CN106636119A - Neuropeptide Corazonin and acceptor gene thereof as well as applications to specific control agent of Bactrocera dorsalis - Google Patents

Abstract

The invention provides Bactrocera dorsalis neuropeptide gene Corazonin and an acceptor gene thereof Corazonin receptor as well as amplification methods, coded proteins and applications. The Bactrocera dorsalis neuropeptide Corazonin gene is shown in a SEQ ID No.9, and coded protein is shown in SEQ ID No.10; the invention also provides a nucleotide sequence of a Bactrocera dorsalis neuropeptide Corazonin ligand as shown in SEQ ID No.11, and coded protein is shown in SEQ ID No.12; the Bactrocera dorsalis neuropeptide acceptor Corazonin receptor gene is shown in SEQ ID No.13, and coded protein is shown in SEQ ID No.14; the invention also provides applications of nucleotide and amino acid sequences.

Description

Neuropeptide Corazonin is with its acceptor gene and in citrus fruit fly specificity controlling agent In application

Technical field

The invention belongs to genetic engineering field, and in particular to a kind of neuropeptide Corazonin is with its acceptor gene and in Fructus Citri tangerinae Application in little trypetid specificity controlling agent.

Background technology

Citrus fruit fly (Bactrocera dorsalis, Hendel), also known as east trypetid, yellow fly, fruit maggot, are subordinate to double Wing mesh Diptera, fruit Nuscidae Tetriphitidae, the worm have extremely strong adaptive capacity to environment and invasion diffusivity, main 46 section's planting fruit-trees more than 250, vegetable and the flowers such as Citrus to be caused harm, Fructus psidii guajavae immaturus, Fructus Mangifera Indicae, to the fruit and vegerable and the industry of flowers and plants of China Sound development causes significant damage.At present, citrus fruit fly is classified as by multiple countries and regions such as Europe, the United States, day and Southeast Asia Important dangerous quarantine object.In terms of the preventing and treating of citrus fruit fly, chemical insecticide be prophylactico-therapeutic measuress important composition portion Point, including organophosphorus insecticide, pyrethroid and avilamycin etc., but chemical prevention is away from our environmental requirement very, Especially human health is seriously threaten the problems such as the generation of pest resistance to insecticide, Environmental Residues, food safety hidden danger, therefore, newly The research and development of type insecticide have to be continued.

Corazonin (CZ) is to be prevalent in the relatively conservative neuropeptide of the class exist in insect bodies, mediation Corazonin effect Corazonin receptors be typical g protein coupled receptor (G-protein coupled receptor, GPCR).In different insects, Corazonin signaling systeies have various different physiological functions, and such as heart rate accelerates, body colour changes Change, substance metabolism increase and decrease, development and physiological rhythm regulation and control, delay of casting off a skin, reduction etc. of spinning.In fruit bat, by RNAi silences Technology or transgenic technology find that Corazonin regulates and controls response of the fruit bat to the environment-stress such as hungry, hypertonic, hypoxia.This Outward, the expression of fruit bat Corazonin there occurs change in location with ontogeny, and its expression is with tissue, period and sex Specificity, shows that Corazonin there may be relatively broad physiological action in fruit bat.And the research table to maduca sexta Bright, cast off a skin behaviors of the Corazonin receptor to maduca sexta has regulating and controlling effect, and Corazonin is regulation and control maduca sexta Cast off a skin the hormone that is released at first in a series of hormones of behavior, and injecting the Corazonin of high dose can cause larva to slough off Skin time retardation.Current world new drug development enters low ebb, but the new drug development with g protein coupled receptor (GPCR) as target But outshine othersOne branch of the tree is particularly thriving, lead the great forward position of global new drug development.GPCR is the maximum family in cell-membrane receptor, with 7 Distinctive transmembrane helix structure, plays an important role during cell signalling.At present, using GPCR as target in insecticide Novel agrochemical be rarely reported, and the research in citrus fruit fly and application are less.

The content of the invention

It is an object of the invention to provide the gene and amplification method of citrus fruit fly neuropeptide Corazonin and its receptor, volume The protein of code and application.

In a first aspect of the present invention, there is provided the albumen of a kind of citrus fruit fly neuropeptide Corazonin genes and its coding Matter, the nucleotide sequence such as SEQ ID NO of the citrus fruit fly neuropeptide Corazonin genes:Shown in 9, the albumen of its coding The aminoacid sequence of matter such as SEQ ID NO:Shown in 10.

In another aspect of this invention, there is provided a kind of amplification method of citrus fruit fly neuropeptide Corazonin genes, including Following steps：Citrus fruit fly total serum IgE is extracted, reverse transcription is cDNA, the amplification method of nest-type PRC is adopted with cDNA as template, the One wheel amplification primer be Corazonin-F1 and Corazonin-R1, second wheel amplification primer be Corazonin-F2 and Corazonin-R2, the sequence of the primer is：

Corazonin-F1：CAAACGGCTTTTTATTAAAAC,

Corazonin-R1：CTACTAAATTCGTGTGGAGTC,

Corazonin-F2：CATCATGTTCAAATTATTCTTC,

Corazonin-R2：GCCATAATCATGTTTTAATGC.

In another aspect of this invention, there is provided a kind of citrus fruit fly neuropeptide Corazonin mature peptides are (also referred to as CorazoninGPCR parts) gene and its coding protein, the nucleoside of the citrus fruit fly neuropeptide Corazonin parts Acid sequence such as SEQ ID NO:Shown in 11, the aminoacid sequence of the nucleotide sequence coded protein is respectively such as SEQ ID NO:Shown in 12.

In another aspect of this invention, there is provided a kind of citrus fruit fly neuropeptide receptor Corazonin receptor genes and The protein of its coding, the nucleotide sequence such as SEQ of the citrus fruit fly neuropeptide receptor Corazonin receptor genes ID NO:Shown in 13, the aminoacid sequence such as SEQ ID NO of the protein of its coding:Shown in 14.

In another aspect of this invention, there is provided a kind of citrus fruit fly neuropeptide receptor Corazonin receptor genes Amplification method, comprises the steps：Citrus fruit fly total serum IgE is extracted, and reverse transcription is cDNA, nest-type PRC is adopted by template of cDNA Amplification method, the first round amplification primer be CorazoninGPCR-F1 and CorazoninGPCR-R1, second wheel amplification Primer is CorazoninGPCR-F2 and CorazoninGPCR-R2, and the sequence of the primer is：

CorazoninGPCR-F1：ACCTCGAAAAATCACTAAATGG,

CorazoninGPCR-R1：CACATACTCCCCTCCACAGAC,

CorazoninGPCR-F2：CTAAATGGAAGGTGCAAGTGTG,

CorazoninGPCR-R2：CTCGCTTACACATTAGAGATATGC.

In another aspect of this invention, there is provided a kind of aforesaid citrus fruit fly neuropeptide Corazonin genes and its coding Protein, citrus fruit fly neuropeptide Corazonin maturation peptide gene and its coding protein or citrus fruit fly neuropeptide The protein of receptor Corazonin receptor genes and its coding, the application in terms of trypetid neuroregulation are anti-in trypetid The application controlled, or the application in terms of trypetid insecticide is prepared.

The invention has the beneficial effects as follows：The citrus fruit fly neuropeptide receptor Corazonin receptor's that the present invention is provided Ligand polypeptide has good binding ability with Corazonin receptor, it was demonstrated that the part that the present invention is provided has external living Property, there is provided ligand polypeptide and encode the DNA of the ligand polypeptide and be used against the GPCR and develop medicine, such as citrus fruit fly Neuroregulator.According to expression system and the receptor binding assay system of the restructuring G- protein-coupled receptor proteins in the present invention System, the agonist and antagonist that can screen citrus fruit fly neuropeptide Corazonin specificitys (have promotion to mode ligands activity Effect for agonist, play antagonism to mode ligands activity is antagonist), the agonist for being obtained or antagonist can be with For the preventing and treating of citrus fruit fly, there is potential application prospect in terms of trypetid insecticide is prepared.

Description of the drawings

Fig. 1 is determination of activity result figure of the citrus fruit fly neuropeptide Corazonin mature peptides to Corazonin receptors.

Fig. 2 is the relative expression quantity of Corazonin receptor genes after RNA interference.

Fig. 3 is larvae pupation time and percentage of pupation cartogram after RNA interference.

Specific embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.

Main agents and Producer：

2 × PrimeSTARMax Premix (Takara companies, Japan)

RNA extracts kits, reverse transcription reagent box (Tiangeng company, China)

PGEM-T Easy Vector (Promega companies, the U.S.)

DNA ligation kit (Takara companies, Japan)

Trans5 α competent cells (Transgen companies, China)

PcDNA3.1 (+) plasmid (Invitrogen companies, the U.S.)

Enzyme NotI (NEB companies, the U.S.)

Plasmid extraction kit (QIAGEN, Germany)

DMEM/F-12medium (Gibco companies, the U.S.)

T4DNA ligases (Takara companies, Japan)

Aequorin Aequorin plasmids are provided by the state university of kansas, U.S.A

ViaFect transfection reagents (Promega companies, the U.S.)

Coelenterazine Coelanterazine H storage solutions (Life-technologies companies, the U.S.)

Chinese hamster ovary celI (insecticide molecular ecology research department of Southwestern University preserves and provides)

Each sequent synthesis in the embodiment of the present invention are completed by Sangon Biotech (Shanghai) Co., Ltd..

The experimental technique of unreceipted actual conditions in embodiment, generally according to normal condition, or is built according to manufacturer The condition of view.

The acquisition of the open reading frame sequence of embodiment one, citrus fruit fly neuropeptide Corazonin and its receptor

1st, the open reading frame sequence of citrus fruit fly neuropeptide Corazonin and its receptor Corazonin receptor draws Thing is designed and is expanded

Based on genome and transcript profile data, using bioinformatics method, through to fruit bat neuropeptide Corazonin (Genbank No.NP_524350.1) and fruit bat neuropeptide receptor Corazonin receptor (Genbank No.AF373862.3) compare repeatedly and analyze, the Chao Shi PCR for designing citrus fruit fly neuropeptide Corazonin and its receptor are special Property primer, sequence are as follows：

Citrus fruit fly total serum IgE is extracted with RNA extracts kits, is cDNA with reverse transcription reagent box reverse transcription.

Amplification citrus fruit fly neuropeptide Corazonin sequences：The reaction system of 50 μ L includes 24 μ L deionized waters, 20 μ L 2 × PrimeSTAR Max Premix, primer Corazonin-F1 and Corazonin-R1 each 2 μ L (concentration is 10 μM), 2 μ L Citrus fruit fly cDNA templates.First round PCR amplification condition is as follows:Denaturation：98 DEG C of reaction 2min；Subsequently, 98 DEG C of degeneration 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1.5min, circulate 35 times；Last 72 DEG C of extensions 10min.Take the expansion that first round PCR amplifications are obtained Templates of the volume increase 2 μ L of thing as the second wheel PCR amplifications, amplimer Corazonin-F2 and Corazonin-R2,50 μ L's Remaining component of reaction system is identical when expanding with the first round, and the second wheel PCR amplification conditions are identical with the first round.

Amplification citrus fruit fly neuropeptide Corazonin receptor sequences：The reaction system of 50 μ L, and the PCR of first and second wheel Amplification condition is identical with during aforementioned amplification Corazonin sequences, only the primer of the first round need to be changed to CorazoninGPCR-F1 And CorazoninGPCR-R1, second wheel primer be changed to CorazoninGPCR-F2 and CorazoninGPCR-R2.

2nd, amplified production is building up in carrier T

The citrus fruit fly neuropeptide Corazonin and Corazonin donor products of aforementioned amplification are building up to into carrier T respectively On, operating procedure is as follows：

1) connect：Citrus fruit fly neuropeptide Corazonin amplified productions or Corazonin receptors amplified production are connected To on pGEM-T Easy Vector, DNA ligation kit is shown in concrete operations.

2) convert：In superclean bench by 2.5 μ L steps 1) in connection product be added to the Trans5 α competence of 50 μ L In cell, mix, put ice bath 30min on ice.42 DEG C of water-bath thermal shock 65sec, place into 5min in ice bath.Add without ammonia benzyl resistance 200 μ L LB fluid mediums, 250rpm shaken cultivation 1h under the conditions of 37 DEG C.On the LB solid mediums for adding ammonia benzyl, The 80 μ L of bacterium solution for having activated are uniformly coated on above-mentioned LB flat boards, 37 DEG C of overnight incubations, the just round bacterial plaque bacterium of picking white Fall 37 DEG C to shaking bacterium culture 3-5h, with universal primer M13 (upstreams：GCCAGGGTTTTCCCAGTCACGA, downstream： GAGCGGATAACAATTTCACACAGG) enter performing PCR Rapid identification, electrophoresis detection goes out the band of about 1000bp or so, the company of explanation Thing of practicing midwifery successfully is building up in carrier T, the bacterium solution for detecting purpose band is sent to sequencing, after sequencing determines that sequence is errorless, is used Extraction of plasmid DNA test kit extracts plasmid DNA, is stored in -20 DEG C.

By sequencing, the cDNA sequence of citrus fruit fly neuropeptide Corazonin and its receptor is obtained.

The cDNA sequence of citrus fruit fly neuropeptide Corazonin is following (such as SEQ ID NO in sequence table:Shown in 9)： TACACAAGCAAACGGCTTTTTATTAAAACATAAACATCATGTTCAAATTATTCTTCTCATTGGCTGTCCTCTGCTTC TTGGCCACATGCTTCGGCCAAACGTTTCAATACTCACACGGCTGGACCAGCGGCAAACGAGCGGTGAACACTCATCG TGACAATGATATTGCCGAAATGCTCCAACAAGATGGCGACCGCAAATTGGAAAGATGTCTCATGCAGTTGCAATATT TATTACACAATCCCCTGTCGATCCGTGCCGGCGTTCAAGCCCTGACTCCAGCAAATGGTAATCTATTTGGAAATCGT CATCAATCAAATGAATTGTATGAAGAGCTGAATGCTGCCGAGACGAACGATTATGGAAAGCATTAAAACATGATTAT GGCCATAAAATATTAATAAAACGAAGCGACTCCACACGAATTTAGTAGTATATTTAATAGAATATTTGGAACAGCAT ACATACACATTTACATAATACAGTTATTTATTGTACATATGTATGATTTCGTTAACATATTTTACGAACTACAATTA TACTATTATATGCATTTGCAAGTTTAAAAATACTATGATTGTGCATACTTTTACATATATACATGCATACATACCAT ATGTGTGAAAAATAAAAAAAATCTTGAAAGTAAAAATCTAAAAAACGCAAATATAGCAGAAAGCTAAGTTGAAAAAC AAGTAAAGTGTATGTTAGTGTCAAAGAAGGGAGTAAAAAGATGTTTA

SEQ ID NO in the aminoacid sequence such as sequence table of the protein of neuropeptide Corazonin codings:Shown in 10.It is logical Cross to neuropeptide sequence structure feature (cleavage site of mature peptide be usually " Arg ", " Lys " combination；" Gly " is amidatioon position Point) analysis draw, underscore part for citrus fruit fly neuropeptide Corazonin parts nucleotide sequence (in sequence table SEQ ID NO:Shown in 11), it is the peptide sequence of the part translation below：

BdCZ：QTFQYSHGWTSa is (such as SEQ ID NO in sequence table:Shown in 12)

Note：" a " represents amidatioon.

Measure SEQ ID in the cDNA sequence such as sequence table of citrus fruit fly neuropeptide receptor Corazonin receptor NO:Shown in 13, SEQ ID NO in the aminoacid sequence such as sequence table of Corazonin receptor:Shown in 14.

Embodiment two, based on intracellular calcium flow detection method determine citrus fruit fly neuropeptide Corazonin with The binding ability of its receptor Corazonin receptor

1st, build Chinese hamster ovary celI (Chinese hamster ovary cell) expression plasmid of citrus fruit fly Corazonin receptor

The citrus fruit fly neuropeptide Corazonin receptor being connected in carrier T for obtaining will be reclaimed in embodiment one Plasmid and pcDNA3.1 (+) plasmid, connect (T4DNA ligases) respectively Jing after NotI single endonuclease digestion enzyme action, with reference to enforcement after connection Method for transformation in example one is converted, and (enters performing PCR detection, T7 with universal primer T7/BGH after bacterium solution positive identification is errorless： TAATACGACTCACTATAGGG, BGH：TAGAAGGCACAGTCGAGG), plasmid is extracted with plasmid extraction kit, that is, obtain It is built with pcDNA3.1 (+) plasmid of Corazonin receptor fragments.

Cotransfection, is operated in accordance with the following steps：

1) prepare 1.5mL serum-free mediums DMEM/F-12medium to manage in EP.

2) in EP pipes, addition is built with pcDNA3.1 (+) plasmid and aequorin of Corazonin receptor fragments The each 7.5 μ g of Aequorin plasmids.

3) 45uL ViaFect transfection reagents are added in EP pipes, using pipettor gently mix homogeneously back and forth.

4) it is stored at room temperature 15min.

5) by the mixing liquid of above-mentioned transfection, uniformly point is added dropwise to preprepared Chinese hamster ovary celI, and incubated overnight is at least 24h。

2nd, detect intracellular calcium：

1) collect cell：After aforementioned cotransfection incubated overnight terminates, original cell culture medium is removed, add 2-3mL pancreases Protease, after 3min, blows and beats cell with disposable ear washing bulb pipe, collects in the centrifuge tube of 50mL.

2) centrifuge tube is centrifuged into 3min under the conditions of room temperature, 1000g (2500rpm).

3) supernatant is transferred in light-protected vials, and adds the serum-free medium re-suspended cell of 3mL.

4) 30 μ L coelenterazine Coelanterazine H storage solutions (500 μM) (ultimate densities are added in light-protected vials Should be 5 μM).

5) magnetic agitation 3h is carried out in light-protected vials.

6) the addition 27mL serum-free mediums in light-protected vials so as to which final volume is 30mL, and constantly magnetic agitation 30min。

7) ligand polypeptide for synthesizing is measured with the binding ability of receptor using multi-function microplate reader.

The ligand polypeptide of synthesis is matched somebody with somebody as shown in figure 1, showing to the binding ability testing result of Corazonin receptor Body BdCZ has an activation capability to this receptor, and (peptide sequence is to compare BmAKH：Cys-Glu-Leu-Thr-Phe-Ser- Pro-Asp-Thr-NH2 it is) not active to this receptor.The EC50 values (concentration in maximum luminous value) of wherein BdCZ are respectively 52.5nM.Determine BdCZ as mode ligands with this.Embodiment three, based on RNA interference methods determine citrus fruit fly neuropeptide receptor Corazonin receptor silence efficiencies

1) citrus fruit fly total serum IgE is extracted with RNA extracts kits, be cDNA with reverse transcription reagent box reverse transcription, then with this CDNA is template, enters performing PCR amplification using the primer containing T7 promoteres, and reaction condition is：95 DEG C of denaturations 3min；95 DEG C of degeneration 30s, 60 DEG C of annealing 10s, 72 DEG C of extension 2min, totally 35 circulations；Extend 10min under the conditions of 72 DEG C.PCR reaction systems totally 25 μ L, including：CDNA template 0.5 μ l of the concentration for 1000ng/ μ l, concentration are 0.15-0.25 μM of upstream and downstream primer 12.5 μ l of (CorazoninGPCR-dsF, CorazoninGPCR-dsR) each 1 μ l, PrimeSTAR Max Premix and go 10 μ l of nuclease water, primer details see the table below：

Note：In primer sequence, dashed part represents T7 promoter sequences

2) using step 1) in PCR primer with glue reclaim purification kit to specifications purification reclaim after as synthesize The transcription templates of dsRNA, with vitro synthesized RNA test kit TranscriptAid T7High Yield Transcription Kit transcribes synthesis according to operation instruction and purification obtains the dsRNA solution of citrus fruit fly Corazonin receptor, will DsRNA solution concentrations are diluted to 3000ng/ μ l.DsRNA synthetic reactions system is 20 μ l, including：4 μ l (about 1 of cDNA templates μ g), 5 × TranscrptAid Reaction Buffer, 4 μ l, concentration for 100mM 8 μ of ATP/CTP/GTP/ Μ TP Mix 2 μ l and DEPC-treated water of l, TranscriptAid Enzyme Mix, 2 μ l；Reaction condition is：37 DEG C of incubation 4h.

Simultaneously by the use of said method synthesis and purification obtain GFP (green fluorescent protein) dsRNA solution it is right as feminine gender According to the cDNA that reverse transcription is obtained enters the upstream and downstream primer sequence (GFP-dsF, GFP-dsR) such as upper table institute used when performing PCR is expanded Show.

3) taking citrus fruit fly carries out microinjection with a batch of 7 day old larva.Polypide is placed on hand during injection, gently Pin, with Nanoject IIAuto_NaIloliter microinjection instruments (Dmmmond) to citrus fruit fly internal injection dsRNA, Injection position is located at the internode of polypide section third from the bottom, and injection volume is 2 μ g/ heads.After injection is finished, larva is placed in into temperature 27 L DEG C of scholar, 75 scholar 5% of relative humidity, raise in completely black dark environment.45 larvas of per group of injection, arrange and repeat 3 biologys.

Matched group is arranged：Injection does not have the GFP genes of homology as negative control with citrus fruit fly, detects dsRNA's Toxicity, observes the situation of movement of injection efficiency and dsRNA in polypide.

4) in order to detect the interference effect after injection dsRNA to target gene, using qPCR technologies to the gene after RNAi Expression is detected.After the dsRNA24h of injection PBS, GFP or Corazonin receptor, the polypide liquid of survival is collected After nitrogen process, RNA is extracted, and reverse transcription detects the expression situation of change of gene respectively into cDNA.As a result show Corazonin receptor significances are reduced, as a result as shown in Fig. 2 figure is to inject PBS and GFP as heavy under control case Silent Efficiency testing, as a result shows that PBS and GFP injections do not have a significant impact to gene expression amount, and Corazonin Receptor dsRNA (dsCZR) injection group gene expression amount significance is lowered, and is shown in RNA interfering processes, corresponding gene Can be by effectively silence.

5) after injecting dsRNA, using the growth promoter situation of LelcaMl65c every group of larva of micro- sem observation, until pupating Till, statistical analysiss are carried out to accumulative phenotypic ratio and the time of pupating.As a result show to inject the dsRNA of Corazonin receptor Afterwards, larvae pupation time significance postpones, as a result as shown in figure 3, injection PBS and GFP is used as under control case, after RNA interference Larvae pupation time and percentage of pupation statistical result show that PBS and GFP injections were had not significant impact to the larvae pupation time, its larva Can normally pupate in 24h, percentage of pupation is close to 100%, and Corazonin receptor dsRNA (dsCZR) injections group is young Worm pupate significance delay, the percentage of pupation in the 24h time periods is only 17%, and time delay is about 72h.

Sequence table

<110>Southwestern University

<120>Neuropeptide Corazonin and its acceptor gene and the application in citrus fruit fly specificity controlling agent

<160> 18

<210> 1

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<223> Corazonin-F1

<400> 1

caaacggctt tttattaaaa c 21

<210> 2

<211> 21

<212> DNA

<213>Artificial sequence

<223> Corazonin-R1

<400> 2

ctactaaatt cgtgtggagt c 21

<210> 3

<211> 22

<212> DNA

<213>Artificial sequence

<223> Corazonin-F2

<400> 3

catcatgttc aaattattct tc 22

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence

<223> Corazonin-R2

<400> 4

gccataatca tgttttaatg c 21

<210> 5

<211> 22

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-F1

<400> 5

acctcgaaaa atcactaaat gg 22

<210> 6

<211> 21

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-R1

<400> 6

cacatactcc cctccacaga c 21

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-F2

<400> 7

ctaaatggaa ggtgcaagtg tg 22

<210> 8

<211> 24

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-R2

<400> 8

ctcgcttaca cattagagat atgc 24

<210> 9

<211> 740

<212> DNA

<213>Artificial sequence

<223>Citrus fruit fly neuropeptide Corazonin genes

<400> 9

tacacaagca aacggctttt tattaaaaca taaacatcat gttcaaatta ttcttctcat 60

tggctgtcct ctgcttcttg gccacatgct tcggccaaac gtttcaatac tcacacggct 120

ggaccagcgg caaacgagcg gtgaacactc atcgtgacaa tgatattgcc gaaatgctcc 180

aacaagatgg cgaccgcaaa ttggaaagat gtctcatgca gttgcaatat ttattacaca 240

atcccctgtc gatccgtgcc ggcgttcaag ccctgactcc agcaaatggt aatctatttg 300

gaaatcgtca tcaatcaaat gaattgtatg aagagctgaa tgctgccgag acgaacgatt 360

atggaaagca ttaaaacatg attatggcca taaaatatta ataaaacgaa gcgactccac 420

acgaatttag tagtatattt aatagaatat ttggaacagc atacatacac atttacataa 480

tacagttatt tattgtacat atgtatgatt tcgttaacat attttacgaa ctacaattat 540

actattatat gcatttgcaa gtttaaaaat actatgattg tgcatacttt tacatatata 600

catgcataca taccatatgt gtgaaaaata aaaaaaatct tgaaagtaaa aatctaaaaa 660

acgcaaatat agcagaaagc taagttgaaa aacaagtaaa gtgtatgtta gtgtcaaaga 720

agggagtaaa aagatgttta 740

<210> 10

<211> 111

<212> PRT

<213>Artificial sequence

<223>The protein of citrus fruit fly neuropeptide Corazonin gene codes

<400> 10

Met Phe Lys Leu Phe Phe Ser Leu Ala Val Leu Cys Phe Leu Ala Thr

1 5 10 15

Cys Phe Gly Gln Thr Phe Gln Tyr Ser His Gly Trp Thr Ser Gly Lys

20 25 30

Arg Ala Val Asn Thr His Arg Asp Asn Asp Ile Ala Glu Met Leu Gln

35 40 45

Gln Asp Gly Asp Arg Lys Leu Glu Arg Cys Leu Met Gln Leu Gln Tyr

50 55 60

Leu Leu His Asn Pro Leu Ser Ile Arg Ala Gly Val Gln Ala Leu Thr

65 70 75 80

Pro Ala Asn Gly Asn Leu Phe Gly Asn Arg His Gln Ser Asn Glu Leu

85 90 95

Tyr Glu Glu Leu Asn Ala Ala Glu Thr Asn Asp Tyr Gly Lys His

100 105 110

<210> 11

<211> 33

<212> DNA

<213>Artificial sequence

<223>Citrus fruit fly neuropeptide Corazonin ligand genes

<400> 11

caaacgtttc aatactcaca cggctggacc agc 33

<210> 12

<211> 11

<212> PRT

<213>Artificial sequence

<223>Citrus fruit fly neuropeptide Corazonin ligand polypeptides

<400> 12

Gln Thr Phe Gln Tyr Ser His Gly Trp Thr Ser

1 5 10

<210> 13

<211> 2008

<212> DNA

<213>Artificial sequence

<223>Citrus fruit fly neuropeptide receptor Corazonin receptor genes

<400> 13

tacaaattta cctcgaaaaa tcactaaatg gaaggtgcaa gtgtggtggc aacaaccatt 60

ctcaatcctc aagcagccgt gggagcaatg cttgaacatt tcgcagagaa tttaagccac 120

ccacagcagt attacgagag tcatgaaccc catgcacgat tggcggcagc cgcaattgcc 180

acaacaacac taccaaatat agcactgtca cgtttggcgc aagttctcac aataacacaa 240

aatttaacgg ataataccac aatatatcct tatctgccag acacgttaga cacaacactt 300

acaccgtcag caacgagtaa agaagttttc tacactcatg cgccacaatt ctccaccacc 360

acgctgataa aggtctgtgt gctgggtgtg atggcgattt tctcactctt cggcaatatg 420

ctcaccatgt ggaacatcta taagacacgc ttcaagcggc gtagcttgcg caactcttgg 480

aatgccatct attcgttgtt gtttcatcta tcgatcgccg atttgcttgt aactggtttc 540

tgtattatcg gcgaggcggc ctgggcgtac acggtgcaat ggcgtggcgg tgatcttttg 600

tgcaaattct tcaagctctt ccagatgttc agtttatatt tatccactta tgtgatggtg 660

ctaatcggtg tggatcgttg gtttgcggtg aaatttccca tgcgatcgtt atatatgacc 720

aagagatgct atcaatttct gggcattgtc tacatgtctt cgttcatatt gagcatacca 780

cagtttttca tatttcattt atcgcgcggc ccgttcatcg aagacttcca tcaatgcgtg 840

acgcatggca cctacacggc accctggcag gagcagagct acaccacatt cacgctattc 900

agcacatttc tgataccctt ttgtgtgctc accgtcacct acatttccac gttccgggcg 960

atttcacgaa gtgaaaagat atttttgggt ccgcaacagg agccgcacac gagcgccaat 1020

ttaatgcata cgaatcgaca acggctcata cataaggcga aaatgaattc gctgcgactg 1080

tcttttgtga taataattgc atttctcatt tgctgggcac cctactgtac gctcatggtg 1140

ctgctacagt ttgtcgacat cgacgatgcg accagcaaaa gattaattga tggcatattc 1200

ttctttggca tgtccaatag tctggtgaat cctctcatat acggcgcctt ccatctgcac 1260

actataaaga gtaaatcgag cgataaaggc gggaatggtg gctatagtct aaatagagcc 1320

gactcgcagc gtaatccatc catgctaacg gctgttacac aaatcgacgg cagcggacgc 1380

agcacacgcg tcaaccgaca gcccagctat tatcgcgccc aacacaattt cagcaactcc 1440

agcaaggagc aggccagcct gctgcagatg acccccacca ccgccatcgt gcataaattc 1500

aattcgaact ctgaacgcag ttcagtgggt tcatcgccgc aaacctgctc cacaaatttt 1560

acacgcagcg agatgggcga ccacgaacac gagagcggct gcgaagggaa cggtggcggt 1620

ggcgctaagc gcgatgcaaa ttcacacagc accacggtgg tgtatagctt taagaagcca 1680

gccattttgc gcgcacaaag tttcgaggca ttagcaattg cgccgcccaa taatcgtatg 1740

caagcgccga aagctgcgcc acctgtgtcc gagaatggct tccatcggtc ggtgtgtgtg 1800

ttgagcttgg aagattgtaa gatatgcgcc gatgagcata tctctaatgt gtaagcgagt 1860

gtctgtggag gggagtatgt gtgtatgtgg gggatttgca tacaaaatac ttttcgaaaa 1920

agttccttat ttaagtaaca catccggtta tgtgtgcgtg tacataactg cttgtttacg 1980

taagtatata tgtaggtata tatttata 2008

<210> 14

<211> 608

<212> PRT

<213>Artificial sequence

<223>The protein of citrus fruit fly neuropeptide receptor Corazonin receptor gene codes

<400> 14

Met Glu Gly Ala Ser Val Val Ala Thr Thr Ile Leu Asn Pro Gln Ala

1 5 10 15

Ala Val Gly Ala Met Leu Glu His Phe Ala Glu Asn Leu Ser His Pro

20 25 30

Gln Gln Tyr Tyr Glu Ser His Glu Pro His Ala Arg Leu Ala Ala Ala

35 40 45

Ala Ile Ala Thr Thr Thr Leu Pro Asn Ile Ala Leu Ser Arg Leu Ala

50 55 60

Gln Val Leu Thr Ile Thr Gln Asn Leu Thr Asp Asn Thr Thr Ile Tyr

65 70 75 80

Pro Tyr Leu Pro Asp Thr Leu Asp Thr Thr Leu Thr Pro Ser Ala Thr

85 90 95

Ser Lys Glu Val Phe Tyr Thr His Ala Pro Gln Phe Ser Thr Thr Thr

100 105 110

Leu Ile Lys Val Cys Val Leu Gly Val Met Ala Ile Phe Ser Leu Phe

115 120 125

Gly Asn Met Leu Thr Met Trp Asn Ile Tyr Lys Thr Arg Phe Lys Arg

130 135 140

Arg Ser Leu Arg Asn Ser Trp Asn Ala Ile Tyr Ser Leu Leu Phe His

145 150 155 160

Leu Ser Ile Ala Asp Leu Leu Val Thr Gly Phe Cys Ile Ile Gly Glu

165 170 175

Ala Ala Trp Ala Tyr Thr Val Gln Trp Arg Gly Gly Asp Leu Leu Cys

180 185 190

Lys Phe Phe Lys Leu Phe Gln Met Phe Ser Leu Tyr Leu Ser Thr Tyr

195 200 205

Val Met Val Leu Ile Gly Val Asp Arg Trp Phe Ala Val Lys Phe Pro

210 215 220

Met Arg Ser Leu Tyr Met Thr Lys Arg Cys Tyr Gln Phe Leu Gly Ile

225 230 235 240

Val Tyr Met Ser Ser Phe Ile Leu Ser Ile Pro Gln Phe Phe Ile Phe

245 250 255

His Leu Ser Arg Gly Pro Phe Ile Glu Asp Phe His Gln Cys Val Thr

260 265 270

His Gly Thr Tyr Thr Ala Pro Trp Gln Glu Gln Ser Tyr Thr Thr Phe

275 280 285

Thr Leu Phe Ser Thr Phe Leu Ile Pro Phe Cys Val Leu Thr Val Thr

290 295 300

Tyr Ile Ser Thr Phe Arg Ala Ile Ser Arg Ser Glu Lys Ile Phe Leu

305 310 315 320

Gly Pro Gln Gln Glu Pro His Thr Ser Ala Asn Leu Met His Thr Asn

325 330 335

Arg Gln Arg Leu Ile His Lys Ala Lys Met Asn Ser Leu Arg Leu Ser

340 345 350

Phe Val Ile Ile Ile Ala Phe Leu Ile Cys Trp Ala Pro Tyr Cys Thr

355 360 365

Leu Met Val Leu Leu Gln Phe Val Asp Ile Asp Asp Ala Thr Ser Lys

370 375 380

Arg Leu Ile Asp Gly Ile Phe Phe Phe Gly Met Ser Asn Ser Leu Val

385 390 395 400

Asn Pro Leu Ile Tyr Gly Ala Phe His Leu His Thr Ile Lys Ser Lys

405 410 415

Ser Ser Asp Lys Gly Gly Asn Gly Gly Tyr Ser Leu Asn Arg Ala Asp

420 425 430

Ser Gln Arg Asn Pro Ser Met Leu Thr Ala Val Thr Gln Ile Asp Gly

435 440 445

Ser Gly Arg Ser Thr Arg Val Asn Arg Gln Pro Ser Tyr Tyr Arg Ala

450 455 460

Gln His Asn Phe Ser Asn Ser Ser Lys Glu Gln Ala Ser Leu Leu Gln

465 470 475 480

Met Thr Pro Thr Thr Ala Ile Val His Lys Phe Asn Ser Asn Ser Glu

485 490 495

Arg Ser Ser Val Gly Ser Ser Pro Gln Thr Cys Ser Thr Asn Phe Thr

500 505 510

Arg Ser Glu Met Gly Asp His Glu His Glu Ser Gly Cys Glu Gly Asn

515 520 525

Gly Gly Gly Gly Ala Lys Arg Asp Ala Asn Ser His Ser Thr Thr Val

530 535 540

Val Tyr Ser Phe Lys Lys Pro Ala Ile Leu Arg Ala Gln Ser Phe Glu

545 550 555 560

Ala Leu Ala Ile Ala Pro Pro Asn Asn Arg Met Gln Ala Pro Lys Ala

565 570 575

Ala Pro Pro Val Ser Glu Asn Gly Phe His Arg Ser Val Cys Val Leu

580 585 590

Ser Leu Glu Asp Cys Lys Ile Cys Ala Asp Glu His Ile Ser Asn Val

595 600 605

<210> 15

<211> 40

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-dsF

<400> 15

taatacgact cactataggg ttacacaaat cgacggcagc 40

<210> 16

<211> 40

<212> DNA

<213>Artificial sequence

<223> CorazoninGPCR-dsR

<400> 16

taatacgact cactataggg gctgtgtgaa tttgcatcgc 40

<210> 17

<211> 41

<212> DNA

<213>Artificial sequence

<223> GFP-dsF

<400> 17

taatacgact cactataggg cagttcttgt tgaattagat g 41

<210> 18

<211> 41

<212> DNA

<213>Artificial sequence

<223> GFP-dsR

<400> 18

taatacgact cactataggg tttggtttgt ctcccatgat g 41

Claims (6)

1. a kind of protein of citrus fruit fly neuropeptide Corazonin genes and its coding, it is characterised in that the citrus fruit fly The nucleotide sequence of neuropeptide Corazonin genes such as SEQ ID NO:Shown in 9, the aminoacid sequence of the protein of its coding is such as SEQ ID NO:Shown in 10.

2. a kind of amplification method of the citrus fruit fly neuropeptide Corazonin genes described in claim 1, it is characterised in that bag Include following steps：Citrus fruit fly total serum IgE is extracted, reverse transcription is cDNA, the amplification method of nest-type PRC is adopted with cDNA as template, The first round amplification primer be Corazonin-F1 and Corazonin-R1, second wheel amplification primer be Corazonin-F2 and Corazonin-R2, the sequence of the primer is：

Corazonin-F1：CAAACGGCTTTTTATTAAAAC,

Corazonin-R1：CTACTAAATTCGTGTGGAGTC,

Corazonin-F2：CATCATGTTCAAATTATTCTTC,

Corazonin-R2：GCCATAATCATGTTTTAATGC.

3. the protein of a kind of citrus fruit fly neuropeptide Corazonin ligand genes and its coding, it is characterised in that the Fructus Citri tangerinae is little The nucleotide sequence such as SEQ ID NO of trypetid neuropeptide Corazonin parts:Shown in 11, the nucleotide sequence coded egg The aminoacid sequence of white matter is respectively such as SEQ ID NO:Shown in 12.

4. the protein of a kind of citrus fruit fly neuropeptide receptor Corazonin receptor genes and its coding, its feature exist In the nucleotide sequence such as SEQ ID NO of the citrus fruit fly neuropeptide receptor Corazonin receptor genes:13 institutes Show, the aminoacid sequence such as SEQ ID NO of the protein of its coding:Shown in 14.

5. the amplification method of the citrus fruit fly neuropeptide receptor Corazonin receptor genes described in a kind of claim 4, Characterized in that, comprising the steps：Citrus fruit fly total serum IgE is extracted, and reverse transcription is cDNA, nido is adopted by template of cDNA The amplification method of PCR, the primer of first round amplification is CorazoninGPCR-F1 and CorazoninGPCR-R1, and second takes turns amplification Primer be CorazoninGPCR-F2 and CorazoninGPCR-R2, the sequence of the primer is：

CorazoninGPCR-F1：ACCTCGAAAAATCACTAAATGG,

CorazoninGPCR-R1：CACATACTCCCCTCCACAGAC,

CorazoninGPCR-F2：CTAAATGGAAGGTGCAAGTGTG,

CorazoninGPCR-R2：CTCGCTTACACATTAGAGATATGC.

6. protein, the claim of the citrus fruit fly neuropeptide Corazonin genes and its coding described in a kind of claim 1 Citrus fruit fly neuropeptide Corazonin ligand genes described in 3 and its Fructus Citri tangerinae described in the protein or claim 4 of coding The protein of little trypetid neuropeptide receptor Corazonin receptor genes and its coding, answering in terms of trypetid neuroregulation With, the application in trypetid preventing and treating, or the application in terms of trypetid insecticide is prepared.