be with
This infringement (n=24 is reversed completely；Compare with 50% probability：P ＜ 0.05；With the APP/ for receiving the injection of control group slow virus
PSEN1 mouse are compared：P ＜ 0.05).It should be noted that injecting lentivirus operation does not affect two kinds of mouse in experimental period
Performance.Meanwhile, the overexpression of Trem1 is no on test performance in WT mouse affects.
Afterwards, in last 5 days before animal is put to death, we are tested using water maze test to animal.First,
We compare the swimming rate of two kinds of mouse, do not observe significant difference.Slow virus is injected or Trem1 overexpression is operated not
Swimming rate generation to two kinds of mouse (WT and APP/PSEN1 mouse) is significantly affected.These results guarantee that we exclude motivation
With the interference of sensorimotor factors on test performance.Next we test the space of animal using a hiding platform test
Learning functionality.As fig 5d：In from the 2nd to the 5th day time, WT mouse find the distance swum across position of platform and are intended to ratio
APP/PSEN1 mouse are short (the 2nd day：8.45±1.03vs.9.14±1.04m；3rd day：7.52±0.98vs.8.96±
0.84m；4th day：6.05±0.42vs.8.11±0.57m；5th day：5.38±0.79vs.7.56±0.72m；N=24/ is every
Group, P ＜ 0.05).Two factor duplicate measurements variance analyses show：During whole task, the performance preferably (F of WT mousegenotype
(1,230)=148.8, P ＜ 0.05；Fdays(4,230)=173.9, P ＜ 0.05；Fgenotype×days(4,230)=15.59, P
＜ 0.05), the result confirms that September age APP/PSEN1 mouse show the infringement of spatial memory learning functionality really.Important
It is that Trem1 overexpression can save this functional lesion (F of APP/PSEN1 mousetreatment(1,230)=59.72, P ＜
0.05；Fdays(4,230)=85.07, P ＜ 0.05；Ftreatment×days(4,230)=7.49, P ＜ 0.05).It is noticeable
It is：Slow virus injection operation does not affect performance of two kinds of mouse in water maze test.Meanwhile, Trem1 overexpression is not also right
The test performance of WT mouse is produced and affects (Ftreatment(1,230)=2.27, n.s.；Fdays(4,230)=168.4, P ＜
0.05；Ftreatment×days(4,230)=0.95, n.s.).In order to detect impact of the Trem1 overexpression to spatial memory, we
Platform is removed under water, and it is upper once train off-test 24h after allow mouse to carry out space exploration test again.It is little with WT
Mouse shows conversely, APP/PSEN1 mouse are nearly identical in the exploration time that target quadrant and other any quadrants spend, meaning
Taste animal and occurs in that obvious spatial memory infringement.It is important that, it has been found that receive the APP/ of Trem1 slow virus injection
PSEN1 mouse will be long than other any quadrants in the time that target quadrant spends, and difference has statistical significance (n=24；
37.57 ± 1.38%vs.20.81 ± 0.46%；P ＜ 0.05), this shows that the spatial memory function of animal is restored.It is worth
It is noted that slow virus injection operation does not affect performance of two kinds of mouse in exploratory experiment.Simultaneously Trem1 overexpression is not yet
Affect the performance in test of WT mouse.
Embodiment 6 activates Trem1 signal paths by agonistic antibody can relax A β pathology and the cognition of AD correlation spaces
Infringement
In order to find to be transformed into clinically relevant background by more than, we continue 6 circumferential 7 monthly age APP/ using Osmotic minipumps
PSEN1 mouse brain diacele dorsal parts pour into a kind of excitability Trem1 antibody to activate Trem1 signal pathways.
First, we determine impact of the activation of Trem1 signal pathways to A β pathology.The note of excitability Trem1 antibody
Enter to make non-solubility and solubility A β in APP/PSEN1 Cerebral Cortexes1-42Level significantly reduce 31.4% (n respectively
=12, P ＜ 0.05) and 24.6% (n=12, P ＜ 0.05).Meanwhile, the injection of excitability Trem1 antibody makes APP/PSEN1 little
Non-solubility and solubility A β in mouse hippocampus1-42Level significantly reduce 6.1% and 22.6% (n=12, P ＜ respectively
0.05)。
Next step, we have evaluated shadow of the activation of Trem1 signal pathways to short-term spatial memory using Y- maze tests
Ring.In exposure period, the time that each group mouse explores the cost of two arm regions is similar.In experimental period, APP/PSEN1 mouse present
" the new arm " for coming explores the impaired (n=24 of tendency；Compared with 50% probability：n.s.；Compared with WT mouse：P ＜ 0.05) can be swashed
Dynamic property Trem1 antibody saves (n=24；Compared with 50% probability：P ＜ 0.05；With the APP/ for receiving the injection of control group antibody
PSEN1 mouse are compared：P ＜ 0.05).It is pointed out that the transplanting of Osmotic minipumps is not to two kinds of mouse in experimental period
Performance produces impact.Meanwhile, performance of the WT mouse in experimental period is not also affected by excitability Trem1 antibody.
Hereafter animal execution before last 5 days, we are tested using Morris water maze tests to animal.WT
Osmotic minipumps graft procedure or excitability Trem1 antibody implant operation are not affected by with the swimming rate of APP/PSEN1 mouse
Significantly affect.We determine the space learning function of animal followed by hiding platform test.Excitability Trem1 antibody
Inject and successfully saved the impaired Spatial learning ability (F of APP/PSEN1 mousetreatment(1,230)=62.79, P ＜ 0.05；
Fdays(4,230)=103.4, P ＜ 0.05；Ftreatment×days(4,230)=4.02, P ＜ 0.05).It should be noted that miniature
The implant procedure of osmotic pumps does not affect performance of two kinds of mouse in platform test is hidden.Meanwhile, excitability Trem1 antibody
Injection does not produce any impact (F to the performance of WT mouse test phasestreatment(1,230)=0.18, n.s.；Fdays(4,
230)=203, P ＜ 0.05；Ftreatment×days(4,230)=2.31, n.s.).In order to detect the activation of Trem1 signal paths
Impact to spatial memory, we by platform remove and it is last training off-test after 24h allow mouse to carry out space spy again
Rope is tested.Receive time that the APP/PSEN1 mouse of the injection of excitability Trem1 antibody are spent in target quadrant than other
What quadrant is long, and difference has statistical significance (Ftreatment(1,230)=0.18, n.s.；Fdays(4,230)=203, P ＜
0.05；Ftreatment×days(4,230)=2.31, n.s.), show that mouse spatial memory function is improved.It is noticeable
It is that the implantation of Osmotic minipumps does not affect performance of two kinds of mouse in exploratory experiment.Meanwhile, excitability Trem1 antibody
Injection does not affect on the performance of WT mouse test phases.
Bibliography：
1.Scheltens P, Blennow K, Breteler MM, et al.Alzheimer ' s disease.Lancet
2016.
2.Jiang T, Yu JT, Tian Y, et al.Epidemiology and Etiology of Alzheimer ' s
disease：From Genetic to Non-Genetic Factors.Curr Alzheimer Res 2013；10：852-
67.
3.Hardy J, Selkoe DJ.The amyloid hypothesis of Alzheimer ' s disease：
progress and problems on the road to therapeutics.Science 2002；297：353-6.
4.Mawuenyega KG, Sigurdson W, Ovod V, et al.Decreased clearance of CNS
beta-amyloid in Alzheimer′s disease.Science 2010；330：1774.
5.Jiang T, Yu JT, Zhu XC, et al.Temsirolimus promotes autophagic
clearance of amyloid-beta and provides protective effects in cellular and
animal models of Alzheimer′s disease.Pharmacol Res 2014；81：54-63.
6.Zondler L, Muller K, Khalaji S, et al.Peripheral monocytes are
functionally altered and invade the CNS in ALS patients.Acta Neuropathol
2016.
7.Jiang T, Tan L, Zhu XC, et al.Upregulation of TREM2 ameliorates
neuropathology and rescues spatial cognitive impairment in a transgenic mouse
model of Alzheimer′s disease.Neuropsychopharmacology 2014；39：2949-62.
8.Bliederhaeuser C, Grozdanov V, Speidel A, et al.Age-dependent defects
of alpha-synuclein oligomer uptake in microglia and monocytes.Acta
Neuropathol 2016；131：379-91.
9.Griciuc A, Serrano-Pozo A, Parrado AR, et al.Alzheimer ' s disease risk
gene CD33 inhibits microglial uptake of amyloid beta.Neuron 2013；78：631-43.
10.Jiang T, Zhang YD, Chen Q, et al.TREM2 modifies microglial phenotype
and provides neuroprotection in P301S tau transgenic mice.Neuropharmacology
2016；105：196-206.
11.Jiang T, Tan L, Zhu XC, et al.Silencing of TREM2 exacerbates tau
Pathology, neurodegenerative changes, and spatial learning deficits in P301S
tau transgenic mice.Neurobiol Aging 2015；36：3176-86.
12.Tan MS, Yu JT, Jiang T, et al.IL12/23 p40 inhibition ameliorates
Alzheimer′s disease-associated neuropathology and spatial memory in SAMP8
mice.J Alzheimers Dis 2014；38：633-46.
13.Geumann C, Gronborg M, Hellwig M, et al.A sandwich enzyme-linked
immunosorbent assay for the quantification of insoluble membrane and scaffold
proteins.Anal Biochem 2010；402：161-9.
Claims (8)
1. the reagent of specific detection TREM1 expression is in answering that preparation is used in the kit of diagnosis of alzheimer's disease
With.
2. application as claimed in claim 1, the wherein reagent of specific detection TREM1 expression is special selected from a) TREM1
Property primer and/or probe；Or b) TREM1 specific antibodies.
3. a kind of kit of diagnosis of alzheimer's disease, it includes the reagent of specific detection TREM1 expression.
The application of 4.TREM1 or its oligonucleotides coding in the medicine for preparing treatment Alzheimer disease.
Application of the activity part or activity antibody of 5.TREM1 in the medicine for preparing treatment Alzheimer disease.
6. the application described in any one of claim 4-5, it is characterised in that the medicine is formed sediment by strengthening microglia to β
The phagocytosis of powder sample albumen and treat Alzheimer disease.
7. it is a kind of that the drug regimen of Alzheimer disease is treated to the phagocytosis of amyloid beta by strengthening microglia
Thing, it is characterised in that the TREM1 comprising therapeutic dose or its oligonucleotides coding are used as active ingredient.
8. it is a kind of that the drug regimen of Alzheimer disease is treated to the phagocytosis of amyloid beta by strengthening microglia
Thing, it is characterised in that the activity part or activity antibody of the TREM1 comprising therapeutic dose is used as active ingredient.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858835.XA CN106636330B (en) | 2016-09-21 | 2016-09-21 | The diagnosis of Alzheimer disease and medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858835.XA CN106636330B (en) | 2016-09-21 | 2016-09-21 | The diagnosis of Alzheimer disease and medicine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636330A true CN106636330A (en) | 2017-05-10 |
| CN106636330B CN106636330B (en) | 2017-12-15 |
Family
ID=58854717
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610858835.XA Expired - Fee Related CN106636330B (en) | 2016-09-21 | 2016-09-21 | The diagnosis of Alzheimer disease and medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636330B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109646668A (en) * | 2019-01-04 | 2019-04-19 | 厦门大学 | A kind of polypeptide is used to prepare the purposes of prevention and treatment Alzheimer disease drugs |
| CN110726844A (en) * | 2018-07-17 | 2020-01-24 | 暨南大学 | siRNA targeting PSMC5 gene and application of PSMC5 |
| CN111157741A (en) * | 2019-12-30 | 2020-05-15 | 广州市妇女儿童医疗中心 | Application of myeloid cell trigger receptor 1 in preparation of gastritis diagnosis or treatment reagent and kit |
| WO2021091316A1 (en) * | 2019-11-07 | 2021-05-14 | 아밀로이드솔루션 주식회사 | Composition, comprising tmem176b or an expression or activity regulator thereof as an active ingredient, for prevention or treatment of degenerative brain disease |
| US11186636B2 (en) | 2017-04-21 | 2021-11-30 | Amgen Inc. | Anti-human TREM2 antibodies and uses thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013148316A1 (en) * | 2012-03-29 | 2013-10-03 | Biogen Idec Ma Inc. | Biomarkers for use in integrin therapy applications |
-
2016
- 2016-09-21 CN CN201610858835.XA patent/CN106636330B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013148316A1 (en) * | 2012-03-29 | 2013-10-03 | Biogen Idec Ma Inc. | Biomarkers for use in integrin therapy applications |
Non-Patent Citations (3)
| Title |
|---|
| REPLOGLE JM等: "《A TREM1 variant alters the accumulation of Alzheimer-related amyloid pathology》", 《ANN NEUROL》 * |
| 刘娜 等: "《髓样细胞触发受体-1 在疾病中的作用》", 《中国医药导报》 * |
| 朱江 等: "《髓样细胞表达的触发受体-1分子的功能与信号转导机制研究进展》", 《中国药业》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11186636B2 (en) | 2017-04-21 | 2021-11-30 | Amgen Inc. | Anti-human TREM2 antibodies and uses thereof |
| CN110726844A (en) * | 2018-07-17 | 2020-01-24 | 暨南大学 | siRNA targeting PSMC5 gene and application of PSMC5 |
| CN109646668A (en) * | 2019-01-04 | 2019-04-19 | 厦门大学 | A kind of polypeptide is used to prepare the purposes of prevention and treatment Alzheimer disease drugs |
| CN109646668B (en) * | 2019-01-04 | 2019-10-18 | 厦门大学 | A kind of polypeptide is used to prepare the purposes of prevention and treatment Alzheimer disease drugs |
| WO2021091316A1 (en) * | 2019-11-07 | 2021-05-14 | 아밀로이드솔루션 주식회사 | Composition, comprising tmem176b or an expression or activity regulator thereof as an active ingredient, for prevention or treatment of degenerative brain disease |
| KR20210055626A (en) * | 2019-11-07 | 2021-05-17 | 아밀로이드솔루션 주식회사 | Composition for preventing or treating neurodegenerative brain diseases comprising TMEM176B, its expression or activity modulator as an active ingredient |
| KR102531617B1 (en) | 2019-11-07 | 2023-05-12 | 아밀로이드솔루션 주식회사 | Composition for preventing or treating neurodegenerative brain diseases comprising TMEM176B, its expression or activity modulator as an active ingredient |
| CN111157741A (en) * | 2019-12-30 | 2020-05-15 | 广州市妇女儿童医疗中心 | Application of myeloid cell trigger receptor 1 in preparation of gastritis diagnosis or treatment reagent and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636330B (en) | 2017-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636330B (en) | The diagnosis of Alzheimer disease and medicine | |
| Wu et al. | Circular RNA TLK1 aggravates neuronal injury and neurological deficits after ischemic stroke via miR-335-3p/TIPARP | |
| Ni et al. | MicroRNA let-7c-5p protects against cerebral ischemia injury via mechanisms involving the inhibition of microglia activation | |
| Rong et al. | Amentoflavone affects epileptogenesis and exerts neuroprotective effects by inhibiting NLRP3 inflammasome | |
| Nishikawa et al. | Significance of glioma stem-like cells in the tumor periphery that express high levels of CD44 in tumor invasion, early progression, and poor prognosis in glioblastoma | |
| Man et al. | Sema3C promotes the survival and tumorigenicity of glioma stem cells through Rac1 activation | |
| Shibahara et al. | Pericyte-mediated tissue repair through PDGFRβ promotes peri-infarct astrogliosis, oligodendrogenesis, and functional recovery after acute ischemic stroke | |
| CN110049769A (en) | Treatment and mitochondria stress relevant disease method | |
| CN107012203B (en) | Application of PDCD4 as therapeutic target of antidepressant and/or anxiolytic drugs | |
| Qin et al. | Liver soluble epoxide hydrolase regulates behavioral and cellular effects of chronic stress | |
| CN106715695A (en) | Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions | |
| RU2720988C2 (en) | Gata-3 inhibitors for use in treating th2-induced asthma | |
| Di Lauro et al. | P2X7 receptor blockade reduces tau induced toxicity, therapeutic implications in tauopathies | |
| Zha et al. | NLRC3 inhibits MCT‐induced pulmonary hypertension in rats via attenuating PI3K activation | |
| Connolly et al. | Genetically engineered rat gliomas: PDGF-driven tumor initiation and progression in tv-a transgenic rats recreate key features of human brain cancer | |
| KR101718260B1 (en) | Combination therapy and method for assessing resistance to treatment | |
| Ren et al. | Linking cortical astrocytic neogenin deficiency to the development of Moyamoya disease–like vasculopathy | |
| Fu et al. | Identification of potential therapeutic and diagnostic characteristics of Alzheimer disease by targeting the miR-132-3p/FOXO3a-PPM1F axis in APP/PS1 mice | |
| Song et al. | Low-intensity pulsed ultrasound triggers a beneficial neuromodulation in dementia mice with chronic cerebral hypoperfusion via activation of hippocampal Fndc5/irisin signaling | |
| CN102921007B (en) | Method and reagent used for controlling insulin resistance and diabetes mellitus | |
| Sun | F-box and WD repeat domain-containing 7 (FBXW7) mediates the hypoxia inducible factor-1α (HIF-1α)/vascular endothelial growth factor (VEGF) signaling pathway to affect hypoxic-ischemic brain damage in neonatal rats | |
| Liang et al. | The BACE1-specific DNA aptamer A1 rescues amyloid-β pathology and behavioral deficits in a mouse model of Alzheimer's disease | |
| Liu et al. | Bruton’s tyrosine kinase-bearing B cells and microglia in neuromyelitis optica spectrum disorder | |
| Zhou et al. | MKI67 as a potential diagnostic biomarker in pulmonary hypertension | |
| CN109385475B (en) | Product for evaluating effect of propranolol on treating infantile hemangioma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171215 Termination date: 20180921 |