CN106636089B - A kind of short and small non-coding RNA and its application - Google Patents
A kind of short and small non-coding RNA and its application Download PDFInfo
- Publication number
- CN106636089B CN106636089B CN201610874030.4A CN201610874030A CN106636089B CN 106636089 B CN106636089 B CN 106636089B CN 201610874030 A CN201610874030 A CN 201610874030A CN 106636089 B CN106636089 B CN 106636089B
- Authority
- CN
- China
- Prior art keywords
- mir
- crystal methamphetamine
- rna
- methamphetamine
- drug
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of short and small non-coding RNA and its applications, it is characterized by: the RNA is miR-219a-5p, its nucleotides sequence is classified as SEQ ID No.1, compared with prior art, the advantage of the invention is that confirming through a large number of experiments, in establishing crystal methamphetamine rat model, crystal methamphetamine causes microRNA to change in nucleus accumbens septi expression, after the miR-219a-5p nucleus accumbens septi overexpression for targeting AT1, inhibiting effect is played to Addictive Behaviors caused by Methamphetamine, illustrate that miR-219a-5p can be applied to treatment crystal methamphetamine habituation, it is quit drug abuse using exploitation as gene therapy.
Description
Technical field
The present invention relates to a kind of short and small non-coding RNAs more particularly to a kind of miR-219a-5p to prepare anti-crystal methamphetamine
Application in dependence producing drug.
Background technique
Crystal methamphetamine (METH), is commonly called as methamphetamine, is a kind of white amphetamine synthesis class drugs.High dose is long-term anti-
Multiple user can suffer from mental disease, including depression, mania, schizophrenia etc. altogether, and serious person will cause toxic psychosis, performance
For persecutory delusion and illusion, excessively uses and tendency of committing suiside and murder even occur.Period, methamphetamine dependent's meeting are given up in methamphetamine
There is the spiritual emotional change of insomnia, depression, mania and anxiety, and these abstinence reactions also become influence methamphetamine dependent
The major physiological factor of habituation.
The ratio that crystal methamphetamine habituation suffers from mental disease altogether has reached 20-30%, and addict usually will appear depression, coke
The symptoms such as worry, schizophrenia.Crystal methamphetamine can also generate serious neurotoxicity, and crystal methamphetamine, which is used for a long time, to be caused
Cognitive function damage.Therefore the research of crystal methamphetamine habituation mechanism and the searching of therapeutic agent, also gradually to other spirit
Extend with the nervous system disease.Periphery renin-angiotensin system (RAS) is to the function of cardiovascular system, electrolyte and body
The balance and blood pressure control of liquid play an important role.Feritin enters blood circulation through renal vein, starts chain reaction, by
Proangiotensin gradually generates angiotensin I (AngI) and II (AngII), and further generates AngIII and AngIV etc.
Mediator.In addition in peripheral-system, for maincenter there is also a relatively independent RAS system, chief component is AngII.Maincenter
AngII is the neuropeptide with pleiotropism, is present on neuron cell body, aixs cylinder and nerve endings, plays to maincenter
Multiple adjustment effect.There are two types of ATR1 and ATR2 for the major receptors of AngII.Maincenter AngII mainly by being incorporated in ATR1 in
Pivot system, which plays, adjusts endocrine, sympathetic and stress response system effect.ATR1 receptor is divided into the two kinds of Asias ATR1a and ATR1b again
Type.Research also indicates that maincenter AngII and a variety of neural and mental disease pathogenesis, and there are correlations, including Alzheimer
Disease, parkinsonism, Neurogenic inflammatory, apoplexy, two-way personality disorder, epilepsy etc..So far, there are no one to be directed to methylbenzene
The active drug of propylamine addiction therapy.Latent effect and applicant of the maincenter AngII in a variety of spirit and the nervous system disease
The previous work of study group prompts, and maincenter AngII and ATR1 may be from improving and treatment crystal methamphetamine habituation and altogether
Suffer from phrenoblabia, provides new target spot for the research of crystal methamphetamine addiction therapy drug.
Find microRNA for the first time in Caenorhabditis elegans within 1992.Later, largely research shows that miRNAs is in base
Because being of crucial importance in expression.MiRNAs is a kind of RNA of short and small non-coding, it only has 21-25 nucleotides sequence
Column.MiRNA transcribes out longer primary miRNA in nucleus first, is then processed into 60~70 by Drosha in core
The hairpin RNA of nucleotide, i.e. precursor miRNA are transported out karyon with the help of Exprotin-5 compound, in endochylema
Maturation miRNA is become by Dicer shearing, is integrated into RNA silencing complex immediately.MiRISC is by holding target non-codings with 3 '
Area targets mRNA according to basepairing rule come the translation of suppressor or the degradation of induction mRNA.Recently, increasingly
The sight of more researchers focuses adjustment effect of the miRNA in various addictive drugs, including cocaine, Hai Ruoyin, phenylpropyl alcohol
Amine and alcohol.Long-term cocaine can also be raised in corpus straitum using the downward for causing miR-134 and miR-135a in hippocampus
MiR-181a, miR-212 and lower terminal mucro (CPU) miR-124.It alcohol addiction and gives up and leads to miR-155 and miR-
The up-regulation of 375 expression.However, most of research is concentrated mainly on miRNA in cocaine or alcohol addiction at present, methylbenzene
Propylamine habituation correlative study is less, and the microRNA adjustment mechanism in crystal methamphetamine habituation is also indefinite at present.
Summary of the invention
A technical problem to be solved by this invention is to provide a kind of short and small non-volume for above-mentioned state of the art
Code RNA.
Another technical problem to be solved by this invention is provided a kind of above-mentioned short for above-mentioned state of the art
The application of small non-coding RNA.
The technical scheme of the invention to solve the technical problem is: the RNA of the short and small non-coding, feature exist
In: the RNA is miR-219a-5p, and nucleotides sequence is classified as SEQ ID No.1.
The present invention also provides a kind of RNA of short and small non-coding to prepare the application in anti-crystal methamphetamine dependence producing drug.
Further, the drug is included the nucleic acid of SEQ ID No.1 shown in sequence table as effective quantity and can pharmaceutically be connect
Carrier or the auxiliary material composition received.
Further, the effective dose of the drug is 6~20 μ l/kg.
Further, the drug is injection medicament.
It is big establishing crystal methamphetamine compared with the prior art, the advantages of the present invention are as follows confirming through a large number of experiments
In mouse model, crystal methamphetamine cause microRNA nucleus accumbens septi expression change, target AT1 miR-219a-5p volt every
After core is overexpressed, inhibiting effect is played to Addictive Behaviors caused by Methamphetamine, illustrates that miR-219a-5p can be applied
To treatment crystal methamphetamine habituation, quit drug abuse using exploitation as gene therapy.
Detailed description of the invention
Fig. 1 is the foundation of crystal methamphetamine habituation model in the present invention；
Fig. 2 is the comparison figure that crystal methamphetamine causes miR-219a-5p expression quantity in nucleus accumbens septi in the present invention；
Fig. 3 is the microRNA dendrogram that crystal methamphetamine causes maincenter hypertensin system in the present invention；
Fig. 4 is the microRNA that maincenter hypertensin system is targeted in the present invention；
Fig. 5 is the expression variation diagram of maincenter hypertensin system microRNA in the present invention；
Fig. 6 is that miR-219a-5p nucleus accumbens septi is overexpressed the inhibiting effect for fixed frequency being administered behavior in the present invention；
Fig. 7 is that miR-219a-5p nucleus accumbens septi is overexpressed the inhibiting effect for progression frequency being administered behavior in the present invention；
Fig. 8 is that miR-219a-5p is overexpressed the intervention expressed angiotensin-ii receptor 1 in FR in the present invention；
Fig. 9 is that miR-219a-5p is overexpressed the intervention expressed angiotensin-ii receptor 1 in PR in the present invention.
Specific embodiment
Below by way of accompanying drawings and embodiments are combined, the invention will be further described
Crystal methamphetamine used in the embodiment of the present invention is standard items, is studied from Ningbo City's microcirculation and henbane class medicine
Institute, miR-219a-5p come from Shanghai JiMa pharmacy Technology Co., Ltd.
The foundation of 1 crystal methamphetamine intravenous self administration model of embodiment
Intravenous self administration (Intravenous Drug Self-Administration) is that research drug habit most passes through
One of animal model of allusion quotation, intravenous self administration model are to reflect that drug user actively looks for the classical animal mould of medicine and drug taking behavior
Type can use experimental animal and investigate administration motivation and active compulsive drug use behavior.
Classical Methamphetamine crystal methamphetamine self administration model can be very good simulation, and clinically drug abuse is suffered from
The crystal methamphetamine of person sucks behavior, and rat can produce the automedication of p-Methylamphetamine by training, while train
The behavior reaction rate and dosage of the p-Methylamphetamine constantly risen in journey can reflect drug addict and contact first from the beginning
Base amphetamine is to such a process for largely sucking crystal methamphetamine habituation.
We establish the self administration model of rat with the following method:
Firstly, SD rat carries out jugular vein intubation operation, it is inserted into one section of PE pipe in right jugular vein, and be pierced by body through back
Outside, antibacterial and restore one week or more after operation.Then, rat is trained in self administration operation cage respectively, training every time
The PE pipe of preceding connection rat back and the crystal methamphetamine injecting systems in operation cage；The two nose tentaculums in left and right are set in operation cage,
One of them is effective nose tentaculum, and rat touches nose, and once effective nose tentaculum will obtain needle crystal methamphetamine injection, is operated simultaneously
Cage lamp in cage lights (as a kind of clue with medicine), computer record；Another is invalid nose tentaculum, and rat touches nose one
Invalid nose tentaculum does not have any crystal methamphetamine injection and light down, and only computer records.Between crystal methamphetamine injection twice
There are 20 seconds refractory periods, crystal methamphetamine injection and light will not be had by during which touching the effective nose tentaculum of nose, and only computer records, often
It crystal methamphetamine injection needle number is limited to 50 needles (preventing excess injection dead).32 operation cages are using large server
Computer controls simultaneously, and self administration training software is the AniLabV652 independently write, and training program is fixed ratio
FR1, i.e. rat touch nose, and once effective nose tentaculum obtains needle crystal methamphetamine injection.Rat passes through 3 days, daily 4 hours instructions
After white silk, effectively touches rhinoreaction rate and injection volume obviously rises, tend towards stability within several days finally, so as to form stable methyl
Amphetamine addiction state.
A, method: jugular vein intubation operation is carried out to rat, is restored 3 days later.After recovery, starts self administration, be divided into
Two groups, i.e. crystal methamphetamine group and physiological saline group, every group of 6 mouse.First three days are administration training periods, this stage allows mouse
Association.Continuous administered for fourteen days after association.
A) crystal methamphetamine group: the crystal methamphetamine that solubility is 0.12mg/ml is prepared, according to 0.05mg/kg/infusion
Dosage administration.
B) physiological saline group: the group is control group, is directly administered with physiological saline substitution crystal methamphetamine.
It will be seen from figure 1 that administration number of times crystal methamphetamine group is significantly higher than physiological saline group, and maintain certain level
On, illustrate crystal methamphetamine group habituation, and self administration model has built up.
Expression of the embodiment 2 using Shanghai JiMa pharmacy Technology Co., Ltd qRCR detection kit to miR-219a-5p
It is detected
1. miR-219a-5p reverse transcription reaction system (20 μ l):
| Component | Volume 1rxns |
| 5X MMLV RT Buffer | 4μl |
| dNTP(10mM) | 0.75μl |
| MiRAN&U6snRNA RT primer mix(1μM) | 1.2μl |
| RNasin(40U/μl)RNase-free H2O is replaced | 0.25μl |
| MMLV Reverse Transcriptase(200U/μl) | 0.2μl |
| RNA Sample | Xμl |
| RNase-free H2O | To 20μl |
After the above system mixes, 25 DEG C are incubated for 30 minutes, and 42 DEG C are incubated for 30 minutes, and 85 DEG C are incubated for 5 minutes, and 4 DEG C spare.
2. (PCR kit is derived from Shanghai JiMa pharmacy Technology Co., Ltd, miR- to microRNA real-time PCR
The primer of 219a-5p is synthesized by Shanghai JiMa pharmacy Technology Co., Ltd)
Primer are as follows:
F Primer:CTGATTCCCTGATTGTCCAAAC
R Primer:TATGCTTGTTCTCGTCTCTGTGTC
| Component | Volume 1rxns | |
| 2X Real-time PCR Master Mix(SYBR) | 1X | 10μl |
| miRAN/U6snRNA specific Primer set(10μM) | 0.2μM | 0.4μl |
| ROX reference dye(50X)Sterilized H2O is replaced | 1Xor5X | 0.4or 2μl |
| Taq DNA polymerase(5U/μl) | 1U | 0.2μl |
| miRNA RT product | 2μl | |
| Sterilized H2O | To20μl |
3. real-time quantitative PCR response procedures
What is identified by qRT-PCR method DNA amplification is purpose RNA (miR-219a-5p, nucleotides sequence
It is classified as sequence 1).
4. the results show that miR-219a-5p content relatively compares normal group mouse in crystal methamphetamine rat model nucleus accumbens septi
It decreased significantly, illustrate in crystal methamphetamine rat nucleus accumbens septi, miR-219a-5p expression declines (result such as Fig. 2 institute
Show).
3 microRNA target prediction of embodiment
According to the discrepant microRNA of the expression screened, carry out microRNA target prediction (based on TargetScan with
The databases such as KEGGpathway), it filters out and target microRNA.
Fig. 3 dendrogram, it is intuitive to reflect that microRNA expression status, Fig. 4 can be seen that in numerous differential expressions
In microRNA, by microRNA target prediction, have 26 it is related with maincenter hypertensin system.From Fig. 5, it can be seen that miR-
The expression multiple highest of 219a-5p, here it is targets of the invention.
The influence of embodiment 4miR-219a-5p rat nucleus accumbens septi overexpression p-Methylamphetamine habituation
In order to clearly target ATR1b microRNA p-Methylamphetamine Addictive Behaviors intervention effect.Experimental animal is first
Crystal methamphetamine self administration training is first carried out, after training successfully, experimental animal is randomly divided into two groups, one group is target
MicroRNA intervention group (LV1-miR) and control group (LV1CN).By the slow virus containing target microRNA plasmid and contain respectively
Have in the slow virus microinjection of empty plasmid to the rat nucleus accumbens septi of target microRNA intervention group and control group.After surgery recovery,
The maintenance of experimental animal progress crystal methamphetamine self administration.Using FR and PR program, compare two groups of animals in crystal methamphetamine
The trend of FR and PR dose-effect curve in the self administration maintenance phase, wherein PR is measured greatly using progression ratio PR3-4 program
The Break-Point (breakpoint) of mouse, different from the fixed ratio program used of training before, rat is obtained under PR3-4 program determination
Obtaining the required effective touching nose number of each heroin injection is in progression ascendant trend, and the meaning of Break-Point is can
Evaluation rat sucks the subjective initiative of heroin, is equivalent to the motivation that clinical patients suck heroin.Method: 24 instructions are chosen
Practice successful rat, be divided into two big group FR combination PR groups, 12 rats of each group greatly, each big group be divided into LV1CN group with
LV1-miR-219a-5p group does brain solid to rat, packaged slow virus is injected into rat nucleus accumbens septi (NAc), LV1-
MiR-219a-5p group microinjection contains the slow virus of target microRNA, microRNA of the LV1CN group microinjection containing empty plasmid.
Slow virus injection dosage can be 6-20 μ l/kg, and injection volume is 14 μ l/kg herein.After restoring 7 days, by rat dose-effect curve
When establishing, crystal methamphetamine institute dose is respectively 0.025mg/kg, 0.05mg/kg, 0.075mg/kg, 0.1mg/kg.Each
Dose maintenance 3 days, and be averaged, obtain the administration number of times per hour and breakpoint of each dosage, ultimate analysis FR, PR dosage
The tendency of effect curve.
From Fig. 6, it can be seen that in 0.05mg/kg, 0.075mg/kg and 0.1mg/kg dosage, miR-219a-5p crosses table
Inhibit administration number of times (p < 0.01) up to obvious, shows that miR-219a-5p has inhibiting effect to administration FR is strengthened.
From Fig. 7, it can be seen that under 0.05mg/kg and 0.075mg/kg dosage, miR-219a-5p is overexpressed obvious inhibition and gives
Medicine number (p < 0.001) shows that miR-219a-5p has significant inhibiting effect to administration motivation PR.
Embodiment 5miR-219a-5p rat nucleus accumbens septi is overexpressed during habituation to angiotensin-ii receptor 1AT1
The influence of expression
Nucleus accumbens septi (NAc): it is incoming to receive prefrontal cortex, hippocampus, the Glutamatergic nerve of amygdaloid nucleus, research shows that NAc joins
With " stimulation award " related with habituation study, the nerve fibre of NAc mainly terminates at its shell region, and with project VTA
GABA serotonergic neuron formed synaptic contact, directly participate in and drug reward motivation and emotional activity.
Method: 1. rat reaches stable crystal methamphetamine habituation state by training in 3 days, SD rat is divided into two big
Group FR combines PR group, 12 rats of each group greatly, and each big group is divided into LV1CN group and LV1-miR-219a-5p group, and broken end takes
Brain carries out Western Blotting experiment, NAc brain area is removed, and is divided in clean grinding pipe and is placed on ice for use.?
Grinding bead, lysate (RIPA) and protease inhibitors are added in each grinding pipe to be placed in and grind after various reagents accurately add well
It takes out rapidly and is placed on ice after grinding 30s in grinding machine.It is centrifuged 15 minutes under 4 DEG C of 13,000g after 5min, its supernatant is taken after centrifugation
Liquid, using the concentration of the taken albumen of BCA kit measurement, and being adjusted correspondingly is consistent protein concentration as far as possible.With
The albumen buffer 35ul of 5x is added in every pipe supernatant afterwards and is placed in boiling water bath after 10min cooling be placed on ice for use.
2. the sample after above-mentioned water-bath is carried out PAGE gel electrophoresis by electrophoresis, each brain area does 3 multiple holes.
3. transferring film, NC film, which will be pre-chilled, in transferring film liquid will balance pretreatment 10 to 15 minutes because transferring film liquid contains formaldehyde, and hand
The first albumen that bag has will cause the pollution of film, so clean gloves must be taken.Notice that sponge will be sufficiently humidified so as to, bubble will be caught up with
It walks completely, clip, which is opened, keeps black one side holding horizontal, is padding a foam-rubber cushion above, is rolled back and forth with glass rod several all over to roll away
The bubble of the inside.Three layers of filter paper are padded on Sponge cushion, and fixed filter paper rolls bubble therein with glass rod on the other hand on the other hand, stops running
Wanted after glue horse back transferring film otherwise albumen can spread cause band change so that influence experimental result.In separation gel and concentration glue
Between draw the concentration of pushing aside of a line gently and glue and it removed, NC membrane cover on separation gel and is aligned and adds a little transferring film
Liquid, which is maintained at film in wet state, cannot have bubble under film.
4. being immunoreacted, the above-mentioned film made is put into box, it will be such as confining liquid (generally skimmed milk power), room temperature closing
2 hours or 4 DEG C overnight.After the completion of closing, confining liquid is removed, primary antibody is added overnight (or room temperature 5h), primary antibody incubation is over
Afterwards, it recycles primary antibody and cleans 3 each 5min with the TBST of 1X, secondary antibody is added, is protected from light 2h.After being protected from light, secondary antibody is recycled, and
It is cleaned 1 time after cleaning 3 times with 1X TBST with 1X TBS.
5. developing the color, after the completion of above-mentioned steps, film is placed on instrument and is developed the color, and carries out observation and the ash of protein band
The measurement of angle value.
From figure 8, it is seen that LV1-miR-219a-5p group is remarkably decreased (p relative to LV1CN group, the expression of AT1 in FR
< 0.01), illustrate that miR-219a-5p is overexpressed the expression that can inhibit AT1.
From fig. 9, it can be seen that LV1-miR-219a-5p group is remarkably decreased (p relative to LV1CN group, the expression of AT1 in PR
< 0.05), illustrate that miR-219a-5p is overexpressed the expression that can inhibit AT1.
Claims (4)
1. a kind of RNA of short and small non-coding is preparing the application in anti-crystal methamphetamine dependence producing drug, it is characterised in that: described
RNA is miR-219a-5p, and nucleotides sequence is classified as SEQ ID No.1.
2. the RNA of short and small non-coding according to claim 1 is preparing the application in anti-crystal methamphetamine dependence producing drug,
It is characterized in that: nucleic acid and pharmaceutically acceptable carrier of the drug as effective quantity comprising SEQ ID No.1 shown in sequence table
Or auxiliary material composition.
3. the RNA of short and small non-coding according to claim 2 is preparing the application in anti-crystal methamphetamine dependence producing drug,
The effective dose for being characterized in that the drug is 6~20 μ l/kg.
4. the RNA of short and small non-coding according to claim 3 is preparing the application in anti-crystal methamphetamine dependence producing drug,
It is characterized in that the drug is injection medicament.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610874030.4A CN106636089B (en) | 2016-09-30 | 2016-09-30 | A kind of short and small non-coding RNA and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610874030.4A CN106636089B (en) | 2016-09-30 | 2016-09-30 | A kind of short and small non-coding RNA and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636089A CN106636089A (en) | 2017-05-10 |
| CN106636089B true CN106636089B (en) | 2019-01-25 |
Family
ID=58854679
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610874030.4A Active CN106636089B (en) | 2016-09-30 | 2016-09-30 | A kind of short and small non-coding RNA and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636089B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8768630B2 (en) * | 2010-02-19 | 2014-07-01 | The Regents Of The University Of Michigan | miRNA target prediction |
| CN103877069B (en) * | 2012-12-21 | 2017-01-04 | 香港中文大学 | The small-molecule modulators of microRNA 34a |
-
2016
- 2016-09-30 CN CN201610874030.4A patent/CN106636089B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636089A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chartoff et al. | Blockade of kappa opioid receptors attenuates the development of depressive-like behaviors induced by cocaine withdrawal in rats | |
| Rodd et al. | Regional heterogeneity for the intracranial self-administration of ethanol and acetaldehyde within the ventral tegmental area of alcohol-preferring (P) rats: involvement of dopamine and serotonin | |
| Stucky et al. | Sex differences in behavior and expression of CGRP‐related genes in a rodent model of chronic migraine | |
| Thakkar et al. | A1 receptor and adenosinergic homeostatic regulation of sleep-wakefulness: effects of antisense to the A1 receptor in the cholinergic basal forebrain | |
| Hansen et al. | MicroRNA as therapeutic targets for treatment of depression | |
| Novak et al. | Incentive learning underlying cocaine-seeking requires mGluR5 receptors located on dopamine D1 receptor-expressing neurons | |
| CN102604951A (en) | Compositions and methods to treat muscular & cardiovascular disorders | |
| Zhang et al. | Upregulation of miR-195 accelerates oxidative stress-induced retinal endothelial cell injury by targeting mitofusin 2 in diabetic rats | |
| Gowen et al. | Role of microRNAs in the pathophysiology of addiction | |
| Pang et al. | Fastigial nucleus stimulation regulates neuroprotection via induction of a novel micro RNA, rno‐miR‐676‐1, in middle cerebral artery occlusion rats | |
| Karachi et al. | Dysfunction of the subthalamic nucleus induces behavioral and movement disorders in monkeys | |
| Yu et al. | MicroRNA-431-5p encapsulated in serum extracellular vesicles as a biomarker for proliferative diabetic retinopathy | |
| RU2008120702A (en) | MODULATION OF EXPRESSION OF 11BETA-HYDROXYSTEROID DEHYDROGENASE 1 FOR TREATMENT OF EYE DISEASES | |
| Xu et al. | Inhibition of methamphetamine self-administration and reinstatement by central blockade of angiotensin II receptor in rats | |
| He et al. | The aversion function of the limbic dopaminergic neurons and their roles in functional neurological disorders | |
| Jiang et al. | A long noncoding RNA links TGF-β signaling in lung fibrosis | |
| Perier et al. | Ipsilateral and contralateral subthalamic activity after unilateral dopaminergic lesion | |
| Li et al. | Fear conditioning downregulates miR-138 expression in the hippocampus to facilitate the formation of fear memory | |
| Kang et al. | Downregulation of microRNA‐124‐3p promotes subventricular zone neural stem cell activation by enhancing the function of BDNF downstream pathways after traumatic brain injury in adult rats | |
| CN106636089B (en) | A kind of short and small non-coding RNA and its application | |
| CN106474144B (en) | MiR-219a-5p relapses application in drug preparing anti-crystal methamphetamine | |
| CN105726530A (en) | Application of SB216763 to preparation of methylamphetamine addiction medicine | |
| Szczytkowski et al. | Dopamine D1 receptors within the basolateral amygdala mediate heroin-induced conditioned immunomodulation | |
| CA3079524A1 (en) | Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation | |
| TWI585205B (en) | Microrna-328 anti-sense composition and therapeutic use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |