CN106636243A - Method for preparing resveratrol oligomer from pichia pastoris - Google Patents
Method for preparing resveratrol oligomer from pichia pastoris Download PDFInfo
- Publication number
- CN106636243A CN106636243A CN201710009219.1A CN201710009219A CN106636243A CN 106636243 A CN106636243 A CN 106636243A CN 201710009219 A CN201710009219 A CN 201710009219A CN 106636243 A CN106636243 A CN 106636243A
- Authority
- CN
- China
- Prior art keywords
- ppu19
- resveratrol
- 4tts
- hydroxystilbene
- pichia pastoris
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for preparing a resveratrol oligomer from pichia pastoris. The method mainly comprises the following steps of constructing a pPU19 plasmid vector comprising a 4-hydroxystilbene peroxidase gene, transforming a recombinant plasmid expression carrier pPU19-4TTS into a Komagataella pastoris DSMZ 70382 pichia pastoris strain to obtain the pichia pastoris with expressed 4-hydroxystilbene peroxidase, preparing a fermentation product comprising the resveratrol oligomer, and separating the resveratrol oligomer. The pichia pastoris is applied for the first time, the 4-hydroxystilbene peroxidase gene, which is key to the production of the resveratrol oligomer, is transferred into the pichia pastoris through a genetic engineering method, and screening is conducted to obtain the high through-put expression 4-hydroxystilbene peroxidase pichia pastoris strain. The resveratrol oligomer is prepared through a microbiological fermentation method; and the purity of the resveratrol oligomer obtained through separation according to the method is 45-60%, wherein the rate of transforming resveratrol into the resveratrol oligomer is 35%-45%.
Description
Technical field
The present invention relates to genetic engineering and technical field of microbial fermentation, more particularly to a kind of to be prepared in vain using Pichia pastoris
The method of veratryl alcohol dimer extract.
Background technology
Resveratrol dimer (viniferins) is resveratrol by 4- hydroxystilbene peroxidase (4-
Trihydroxy-trans-stilbene) oxidation is formed；It is plant in adverse circumstances or suffers pathogen infection when institute
The phytoalexin of secretion；There is higher antioxygenic property than resveratrol, the product of free radical can be effectively removed and suppress
It is raw, while can also anti-lipid peroxidation and DNA losses；Hematoblastic activity can be improved and reach releive allergic symptom and anti-inflammatory
Effect.
Resveratrol dimer is present in grape leaf epidermis, berry pericarp and grape pip, and content is extremely low.Although take as
The methods such as ultraviolet irradiation, fungal infection, mechanical damage can stimulate the synthesis of resveratrol dimer, but effect on driving birds is not good.Currently
It is mainly chemical complete synthesizing process to the dimeric preparation method of resveratrol, has research to apply 1,1- diphenyl -2- trinitrobenzens
Hydrazine (DPPH) processes resveratrol, and synthesizing resveratrol dimer, yield is 15%, has the disadvantage that synthetic yield is low, and application is a large amount of
Strong and stimulating, poisonous DPPH, dangerous high, carrying capacity of environment weight；There is research application FeCl3Resveratrol is processed, white lamb's-quarters is obtained
Reed alcohol dimer, yield is 2.7%, has the disadvantage heavy metal accumulation, it is difficult to directly applied；There is research using resveratrol chemical oxygen
Change polymerization and produce resveratrol dimer, have the disadvantage complex process, accessory substance is more, and the Direction of Reaction is uncontrollable.
The method for preparing resveratrol dimer using Pichia pastoris is at home and abroad there is no at present, is not also had using complete red ferment
Relevant report of the matrix up to 4- hydroxystilbene peroxidase proteins.
The content of the invention
It is an object of the invention to provide a kind of method that employing Pichia pastoris prepares resveratrol dimer, to solve to work as
Front resveratrol dimer yields poorly, complex process, the problem that the Direction of Reaction is uncontrollable, carrying capacity of environment is heavy.
To solve above-mentioned technical problem, the present invention is employed the following technical solutions：One kind prepares white black false hellebore using Pichia pastoris
The dimeric method of alcohol, it is characterised in that comprise the steps：
1) structure of the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4-：Restriction enzyme is applied respectively
EcoP1 and EcoP15 digestion 4- hydroxystilbene peroxidase gene fragments and pPU19 plasmids, obtain the 4- hydroxystilbene mistakes after digestion
Oxide enzyme gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+)；Using T4 ligases by above-mentioned digestion products
It is attached, obtains recombinant plasmid pPU19-4TTS, is then expanded by PCR of pPU19 DNAs by round pcr and expand mould
The 4- hydroxystilbene peroxidase genes of plate, obtain the recombinant plasmid expression vector pPU19-4TTS after PCR amplifications；The 4- hydroxyls
The gene order of stilbene peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC；
2) the recombinant plasmid expression vector pPU19-4TTS after PCR is expanded by heat shock method is proceeded to deposit number and is
In 638632 Pichi strains of Komagataella pastoris DSMZ 70382, expression 4- hydroxystilbene peroxidating is obtained
The Pichia pastoris of thing enzyme, be named as Pichia pastoris pPU19 4TTS, its nucleotide sequence：
TCGCTGGTAATCCCGGCTTTTGCTGCTTACAAGCTTTACGGATTATTTCTAGGAGGTAGNCAATTATTGGGTGGTCG
CAGCAGTTTCAAAGAGGAGGAGCCAGCTTCTGGGTCAAAAGAAAAGGGACAGAGCAAGAGACAACAGAAACTAGAAA
AGAGAGGACAAAAGGTGAGATACAGATAGAATCTTTGCGAGTGAACCAAGGTAGCTGAAAAACATAACTTGCAAGGA
TGCTATTGGACAATTTTAGGTGATAAACTCGATTGCTATCACTGGGCTCTGCCACATGGAAGCTTTAGTGAGAAGAG
CTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAACGAA
TTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACATTCATT
TGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCACAGC
TCTTGCGCACTATTCGAGTCGTTTACTTTTTTTTTGGTTTTTGCTAGGCCTTCCATTACTTCTTTACTTCGTTAGTG
ACAAGTGACTTAAGGCCAATGTATTCTTGAATCAAAAGAAGGCTGTGTCAATTCCTAAGCCCTACTAGCTCTACTTT
CGGAGTGACCTACCGATAAGTTCGCATACGCGAATCTGGACCATTTTTATAATACCAAGTAGAAATTCAATAGCCAT
CTAGCTGTTTCTACATGATGACAGCCCATAACCATAAAGAAAACTGCAAACGATTGCTGAGCTTGTAGAGCGTCCAG
TAAGTAGCGCAATCTCCAGTGAGCAACGTAATATCATATTTTCTTCTCTCTCTTTCATTCTCCTCCGAGAATTACAG
AAGCATCATAGTAGTGTACCCACCAATGGTTGTGAGCGACTGCGCGATTCCATGGATGCTACTGAAACCAATGAATG
AAACTTGTCAAGTTTCCTCGCTTCCTTTTACATAACGGATCTTTTAACTTAGAAACAGTTTAGTAAAAGAAATTCAT
CAATACAATGGACGGAGGTAAGTCAGCTCTTTCAGCAAGGGAGCATGGAATCAGATTGGCAACGACTTCTGCGATTC
TTATTCTTCCGATTGATTCAACAGTAGATTTGCGAGTGGTTGGCCAAACACACAGTTTCGATGCGATCTCCGTTTGA
TTTGTATGAATACGCAGTCATCTCATTGGTGGAGCATTTTATACGGATTGATTGAGTGGAAGCATGGTACTGAGAGT
ATCTACATGTGCATTTCTGTTGGTTGTCCTCGGTTGAGTTTTCGTATCTGTTTGTCCCCCCAATTTTGTCCACTCCT
TTTGGCAATCTGCCGAATCCAAGCTCATAATACTAACTCCCATTTTAGAAGACGTTGCAGCAGTAAGTACCCTTACA
TGTAATCCATGAAAGCAAATGTGGCGCAGTCAATCGAAGTCACTGTCTGATTGATTCTTCCCTCAGTGGCGGT；
3) the Pichia pastoris that step (2) is obtained pPU19 4TTS bacterial strains by line and squamous subculture, Jing
Primary dcreening operation, secondary screening, carry out liquid training fermentation, choose the bacterium solution that metabolite content is high or activity is high and line solid screening and culturing medium
On, isolate and purify, obtain secondary screening bacterial classification；
4) tunning containing resveratrol dimer is prepared：The LB fermentation trainings of resveratrol of the configuration containing 15-20g/L
Foster base, from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in the shaking flask of LB culture mediums, fermentation, obtain
Tunning containing resveratrol dimer；
5) separation of resveratrol dimer：By fermentation product liquor Jing containing resveratrol dimer step (4) Suo Shu
Purifying resin, obtains solid and is resveratrol dimer extract.
Further, the condition of liquid training fermentation is in step (3)：37 DEG C of fermentation temperature, hunting speed 160r/min, pH is
7, fermentation time 24h.
The condition of shake flask fermentation is in step (4)：Temperature is 31-35 DEG C, hunting speed 180-220r/min, initial pH controls
System is controlled in 32-40h in 6-8, fermentation time.
The separation method of resveratrol dimer is specially in step (5)：By step 4) it is described containing resveratrol dimer
Fermentation product liquor Jing H103 types macroporous resin enrichment purifying, column internal diameter 4mm, height 1m, packed column volume is 2L, sample solution
Mass concentration is 0.7-0.8mg/mL, and loading flow velocity is 2-4BV/h, first with the distillation water washing of 3-5 times of column volume, Ran Houyong
The ethanol water wash-out of 8BV 75%, reclaims ethanol water and washes out liquid, and using Rotary Evaporators ethanol is removed, and obtains solid
As resveratrol dimer extract.
Preserving number of the present invention is that 638632 Pichi strains of Komagataella pastoris DSMZ 70382 are protected
It is hidden in NCBI (US National Biotechnology Information center).It is limited that 4- hydroxystilbene peroxidase is purchased from the abundant biotechnology of Hisense
Company；PPU19 plasmids are purchased from Australian pCambia companies；Restriction enzyme EcoP1 and EcoP15 enzyme is purchased from Shanghai, and this is safe
That bio tech ltd；T4 ligases are purchased from Thermo Fisher Scientific；Liquid training Zymolysis Equipment is purchased from Nanjing
Moist bioengineering equipment Co., Ltd, model RZY-XGX；Solid screening and culturing medium is purchased from Shanghai and breathes out the limited public affairs of clever biotechnology
Department；LB culture mediums are purchased from Sigma Aldrich；Resveratrol is bought in DSM (China) Co., Ltd；H103 type macropore trees
Fat is purchased from the great poly resin in Tianjin；Rotary Evaporators are Germany's Chinese mugwort card RV10 type Rotary Evaporators.
The present invention secreting, expressing 4- hydroxystilbene peroxidase in pichia yeast expression system first, successfully will affect
The 4- hydroxystilbenes peroxidase that resveratrol dimer is generated imports Komagataella pastoris DSMZ 70382 and finishes
Red yeast, acquisition can express the recombinant yeast pichia pastoris of 4- hydroxystilbene peroxidase.
First Application Pichia pastoris of the present invention, is possible to produce the key of resveratrol dimer by gene engineering research
4- hydroxystilbenes peroxidase gene imports Pichia pastoris, and screening obtains a kind of high flux expression 4- hydroxystilbenes peroxidase and finishes
Red barms.Pichia pastoris is selected to be because that Pichia pastoris gene expression system is eukaryotic expression system, and with regulation and control machine
The strict alcohol oxidase AOX gene promoters of reason；Expression is high, you can in intracellular expression, secretion type expression can be carried out again；
And zymotechnique is ripe, easy industrialized production；Toxigenic capacity is low, and product can be easily separated；Foreign protein gene genetic is stablized, and is difficult
Lose.Microbe fermentation method prepares resveratrol dimer, the method environmental protection of selection, weatherproof, low cost, product
Thing is controllable, and suitable industrialized production.
The isolated resveratrol dimer purity of Jing the inventive method is 45-60%, and wherein resveratrol conversion is white
The dimeric conversion ratio of veratryl alcohol is 35%-45%.Significantly larger than contemporary literature reported values, and operating procedure are simple, selection
Method environmental protection, weatherproof, low cost, product are controllable, and suitable industrialized production.
Description of the drawings
Fig. 1 is the agarose electrophoresis testing result figure of the Pichia pastoris for expressing 4- hydroxystilbene peroxidase genes.
Fig. 2 is the nucleotide sequence of the Pichia pastoris for expressing 4- hydroxystilbene peroxidase genes.
Specific embodiment
With reference to embodiments 1～5 pair of technical scheme disclosed by the invention is further described：
Embodiment 1：
The method for preparing resveratrol dimer extract using Pichia pastoris, comprises the following steps：
1) sterilizing centrifuge tube in add 1g 4- hydroxystilbene peroxidase genes, 2g pPU19 plasmid genes,
0.3mL Restriction Enzyme buffer solutions, 10U restriction enzyme EcoP1 and 10U EcoP15 and 100mL pure water, are carried out at 30 DEG C
Temperature bath 10min, Jing vortexs concussion 10s, under the rotating speed of 12000r/min, is centrifuged 2min, filters, and obtains containing the 4- hydroxyls after digestion
The mixed liquor of base stilbene peroxidase gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+).Wherein 4- hydroxystilbenes
The gene order of peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC。
2) in the centrifuge tube of sterilizing, 1 the step of add 5 μ L) the peroxidase gene fragment of hydroxystilbene containing 4- that obtains
The mixed liquor of 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+), the T4 ligases of 0.5 μ L, 1 μ L ligase buffer solutions, 5 μ
The ddH2O of L, then Jing vortex oscillations 1min, under the rotating speed of 12000r/min, after centrifugation 15s, are placed in 16 DEG C of water and were incubated
At night, the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4- are obtained final product, be placed in standby in 4 DEG C of refrigerator.
3) plasmid vector after restructuring is expanded by round pcr, in 95 DEG C of denaturations 5min, 1 circulation；94℃
Denaturation 40s, 57 DEG C of renaturation 40s, 35 circulations；72 DEG C of extension 2min, 72 DEG C of last extension 10min, that is, containing after being expanded
The pPU19 plasmid vectors of 4- hydroxystilbene peroxidase genes；
4) recombinant expression carrier pPU19-4TTS heat shock methods are proceeded into Komagataella pastoris DSMZ
In 70382 Pichia pastoris competent cells, by agarose electrophoresis testing result as shown in figure 1, nucleotide sequence such as Fig. 2,
4- hydroxystilbene peroxidase genes are detected at the 306bp of DNA molecular amount standard, the purpose band of digestion products is 234bp,
Meet the base number of digestion 4- hydroxystilbene peroxidase genes, it was demonstrated that restructuring Komagataella pastoris DSMZ
70382 Pichia pastoris successful expression 4- hydroxystilbene peroxidase genes, be named as Pichia pastoris pPU19
4TTS；
5) from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in equipped with LB culture mediums shaking flask in,
Medium component is peptone 1g/L, yeast extract 1.5g/L, sucrose 6g/L, MgSO4 0.3g/L、CaCl2 0.2g/L、K2HPO4
0.2g/L, resveratrol 15g/L, control temperature for 31 DEG C, hunting speed 180r/min, initial pH controls 6, fermentation time control
System obtains the tunning containing resveratrol dimer in 32h；
6) the fermentation product liquor Jing H103 types macroporous resin enrichment of resveratrol dimer is purified, column internal diameter 4mm, it is high
Degree 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.7mg/mL, and loading flow velocity is 2BV/h, first with 3 times of column volumes
Distillation water washing, is then eluted with the ethanol water of 8BV 75%, reclaims ethanol water.Second is dispelled using Rotary Evaporators
Alcohol, gained solid content is resveratrol dimer extract, and Jing HPLC tests, its purity is 45%, and wherein resveratrol turns
The conversion ratio for changing resveratrol dimer is 35%.
Embodiment 2：
The method for preparing resveratrol dimer extract using Pichia pastoris, comprises the following steps：
1) sterilizing centrifuge tube in add 1g 4- hydroxystilbene peroxidase genes, 2g pPU19 plasmid genes,
0.3mL Restriction Enzyme buffer solutions, 10U restriction enzyme EcoP1 and 10U EcoP15 and 100mL pure water, are carried out at 32 DEG C
Temperature bath 13min, Jing vortexs concussion 12s, under the rotating speed of 12000r/min, is centrifuged 2min, filters, and obtains containing the 4- hydroxyls after digestion
The mixed liquor of base stilbene peroxidase gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+).Wherein 4- hydroxystilbenes
The gene order of peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC。
2) in the centrifuge tube of sterilizing, 1 the step of add 5 μ L) the peroxidase gene fragment of hydroxystilbene containing 4- that obtains
The mixed liquor of 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+), the T4 ligases of 0.5 μ L, 1 μ L ligase buffer solutions, 5 μ
The ddH2O of L, then Jing vortex oscillations 1.3min, under the rotating speed of 12000r/min, after centrifugation 12s, are placed in 16 DEG C of water and are incubated
Overnight, the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4- are obtained final product, is placed in standby in 4 DEG C of refrigerator.
3) plasmid vector after restructuring is expanded by round pcr, in 95 DEG C of denaturations 5min, 1 circulation；94℃
Denaturation 40s, 57 DEG C of renaturation 40s, 35 circulations；72 DEG C of extension 2min, 72 DEG C of last extension 10min, that is, containing after being expanded
The pPU19 plasmid vectors of 4- hydroxystilbene peroxidase genes；
4) recombinant expression carrier pPU19-4TTS heat shock methods are proceeded into Komagataella pastoris DSMZ
In 70382 Pichia pastoris competent cells, the Komagataella of expression 4- hydroxystilbene peroxidase genes is obtained
The Pichia pastoris of pastoris DSMZ 70382, be named as Pichia pastoris pPU19 4TTS；
5) from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in equipped with LB culture mediums shaking flask in,
Medium component is peptone 2g/L, yeast extract 1.5g/L, sucrose 6.5g/L, MgSO4 0.4g/L、CaCl2 0.25g/L、
K2HPO40.3g/L, resveratrol 16g/L, control temperature for 32 DEG C, and hunting speed 190r/min, initial pH is controlled 6.5, is sent out
Ferment time control obtains the tunning containing resveratrol dimer in 33h；
6) the fermentation product liquor Jing H103 types macroporous resin enrichment of resveratrol dimer is purified, column internal diameter 4mm, it is high
Degree 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.75mg/mL, and loading flow velocity is 2.5BV/h, first with 3 times of column volumes
Distillation water washing, then eluted with the ethanol water of 8BV 75%, reclaim ethanol water.Dispelled using Rotary Evaporators
Ethanol, gained solid content is resveratrol dimer extract, and Jing HPLC tests, its purity is 50%, wherein resveratrol
The conversion ratio of conversion resveratrol dimer is 38%.
Embodiment 3：
The method for preparing resveratrol dimer extract using Pichia pastoris, comprises the following steps：
1) sterilizing centrifuge tube in add 1g 4- hydroxystilbene peroxidase genes, 2g pPU19 plasmid genes,
0.3mL Restriction Enzyme buffer solutions, 10U restriction enzyme EcoP1 and 10U EcoP15 and 100mL pure water, are carried out at 33 DEG C
Temperature bath 15min, Jing vortexs concussion 14s, under the rotating speed of 13000r/min, is centrifuged 3min, filters, and obtains containing the 4- hydroxyls after digestion
The mixed liquor of base stilbene peroxidase gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+).Wherein 4- hydroxystilbenes
The gene order of peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC。
2) in the centrifuge tube of sterilizing, 1 the step of add 5 μ L) the peroxidase gene fragment of hydroxystilbene containing 4- that obtains
The mixed liquor of 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+), the T4 ligases of 0.5 μ L, 1 μ L ligase buffer solutions, 5 μ
The ddH2O of L, then Jing vortex oscillations 2min, under the rotating speed of 12000r/min, after centrifugation 16s, are placed in 16 DEG C of water and were incubated
At night, the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4- are obtained final product, be placed in standby in 4 DEG C of refrigerator.
3) plasmid vector after restructuring is expanded by round pcr, in 95 DEG C of denaturations 5min, 1 circulation；94℃
Denaturation 40s, 57 DEG C of renaturation 40s, 35 circulations；72 DEG C of extension 2min, 72 DEG C of last extension 10min, that is, containing after being expanded
The pPU19 plasmid vectors of 4- hydroxystilbene peroxidase genes；
4) recombinant expression carrier pPU19-4TTS heat shock methods are proceeded into Komagataella pastoris DSMZ
In 70382 Pichia pastoris competent cells, the Komagataella of expression 4- hydroxystilbene peroxidase genes is obtained
The Pichia yeasts of pastoris DSMZ 70382, be named as Pichia pastoris pPU19 4TTS；
5) from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in equipped with LB culture mediums shaking flask in,
Medium component is peptone 2.5g/L, yeast extract 2g/L, sucrose 7g/L, MgSO4 0.35g/L、CaCl2 0.25g/L、
K2HPO40.25g/L, resveratrol 15g/L, control temperature for 33 DEG C, and hunting speed 195r/min, initial pH is controlled 6.5,
Fermentation time control obtains the tunning containing resveratrol dimer in 34h；
6) the fermentation product liquor Jing H103 types macroporous resin enrichment of resveratrol dimer is purified, column internal diameter 4mm, it is high
Degree 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.78mg/mL, and loading flow velocity is 3.0BV/h, first with 4 times of column volumes
Distillation water washing, then eluted with the ethanol water of 8BV 75%, reclaim ethanol water.Dispelled using Rotary Evaporators
Ethanol, gained solid content is resveratrol dimer extract, and Jing HPLC tests, its purity is 48%, wherein resveratrol
The conversion ratio of conversion resveratrol dimer is 40%.
Embodiment 4：
The method for preparing resveratrol dimer extract using Pichia pastoris, comprises the following steps：
1) sterilizing centrifuge tube in add 1g 4- hydroxystilbene peroxidase genes, 2g pPU19 plasmid genes,
0.3mL Restriction Enzyme buffer solutions, 10U restriction enzyme EcoP1 and 10U EcoP15 and 100mL pure water, are carried out at 33 DEG C
Temperature bath 15min, Jing vortexs concussion 20s, under the rotating speed of 14000r/min, is centrifuged 3min, filters, and obtains containing the 4- hydroxyls after digestion
The mixed liquor of base stilbene peroxidase gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+).Wherein 4- hydroxystilbenes
The gene order of peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC。
2) in the centrifuge tube of sterilizing, 1 the step of add 5 μ L) the peroxidase gene fragment of hydroxystilbene containing 4- that obtains
The mixed liquor of 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+), the T4 ligases of 0.5 μ L, 1 μ L ligase buffer solutions, 5 μ
The ddH2O of L, then Jing vortex oscillations 1.6min, under the rotating speed of 12000r/min, after centrifugation 14s, are placed in 16 DEG C of water and are incubated
Overnight, the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4- are obtained final product, is placed in standby in 4 DEG C of refrigerator.
3) plasmid vector after restructuring is expanded by round pcr, in 95 DEG C of denaturations 5min, 1 circulation；94℃
Denaturation 40s, 57 DEG C of renaturation 40s, 35 circulations；72 DEG C of extension 2min, 72 DEG C of last extension 10min, that is, containing after being expanded
The pPU19 plasmid vectors of 4- hydroxystilbene peroxidase genes；
4) recombinant expression carrier pPU19-4TTS heat shock methods are proceeded into Komagataella pastoris DSMZ
In 70382 Pichia pastoris competent cells, the Komagataella of expression 4- hydroxystilbene peroxidase genes is obtained
The Pichia yeasts of pastoris DSMZ 70382, be named as Pichia pastoris pPU19 4TTS；
5) from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in equipped with LB culture mediums shaking flask in,
Medium component is peptone 3g/L, yeast extract 2g/L, sucrose 8g/L, MgSO4 0.3g/L、CaCl2 0.3g/L、K2HPO4
0.3g/L, resveratrol 18g/L, control temperature for 33 DEG C, hunting speed 200r/min, initial pH controls 7.5, fermentation time
Control obtains the tunning containing resveratrol dimer in 36h；
6) the fermentation product liquor Jing H103 types macroporous resin enrichment of resveratrol dimer is purified, column internal diameter 4mm, it is high
Degree 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.80mg/mL, and loading flow velocity is 3BV/h, first with 4 times of column volumes
Distillation water washing, is then eluted with the ethanol water of 8BV 75%, reclaims ethanol water.Second is dispelled using Rotary Evaporators
Alcohol, gained solid content is resveratrol dimer extract, and Jing HPLC tests, its purity is 60%, and wherein resveratrol turns
The conversion ratio for changing resveratrol dimer is 45%.
Embodiment 5：
The method for preparing resveratrol dimer extract using Pichia pastoris, comprises the following steps：
1) sterilizing centrifuge tube in add 1g 4- hydroxystilbene peroxidase genes, 2g pPU19 plasmid genes,
0.3mL Restriction Enzyme buffer solutions, 10U restriction enzyme EcoP1 and 10U EcoP15 and 100mL pure water, are carried out at 35 DEG C
Temperature bath 20min, Jing vortexs concussion 25s, under the rotating speed of 15000r/min, is centrifuged 4min, the 4- hydroxyls after being filtrated to get containing digestion
The mixed liquor of base stilbene peroxidase gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+).Wherein 4- hydroxystilbenes
The gene order of peroxidase gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTC
AACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACA
TTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGAT
CAC。
2) in the centrifuge tube of sterilizing, 1 the step of add 5 μ L) the peroxidase gene fragment of hydroxystilbene containing 4- that obtains
The mixed liquor of 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+), the T4 ligases of 0.5 μ L, 1 μ L ligase buffer solutions, 5 μ
The ddH2O of L, then Jing vortex oscillations 1.6min, under the rotating speed of 12000r/min, after centrifugation 13s, are placed in 16 DEG C of water and are incubated
Overnight, the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4- are obtained final product, is placed in standby in 4 DEG C of refrigerator.
3) plasmid vector after restructuring is expanded by round pcr, in 95 DEG C of denaturations 5min, 1 circulation；94℃
Denaturation 40s, 57 DEG C of renaturation 40s, 35 circulations；72 DEG C of extension 2min, 72 DEG C of last extension 10min, that is, containing after being expanded
The pPU19 plasmid vectors of 4- hydroxystilbene peroxidase genes；
4) recombinant expression carrier pPU19-4TTS heat shock methods are proceeded into Komagataella pastoris DSMZ
In 70382 Pichia pastoris competent cells, the Komagataella of expression 4- hydroxystilbene peroxidase genes is obtained
The Pichia yeasts of pastoris DSMZ 70382, be named as Pichia pastoris pPU19 4TTS；
5) from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in equipped with LB culture mediums shaking flask in,
Medium component is peptone 5g/L, yeast extract 4g/L, sucrose 12g/L, MgSO4 0.5g/L、CaCl2 0.4g/L、K2HPO4
0.6g/L, resveratrol 20g/L, control temperature for 35 DEG C, hunting speed 220r/min, initial pH controls 8, fermentation time control
System obtains the tunning containing resveratrol dimer in 40h；
6) the fermentation product liquor Jing H103 types macroporous resin enrichment of resveratrol dimer is purified, column internal diameter 4mm, it is high
Degree 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.80mg/mL, and loading flow velocity is 4.0BV/h, first with 5 times of column volumes
Distillation water washing, then eluted with the ethanol water of 8BV 75%, reclaim ethanol water.Dispelled using Rotary Evaporators
Ethanol, gained solid content is resveratrol dimer extract, and Jing HPLC tests, its purity is 50%, wherein resveratrol
The conversion ratio of conversion resveratrol dimer is 42%.
SEQUENCE LISTING
<110>Proya Cosmetics Co., Ltd.
<120>A kind of method that employing Pichia pastoris prepares resveratrol dimer
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 234
<212> DNA
<213>4- hydroxystilbene peroxidase gene fragments 4TTS（+）
<400> 1
gaagagctgt cgacagtcgc atgccagcta aattaagaaa accttcactt gcttcaagta 60
aagcatgtcg atccttcaac gaattctata tcacttggat ggaaaactaa gtgttcagta 120
tttcacaggt gacaaaccag acaagaagcg tacattcatt tgaccgaaga agcttgagga 180
gcacccaaac atggtgctta tatggctcca tctcttaaca cgccaagaga tcac 234
<210> 2
<211> 1536
<212> DNA
<213>The Pichia pastoris of expression 4- hydroxystilbene peroxidase
<220>
<221> misc_feature
<222> (60)..(60)
<223> n is a, c, g, or t
<400> 2
tcgctggtaa tcccggcttt tgctgcttac aagctttacg gattatttct aggaggtagn 60
caattattgg gtggtcgcag cagtttcaaa gaggaggagc cagcttctgg gtcaaaagaa 120
aagggacaga gcaagagaca acagaaacta gaaaagagag gacaaaaggt gagatacaga 180
tagaatcttt gcgagtgaac caaggtagct gaaaaacata acttgcaagg atgctattgg 240
acaattttag gtgataaact cgattgctat cactgggctc tgccacatgg aagctttagt 300
gagaagagct gtcgacagtc gcatgccagc taaattaaga aaaccttcac ttgcttcaag 360
taaagcatgt cgatccttca acgaattcta tatcacttgg atggaaaact aagtgttcag 420
tatttcacag gtgacaaacc agacaagaag cgtacattca tttgaccgaa gaagcttgag 480
gagcacccaa acatggtgct tatatggctc catctcttaa cacgccaaga gatcacagct 540
cttgcgcact attcgagtcg tttacttttt ttttggtttt tgctaggcct tccattactt 600
ctttacttcg ttagtgacaa gtgacttaag gccaatgtat tcttgaatca aaagaaggct 660
gtgtcaattc ctaagcccta ctagctctac tttcggagtg acctaccgat aagttcgcat 720
acgcgaatct ggaccatttt tataatacca agtagaaatt caatagccat ctagctgttt 780
ctacatgatg acagcccata accataaaga aaactgcaaa cgattgctga gcttgtagag 840
cgtccagtaa gtagcgcaat ctccagtgag caacgtaata tcatattttc ttctctctct 900
ttcattctcc tccgagaatt acagaagcat catagtagtg tacccaccaa tggttgtgag 960
cgactgcgcg attccatgga tgctactgaa accaatgaat gaaacttgtc aagtttcctc 1020
gcttcctttt acataacgga tcttttaact tagaaacagt ttagtaaaag aaattcatca 1080
atacaatgga cggaggtaag tcagctcttt cagcaaggga gcatggaatc agattggcaa 1140
cgacttctgc gattcttatt cttccgattg attcaacagt agatttgcga gtggttggcc 1200
aaacacacag tttcgatgcg atctccgttt gatttgtatg aatacgcagt catctcattg 1260
gtggagcatt ttatacggat tgattgagtg gaagcatggt actgagagta tctacatgtg 1320
catttctgtt ggttgtcctc ggttgagttt tcgtatctgt ttgtcccccc aattttgtcc 1380
actccttttg gcaatctgcc gaatccaagc tcataatact aactcccatt ttagaagacg 1440
ttgcagcagt aagtaccctt acatgtaatc catgaaagca aatgtggcgc agtcaatcga 1500
agtcactgtc tgattgattc ttccctcagt ggcggt 1536
Claims (4)
1. a kind of method that employing Pichia pastoris prepares resveratrol dimer, it is characterised in that comprise the steps：
1) structure of the pPU19 plasmid vectors of the peroxidase gene of hydroxystilbene containing 4-：Restriction enzyme EcoP1 is applied respectively
With EcoP15 digestion 4- hydroxystilbene peroxidase gene fragments and pPU19 plasmids, the 4- hydroxystilbene peroxidating after digestion is obtained
Thing enzyme gene fragment 4TTS (+) and pPU19 plasmid genes fragment pPU19 (+)；Above-mentioned digestion products are carried out using T4 ligases
Connection, obtains recombinant plasmid pPU19-4TTS, is then expanded by PCR of pPU19 DNAs by round pcr and expands template
4- hydroxystilbene peroxidase genes, obtain the recombinant plasmid expression vector pPU19-4TTS after PCR amplifications；The 4- hydroxystilbenes mistake
The gene order of oxide enzyme gene fragment 4TTS (+) is：
GAAGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATC
CTTCAACGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCG
TACATTCATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAG
AGATCAC；
2) it is 638632 that the recombinant plasmid expression vector pPU19-4TTS after PCR is expanded by heat shock method proceeds to deposit number
In the Pichi strains of Komagataella pastoris DSMZ 70382, finishing for expression 4- hydroxystilbene peroxidase is obtained
Red yeast, be named as Pichia pastoris pPU19 4TTS, its nucleotide sequence：
TCGCTGGTAATCCCGGCTTTTGCTGCTTACAAGCTTTACGGATTATTTCTAGGAGGTAGNCAATTATTGGGTG
GTCGCAGCAGTTTCAAAGAGGAGGAGCCAGCTTCTGGGTCAAAAGAAAAGGGACAGAGCAAGAGACAACAGAAACTA
GAAAAGAGAGGACAAAAGGTGAGATACAGATAGAATCTTTGCGAGTGAACCAAGGTAGCTGAAAAACATAACTTGCA
AGGATGCTATTGGACAATTTTAGGTGATAAACTCGATTGCTATCACTGGGCTCTGCCACATGGAAGCTTTAGTGAGA
AGAGCTGTCGACAGTCGCATGCCAGCTAAATTAAGAAAACCTTCACTTGCTTCAAGTAAAGCATGTCGATCCTTCAA
CGAATTCTATATCACTTGGATGGAAAACTAAGTGTTCAGTATTTCACAGGTGACAAACCAGACAAGAAGCGTACATT
CATTTGACCGAAGAAGCTTGAGGAGCACCCAAACATGGTGCTTATATGGCTCCATCTCTTAACACGCCAAGAGATCA
CAGCTCTTGCGCACTATTCGAGTCGTTTACTTTTTTTTTGGTTTTTGCTAGGCCTTCCATTACTTCTTTACTTCGTT
AGTGACAAGTGACTTAAGGCCAATGTATTCTTGAATCAAAAGAAGGCTGTGTCAATTCCTAAGCCCTACTAGCTCTA
CTTTCGGAGTGACCTACCGATAAGTTCGCATACGCGAATCTGGACCATTTTTATAATACCAAGTAGAAATTCAATAG
CCATCTAGCTGTTTCTACATGATGACAGCCCATAACCATAAAGAAAACTGCAAACGATTGCTGAGCTTGTAGAGCGT
CCAGTAAGTAGCGCAATCTCCAGTGAGCAACGTAATATCATATTTTCTTCTCTCTCTTTCATTCTCCTCCGAGAATT
ACAGAAGCATCATAGTAGTGTACCCACCAATGGTTGTGAGCGACTGCGCGATTCCATGGATGCTACTGAAACCAATG
AATGAAACTTGTCAAGTTTCCTCGCTTCCTTTTACATAACGGATCTTTTAACTTAGAAACAGTTTAGTAAAAGAAAT
TCATCAATACAATGGACGGAGGTAAGTCAGCTCTTTCAGCAAGGGAGCATGGAATCAGATTGGCAACGACTTCTGCG
ATTCTTATTCTTCCGATTGATTCAACAGTAGATTTGCGAGTGGTTGGCCAAACACACAGTTTCGATGCGATCTCCGT
TTGATTTGTATGAATACGCAGTCATCTCATTGGTGGAGCATTTTATACGGATTGATTGAGTGGAAGCATGGTACTGA
GAGTATCTACATGTGCATTTCTGTTGGTTGTCCTCGGTTGAGTTTTCGTATCTGTTTGTCCCCCCAATTTTGTCCAC
TCCTTTTGGCAATCTGCCGAATCCAAGCTCATAATACTAACTCCCATTTTAGAAGACGTTGCAGCAGTAAGTACCCT
TACATGTAATCCATGAAAGCAAATGTGGCGCAGTCAATCGAAGTCACTGTCTGATTGATTCTTCCCTCAGTGGCGGT
；
3) the Pichia pastoris that step (2) is obtained pPU19 4TTS bacterial strains by line and squamous subculture, Jing primary dcreening operations,
Secondary screening, carries out liquid training fermentation, chooses the bacterium solution that metabolite content is high or activity is high and lines on solid screening and culturing medium, point
From purifying, secondary screening bacterial classification is obtained；
4) tunning containing resveratrol dimer is prepared：The LB fermented and cultureds of resveratrol of the configuration containing 15-20g/L
Base, from flat board picking Pichia pastoris pPU19 4TTS single bacterium colonies in the shaking flask of LB culture mediums, fermentation, contained
The tunning of resveratrol dimer；
5) separation of resveratrol dimer：By the fermentation product liquor Jing resin containing resveratrol dimer step (4) Suo Shu
Purifying, obtains solid and is resveratrol dimer extract.
2. the method for claim 1, it is characterised in that the condition of liquid training fermentation is in step (3)：Fermentation temperature 37
DEG C, hunting speed 160r/min, pH is 7, fermentation time 24h.
3. the method for claim 1, it is characterised in that the condition of shake flask fermentation is in step (4)：Temperature is 31-35
DEG C, hunting speed 180-220r/min, in 6-8, fermentation time is controlled in 32-40h for initial pH controls.
4. the method for claim 1, it is characterised in that the separation method of resveratrol dimer is concrete in step (5)
For：By step 4) purifying of the fermentation product liquor Jing H103 types macroporous resin enrichment containing resveratrol dimer, column internal diameter
4mm, height 1m, packed column volume is 2L, and the mass concentration of sample solution is 0.7-0.8mg/mL, and loading flow velocity is 2-4BV/h, is first used
The distillation water washing of 3-5 times of column volume, is then eluted with the ethanol water of 8BV 75%, is reclaimed ethanol water and is washed out liquid,
Ethanol is removed using Rotary Evaporators, solid is obtained and is resveratrol dimer extract.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710009219.1A CN106636243A (en) | 2017-01-06 | 2017-01-06 | Method for preparing resveratrol oligomer from pichia pastoris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710009219.1A CN106636243A (en) | 2017-01-06 | 2017-01-06 | Method for preparing resveratrol oligomer from pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636243A true CN106636243A (en) | 2017-05-10 |
Family
ID=58844307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710009219.1A Withdrawn CN106636243A (en) | 2017-01-06 | 2017-01-06 | Method for preparing resveratrol oligomer from pichia pastoris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636243A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979617A (en) * | 2010-10-12 | 2011-02-23 | 尉亚辉 | Method for preparing resveratrol dimer |
-
2017
- 2017-01-06 CN CN201710009219.1A patent/CN106636243A/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979617A (en) * | 2010-10-12 | 2011-02-23 | 尉亚辉 | Method for preparing resveratrol dimer |
Non-Patent Citations (2)
| Title |
|---|
| MAURICIO MORA-PALE等: "Antimicrobial Mechanism of Resveratrol-trans-Dihydrodimer Produced From Peroxidase-Catalyzed Oxidation of Resveratrol", 《BIOTECHNOLOGY AND BIOENGINEERING》 * |
| 无: "JN858964.1", 《GENBANK》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2744466T3 (en) | Polypeptides with oxidoreductase activity and their uses | |
| CN102174420A (en) | Genetic engineering bacteria for producing high-purity cephalosporin C and application thereof | |
| CN113604374B (en) | Genetically engineered bacterium for efficiently producing carotenoid, construction method and application thereof | |
| CN103298945A (en) | Microorganisms for 1,3-propanediol production using high glycerine concentration | |
| CN103740629A (en) | Genetic engineering acetic acid bacteria of overexpressing coenzyme PQQ (pyrroloquinoline quinone) synthetic proteins and application of bacteria | |
| CN109266630A (en) | A kind of lipase and its preparing the application in Bu Waxitan intermediate | |
| CN112280726A (en) | Construction method and application of high-yield ectoine engineering strain | |
| CN111154737B (en) | Manganese peroxidase capable of degrading aflatoxin B1 and application thereof | |
| CN101613707B (en) | Method for producing glutathione by use of metabolic engineering bacteria | |
| CN106636243A (en) | Method for preparing resveratrol oligomer from pichia pastoris | |
| CN117229934A (en) | Genetically engineered bacterium for synthesizing carotenoid, construction method and application thereof | |
| CN110872592B (en) | Tobacco acyl glycosyltransferase gene NtASAT2 and encoding protein and application thereof | |
| CN110257312B (en) | Recombinant gene engineering bacterium and application thereof in producing vanillin by fermentation | |
| CN104357413B (en) | One kind restructuring dextrose fructose oxidoreducing enzyme and its fungus expression vector and fungus insecticide | |
| CN110157720B (en) | Sesquiterpene cyclase gene peniA and method for synthesizing silphine through heterologous expression in yeast | |
| CN108424871B (en) | Mutant mycobacterium smegmatis secreting nicotinic acid and construction method thereof | |
| CN105969790A (en) | Method for increasing carbon source utilization rate in aspergillus oryzae L-malic acid synthesizing process | |
| CN113717998A (en) | Application of recombinant bacillus subtilis and method for producing tetrahydropyrimidine by using wastewater generated in synthesis of carnosine by enzyme method | |
| CN112608853A (en) | Recombinant monascus strain incapable of producing citrinin and construction method thereof | |
| CN107916271B (en) | A kind of high-efficiency expression method of recombination nitrile hydratase | |
| CN114250155A (en) | Trichoderma reesei engineering bacterium capable of highly producing cellulase under condition of taking glucose as carbon source and construction method and application thereof | |
| CN113293153B (en) | Method for secretory expression of levansucrase by recombinant pichia pastoris and application thereof | |
| WO2014187151A1 (en) | Autolytic recombinant bacteria, preparation method and application thereof | |
| CN112029671B (en) | Recombinant aspergillus terreus strain for producing trans-aconitic acid and preparation method and application thereof | |
| CN116254286B (en) | Cyanamide-induced saccharomyces cerevisiae engineering bacteria and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20170510 |
|
| WW01 | Invention patent application withdrawn after publication |