CN106636135A

CN106636135A - Salt-tolerant gene of wheat and application of salt-tolerant gene

Info

Publication number: CN106636135A
Application number: CN201611243044.2A
Authority: CN
Inventors: 王萌; 施卫明
Original assignee: Institute of Soil Science of CAS
Current assignee: Institute of Soil Science of CAS
Priority date: 2016-12-29
Filing date: 2016-12-29
Publication date: 2017-05-10

Abstract

The invention discloses a salt-tolerant gene of wheat and application of the salt-tolerant gene. By the use of a plant gene engineering technology, the salt-tolerant gene of the wheat is obtained by cloning, and the gene is transferred into common wheat for the first time; comparative analysis shows that the salt tolerance of transgenic plants is obviously improved, and the salt-tolerant gene can be widely applied to cultivation of salt-tolerant crop species and particularly plays an important role in cultivation of salt-tolerant wheat species.

Description

A kind of wheat salt tolerance gene and its application

Technical field

The invention belongs to technical field of biological genetic engineering, more particularly to resistant gene of salt and its application.

Background technology

The soil salinization has a strong impact on crop yield.In particular with industrial expansion, the soil salinization is more and more tight Weight, it has also become the social concern of a global concern.China human mortality is numerous, and the soil salinization is even more serious, has become system About China's economy and the key factor of social development.Therefore, in addition to alleviating the soil salinization, salt tolerant crops new product is cultivated Plant has become when previous very urgent task.

New proterties is proceeded in high-biomass plant using transgene improvement plant technology, is developed with this and efficiently turn base It is a technology with broad prospect of application because of new variety of plant and for planting in salt-soda soil.

At present, carry out plant salt tolerance aspect research achieved with larger progress using technique for gene engineering, cloned big Amount related gene, and by these gene transferred plants, study for Mechanisms of Salt Resistance.Some experiments show, by plant itself with And in other biologies in the gene transferred plant related to salt tolerant, its heterologous transcription and translation product can be with render transgenic plants Saline-alkaline tolerance is improved.

The content of the invention

The technical problem of solution：It is an object of the invention to provide a kind of wheat salt tolerance gene changes with it in plant salt tolerance proterties Application in good.

Technical scheme：A kind of wheat salt tolerance gene, the nucleotide sequence of the gene cDNA is as shown in SEQ ID No.1.

The albumen of above-mentioned wheat salt tolerance gene coding.

The amino acid sequence of described albumen is as shown in SEQ ID No.2.

Plant expression vector containing said gene.

Application of the said gene in salt-resistant plant is cultivated.

Above-mentioned plant is common wheat.

Application of the above-mentioned plant expression vector in salt-resistant plant is cultivated.

Beneficial effect：Using plant gene engineering technology, present invention clone has obtained wheat salt tolerance gene, and first should Gene is proceeded in common wheat, is proved through comparative analysis, and the salt resistance ability of transfer-gen plant is significantly improved, and indicates that it can be extensive For cultivating salt tolerant variety of crops, especially will play an important role in Salt-tolerant Wheat kind is cultivated.

Description of the drawings

Fig. 1 is the amplification of full length gene cDNA sequences；

Fig. 2 is the qualification figure of the positive system of transgenic wheat, and wherein "-" is negative control, and "+" is positive control；

Fig. 3 is salt stress to transgenic wheat strain and the impact for compareing strain root growth.

Specific embodiment

The clone of embodiment 1, resistant gene of salt

1.1 extract wheat Total RNA

1. organization material is put in the mortar of Liquid nitrogen precooler, powder is fully ground in liquid nitrogen；

2. treat that liquid nitrogen volatilization is dry, in being immediately transferred to the centrifuge tube of 2mL, about add the Invitrogen of 1mL public per 100mg materials The TRIzol extracts of department, after thawing, are inhaled and are blown repeatedly with sample loading gun, and acutely vibration mixes sample, sample is fully cracked, room temperature Place 5 minutes；

3. 0.2mL chloroforms are added, and acutely vibration is mixed 15 seconds, and room temperature is placed 10 minutes；

4.4 DEG C, 12000rpm is centrifuged 15 minutes；

5. upper strata aqueous phase is carefully suctioned out with pipettor, in adding the centrifuge tube of new 1.5mL, add the isopropanol (1 of 500 μ L:1 Volume), fully mix, -20 DEG C, precipitation 30min or overnight；

6.4 DEG C, 12000rpm centrifugation 10min, careful abandoning supernatant；

7.RNA precipitations are washed with 75% ethanol of 1mL.4 DEG C, 8000rpm centrifugation 10min collect precipitation；

8. repeat to washed once RNA precipitate with 75% ethanol；

9. go supernatant, RNA precipitate to dry on aseptic operating platform about 10-15 minutes, RNA shows slightly transparent, add proper volume （30-50μL）RNase-free water fully dissolve (can be placed on -80 DEG C long-term preserve)；

10. ultraviolet specrophotometer and 1%Agrose detected through gel electrophoresis RNA concentration and quality.

1.2 cDNA reverse transcriptions

Reverse transcriptase：M-MLV Reverse Transcriptase(Invitrogen).

1.12 μ L systems：Oligo（dT） 1μL

Total RNA 100ng-5μg

dNTP 1μL

DEPC water is mended to 12 μ L

2.65 DEG C of denaturation 5min, in being rapidly inserted into ice, then sequentially add:

5×First-Strand Buffer 4μL

0.1M DTT 2μL

RNase (Invitrogen) 1μL

3. gently mix, 37 DEG C of reaction 2min；

4. 1 μ L M-MLV RT are added, is mixed, 37 DEG C of reaction 50min；

5.70 DEG C incubate 15min and inactivate M-MLV RT；

6. 1 μ L RNase H are added（Invitrogen）, 37 DEG C of reaction 20min；

7. suitable concn is diluted to ultra-pure water.As pcr template.

The clone of 1.3 ORFs and sequencing

1. primer sequence：According to sequencing result, gene upstream and downstream primer is designed: HKT-B1-F (ATACTTACCAACGAATGGG TTCTC), HKT-B1-R (GTCTGCTACTAGGTTATACTATCC), the ORFs of amplification gene.

2.PCR reaction systems（50μL）：

2×GC bufferⅠ 10μL

The μ L of template cDNA 1

dNTPs（2.5mM each） 0.5μL

Primer1 (10μM) 1μL

Primer2(10μM) 1μL

LA Taq(TaKaRa) 0.5μL

ddH₂O adds to the μ L of final volume 50

3.PCR response procedures are：94 DEG C of denaturations 5min；94 DEG C of denaturation 45sec, 55 DEG C of renaturation 45sec, 72 DEG C of extensions 2min, circulates 35 times；72 DEG C of extension 7min.

4. amplified fragments are connected and convert Escherichia coli DH10B after reclaiming with pEASY-T1 carriers, be sequenced by Nanjing gold this Auspicious company completes.

The structure of embodiment 2, plant expression vector

Using plant expression vector pGA3626, selectKpnIWithBspTIRespectively to pGA3626 and containing genes of interest PEASY-T1 carriers carry out double digestion, are separately recovered carrier large fragment and genes of interest small fragment, are connected with T4 DNA ligases Escherichia coli DH10B competent cells are converted after connecing, identifies that the expression of the plant with genes of interest is obtained after recon to be carried Body.

（1）Plasmid pGA3626 empty carriers and pEASY-T1'sKpnI and BspTIDouble digestion

Alkaline lysis method of extracting pGA3626 empty carrier and pEASY-T1 plasmids, respectively take 10 μ g digestions, and digestion system is as follows：

KpnI 1μL

BspTI 1μL

The μ L of pGA3626 carriers/pEASY-T1 plasmids 1 ~ 2

10×Buffer K 1μL

ddH₂O is supplemented to 20 μ L

In 30 DEG C of thermostat water bath digestions more than 2 hours.With 1 × TAE as electrophoretic buffer after double digestion, digestion is produced

Thing carries out 0.8% agarose gel electrophoresis.The load of 14kb in pGA3626 is cut with clean blade under ultraviolet transilluminator The genes of interest band of about 1.5 kb, reclaims the band in body large fragment and pEASY-T1.

（2）The dephosphorization of the carrier large fragment that pGA3626 plasmid enzyme restrictions are reclaimed.

（3）The pGA3626 carrier segments (about 14kb) of Jing digestions and dephosphorization and pEASY-T1 double digestions reclaim fragment（About 1.5kb）With mol ratio 1:4 ratio carries out 16 DEG C of connections overnight.

（4）Connection product heat shock method converts Escherichia coli DH10B competent cells, and transformed bacteria is in the μ g/mL containing Kan 50 LB solid plates on 37 DEG C cultivate 16 hours or so.

（5）The identification of recon

1. the PCR checkings of plasmid

Picking single bacterium colony be inoculated in respectively 5mL containing Kan LB fluid nutrient mediums in 37 DEG C of shaken cultivations overnight, alkaline denaturation Plasmid is extracted, with gene specific primer performing PCR amplification is entered, system is as follows：

PCR reaction conditions are as follows：94 DEG C of 3min of denaturation, 35 circulations are：94 DEG C of 30sec, 55 DEG C of 30sec, 72 DEG C 1min, finally, 72 DEG C of extension 10min.PCR products are identified with 1.0% agarose gel electrophoresis.

2. plasmid enzyme restriction identification

Upgrading grain is carried outKpnI and BspTIDouble digestion, digestion system is ibid.0.8% agarose gel electrophoresis, detects whether to contain There are the fragment of expected molecular size range, the correct structure of checking carrier.

The initiative of embodiment 3, transgenic wheat, checking and phenotypic evaluation

The initiative of 2.1 transgenic wheats

The growing point method for transformation set up using collaboration laboratory（National inventing patent ZL200410075773.2）, by what is built Plant expression vector transformed wheat.

The checking of 2.2 transgenic wheats positive strain

(1) CTAB methods extract genomic DNA.

(2) PCR identifications positive plant.

PCR is expanded with the genomic DNA of transformation plant as template, and primer, PCR reaction systems and reaction condition are shown in 1.3. The result is shown in Fig. 2.

2.3 the phenotypic evaluation of transgenic wheat positive strain

Wheat lines：Vector transgene positive strain and control common wheat Jinan 177.

Condition of culture：Water culture is cultivated 2 days for 20 DEG C on aseptic filter paper, is then transferred into 1/2 Hoagland nutrient solutions (Hoagland and Arnon, 1950) in, be placed in culturing room（12 hours photoperiods, light process is distinguished with the temperature of dark treatment For 22 DEG C and 20 DEG C, humidity 50%, photosynthetically active radiation is 300 μm of ol m-2s-1）, nutrient solution changes daily.

Treatment conditions：When wheat seedling culture is to two leaf phases, blank process, salt treatment are carried out（50mM NaCl process 1st day, afterwards NaCl concentration daily be incremented by 50mM, until 200mM）, process time is 7 days, identifies phenotype, as shown in figure 3, Vector transgene positive strain root length, overground part growing state illustrate that vector transgene can promote significantly better than control strain Enter the salt tolerance of wheat, it was demonstrated that the gene can be used for the salt tolerance improvement of the plants such as wheat.

SEQUENCE LISTING

<110>Nanjing Soil Inst., Chinese Academy of Sciences

<120>A kind of wheat salt tolerance gene and its application

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1557

<212> DNA

<213>Artificial sequence

<400> 1

atgggttctc tgcatgtctc ctgcagtacc actcaacata gcaagcttca gagggtttac 60

caactcctgt ttttccatgt gcacccgttc tggctccatt tcttgtactt tgtaaccatc 120

tccttcttag gtttcgtgat cctgaaagcc ctgcccatga agaccagcat ggtctcgagg 180

cccatagacc ttgacctgat cttcacctcg gtgtcggcca ccacggtgtc gagcatggtg 240

gccgtggaga tggagtcctt ctccaacccc cagctcctac tcctgaccat ccttatgctc 300

ctcggcggcg aggtgttcac cagcatgctt ggcctttact ttacctacat caagtccaag 360

aagaaagaag ccccccatga ccatggtgat ggtggtggca aagtcgaacc agcaccgtct 420

agcctagagc tccctgctac caccttcatg gacgatagca ctgcacagaa ccagatggag 480

caagggttca acaaggagca gccccgatac ggccgagcct tcctcaccag gttgctcctg 540

ttcatagtgc tgggctatca cgtggtggtg cacctcgccg gctactccct gatgctgctc 600

tacctgagcg tcgtctccgg cgcaagggct gtgctcgccg gcaaggggat cagcctgcac 660

accttctccg tattcaccgt cgtctcgaca ttcgccaatg gtggcttcgt gccgaacaac 720

gaagggatgg tcgtcttccg gtccttcccg ggcctcctgc tcctcgtcat gccgcacgtc 780

ctcctcggca acacgctctt ccctgtcttc ctcaggctgg ccatctgggc tctccggagg 840

gtcaccagga ggcccgagct cggccagctg cagagcatcg gctatggtca cctgctgacg 900

agccggcaca cctgcttctt ggctttcacc gtggccacgt tcgtgctggc gcagctgtcg 960

ctcttctgcg ccatggagtg gggctccaac gggctgcacg ggctcaccgc cgcgcagaag 1020

ctcgttgcgg cactgttcat gtcggtcaac tctaggcaca ccggcgagat ggtcgtggac 1080

ctttccacca tgtcgtcagc cgttgtggtg ctctacgtgg tcatgatgta cctaccacct 1140

tacactacat ttctaccagt ggaagacgac agtgaccaac aagtgggagc agatcagcac 1200

caccagaaaa gggtaacaag catatggcgg aagctgctca tgtcgccgct ctcgttcttg 1260

gccatcttca tcgccgtcgt gtgcatcacg gagcggcggc agatctccga tgaccccctc 1320

aacttcaacg tcctcaacat caccgtcgag gttatcagtg cgtacggaaa cgtggggttt 1380

agcaccgggt acagctgtgc ccggcaggtg actgccgacg gcggctgcag ggatacgtgg 1440

gttggcttct ctgggaagtg gagctggcaa gggaagctgg ttctcattgc tgtcatgttc 1500

tacggcagac tcaagaagtt cggcatgcat ggtggcgagg catggaggat agtataa 1557

<210> 2

<211> 518

<212> PRT

<213>Artificial sequence

<400> 2

Met Gly Ser Leu His Val Ser Cys Ser Thr Thr Gln His Ser Lys Leu

1 5 10 15

Gln Arg Val Tyr Gln Leu Leu Phe Phe His Val His Pro Phe Trp Leu

20 25 30

His Phe Leu Tyr Phe Val Thr Ile Ser Phe Leu Gly Phe Val Ile Leu

35 40 45

Lys Ala Leu Pro Met Lys Thr Ser Met Val Ser Arg Pro Ile Asp Leu

50 55 60

Asp Leu Ile Phe Thr Ser Val Ser Ala Thr Thr Val Ser Ser Met Val

65 70 75 80

Ala Val Glu Met Glu Ser Phe Ser Asn Pro Gln Leu Leu Leu Leu Thr

85 90 95

Ile Leu Met Leu Leu Gly Gly Glu Val Phe Thr Ser Met Leu Gly Leu

100 105 110

Tyr Phe Thr Tyr Ile Lys Ser Lys Lys Lys Glu Ala Pro His Asp His

115 120 125

Gly Asp Gly Gly Gly Lys Val Glu Pro Ala Pro Ser Ser Leu Glu Leu

130 135 140

Pro Ala Thr Thr Phe Met Asp Asp Ser Thr Ala Gln Asn Gln Met Glu

145 150 155 160

Gln Gly Phe Asn Lys Glu Gln Pro Arg Tyr Gly Arg Ala Phe Leu Thr

165 170 175

Arg Leu Leu Leu Phe Ile Val Leu Gly Tyr His Val Val Val His Leu

180 185 190

Ala Gly Tyr Ser Leu Met Leu Leu Tyr Leu Ser Val Val Ser Gly Ala

195 200 205

Arg Ala Val Leu Ala Gly Lys Gly Ile Ser Leu His Thr Phe Ser Val

210 215 220

Phe Thr Val Val Ser Thr Phe Ala Asn Gly Gly Phe Val Pro Asn Asn

225 230 235 240

Glu Gly Met Val Val Phe Arg Ser Phe Pro Gly Leu Leu Leu Leu Val

245 250 255

Met Pro His Val Leu Leu Gly Asn Thr Leu Phe Pro Val Phe Leu Arg

260 265 270

Leu Ala Ile Trp Ala Leu Arg Arg Val Thr Arg Arg Pro Glu Leu Gly

275 280 285

Gln Leu Gln Ser Ile Gly Tyr Gly His Leu Leu Thr Ser Arg His Thr

290 295 300

Cys Phe Leu Ala Phe Thr Val Ala Thr Phe Val Leu Ala Gln Leu Ser

305 310 315 320

Leu Phe Cys Ala Met Glu Trp Gly Ser Asn Gly Leu His Gly Leu Thr

325 330 335

Ala Ala Gln Lys Leu Val Ala Ala Leu Phe Met Ser Val Asn Ser Arg

340 345 350

His Thr Gly Glu Met Val Val Asp Leu Ser Thr Met Ser Ser Ala Val

355 360 365

Val Val Leu Tyr Val Val Met Met Tyr Leu Pro Pro Tyr Thr Thr Phe

370 375 380

Leu Pro Val Glu Asp Asp Ser Asp Gln Gln Val Gly Ala Asp Gln His

385 390 395 400

His Gln Lys Arg Val Thr Ser Ile Trp Arg Lys Leu Leu Met Ser Pro

405 410 415

Leu Ser Phe Leu Ala Ile Phe Ile Ala Val Val Cys Ile Thr Glu Arg

420 425 430

Arg Gln Ile Ser Asp Asp Pro Leu Asn Phe Asn Val Leu Asn Ile Thr

435 440 445

Val Glu Val Ile Ser Ala Tyr Gly Asn Val Gly Phe Ser Thr Gly Tyr

450 455 460

Ser Cys Ala Arg Gln Val Thr Ala Asp Gly Gly Cys Arg Asp Thr Trp

465 470 475 480

Val Gly Phe Ser Gly Lys Trp Ser Trp Gln Gly Lys Leu Val Leu Ile

485 490 495

Ala Val Met Phe Tyr Gly Arg Leu Lys Lys Phe Gly Met His Gly Gly

500 505 510

Glu Ala Trp Arg Ile Val

515

<210> 3

<211> 24

<212> DNA

<213>Artificial sequence

<400> 3

atacttacca acgaatgggt tctc 24

<210> 4

<211> 24

<212> DNA

<213>Artificial sequence

<400> 4

gtctgctact aggttatact atcc 24

Claims

1. a kind of wheat salt tolerance gene, it is characterised in that the nucleotide sequence of the gene cDNA is as shown in SEQ ID No.1.

2. the albumen that wheat salt tolerance gene described in claim 1 is encoded, amino acid sequence is as shown in SEQ ID No.2.

3. a kind of plant expression vector containing gene described in claim 1.

4. application of the gene described in claim 1 in salt-resistant plant is cultivated.

5. application as claimed in claim 4, it is characterised in that the plant is common wheat.

6. application of the plant expression vector described in claim 3 in salt-resistant plant is cultivated.