CN106636085B - The purposes and its related drugs of DKK3 gene - Google Patents
The purposes and its related drugs of DKK3 gene Download PDFInfo
- Publication number
- CN106636085B CN106636085B CN201510539931.3A CN201510539931A CN106636085B CN 106636085 B CN106636085 B CN 106636085B CN 201510539931 A CN201510539931 A CN 201510539931A CN 106636085 B CN106636085 B CN 106636085B
- Authority
- CN
- China
- Prior art keywords
- dkk3
- dkk3 gene
- nucleic acid
- gene
- sirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention relates to field of biotechnology, disclose the purposes and its related drugs of DKK3 gene.The present invention discloses purposes of the DKK3 gene in screening muscular atrophy therapeutic agent first.The present invention also further constructs DKK3 gene small molecules interference RNA, DKK3 gene interfering nucleic acid construct, DKK3 gene viral interference and discloses their purposes.SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, virus are capable of the expression of specificity inhibition DKK3 gene, especially adenovirus, target cell can efficiently be infected, expeditiously inhibit the expression of DKK3 gene in target cell, and then it is effectively improved muscular atrophy, it is of great significance in muscular atrophy treatment.
Description
Technical field
The present invention relates to field of biotechnology, relate more specifically to the purposes and its related drugs of DKK3 gene.
Background technique
Amyotrophic existing diagnostic method mainly includes inquiring that medical history, the visual examination for carrying out muscle, whether there is or not fleshes for observation
Whether beam trembling, observation patient have apparent muscle quality to reduce, and by electromyogram combination nerve conduction velocity and induce electricity
Position is diagnosed.There is presently no molecular diagnosis methods.In addition, the muscular atrophy and muscle function that cause for aging decline
It moves back, current not specific treatment method and the action target spot that can be used as therapeutic agent.
Dkk3 is a member of Dickkopf protein family, belongs to exocytosis albumen.It is logical that it mainly acts on Wnt signal
Road inhibits the active effect of Wnt signal path to reach by the membrane receptor LRP in conjunction with Wnt protein competition.But at present
Research it has not been found that Dkk3 expression quantity level whether with amyotrophic generations presence be associated with;Also aging can not treated
The amyotrophic target spot caused.
Therefore, have to treat the research and development with diagnostic purpose highly expressed gene and/or albumen in muscular atrophy
It is significant.
Summary of the invention
It is an object of the invention to open treatment methods and drug with DKK3 gene-correlation, are with RNA interference (RNAi)
Effect of the means research DKK3 gene in muscular atrophy treatment.
The first aspect of the present invention has studied work of the DKK3 gene in muscular atrophy treatment using RNA interference as means
With disclosing a kind of improvement or treat amyotrophic method, this method comprises: applying one kind to muscle cell being capable of specificity
Inhibit the transcription or translation of DKK3 gene, or be capable of specificity inhibit DKK3 albumen expression or active molecule, changed with this
Kind or treatment muscular atrophy.
The improvement is treated in amyotrophic method, and the amount of application of the molecule is to reduce turning for DKK3 gene enough
Record or translation, or expression or the active dosage of reduction DKK3 albumen enough.Further, the expression of the DKK3 gene is extremely
It is lowered 50%, 80%, 90%, 95% or 99% less.
The molecule may be selected from but not limited to: nucleic acid molecules, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine,
Polypeptide, albumen or viral interference.
The nucleic acid includes but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozyme, endoribonuclease
The siRNA (siRNA) or short hairpin RNA (shRNA) of III preparation.
The double-stranded RNA, ribozyme, siRNA or shRNA contain the promoter sequence of DKK3 gene or the letter of DKK3 gene
Cease sequence.
Further, the double-stranded RNA is siRNA (siRNA).The siRNA includes the first chain and second
RNA dimer, and the sequence of first chain and DKK3 gene is collectively formed in chain, first chain and the second chain complementation
Middle 15-27 continuous nucleotide sequences are essentially identical.It is encoded that the small molecules interference RNA can specifically bind target sequence
MRNA segment, and the expression of specific silencing DKK3 gene.
Further, the first chain-ordering of the siRNA and the target sequence in DKK3 gene are essentially identical.
When target sequence in the DKK3 gene is the small molecules interference RNA specificity silencing DKK3 gene expression,
Segment in DKK3 gene corresponding to the mRNA segment of combination complementary with the small molecules interference RNA.
Preferably, the DKK3 gene source is in people.
The first aspect of the present invention also discloses a kind of isolated DKK3 gene in screening muscular atrophy therapeutic agent
Purposes.
It is described that isolated DKK3 gene is used to screen the content that muscular atrophy therapeutic agent includes following aspect: by DKK3
Gene is applied to screening muscular atrophy therapeutic agent or preparation for the action target of atrophy muscle as drug or preparation.
It is described to be applied to screening muscular atrophy for the action target of atrophy muscle using DKK3 gene as drug or preparation
Therapeutic agent or preparation specifically refer to: using DKK3 gene as effective object, screening to drug or preparation, with find can be with
The drug of DKK3 gene expression is inhibited to treat drug candidate as muscular atrophy.DKK3 gene small molecule as described in the present invention is dry
Disturbing RNA (siRNA) is to obtain by effective object screening of DKK3 gene, can be used as having treatment or improving muscular atrophy making
Drug.In addition to this, such as antibody drug, small-molecule drug etc. can also be using DKK3 genes and its albumen as effect pair
As.
The muscular atrophy therapeutic agent is the transcription or translation for capableing of specificity inhibition DKK3 gene, or being capable of specificity
The expression or active molecule for inhibiting DKK3 albumen reach to reduce the expression of DKK3 gene in atrophy muscle cell
Treat or improve amyotrophic purpose.
The muscular atrophy therapeutic agent for preparing or screening acquisition by isolated DKK3 gene includes but is not limited to: core
Acid molecule, carbohydrate, lipid, small-molecule chemical medicine, antibody medicine, polypeptide, albumen or viral interference.
The nucleic acid includes but is not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozyme, endoribonuclease
The siRNA (siRNA) or short hairpin RNA (shRNA) of III preparation.
The amount of application of the muscular atrophy therapeutic agent is the transcription or translation for reducing DKK3 gene enough, or drop enough
The expression of low DKK3 albumen or active dosage.So that the expression of DKK3 gene is at least lowered 50%, 80%, 90%, 95%
Or 99%.
Amyotrophic method, the mainly table by reducing DKK3 gene are treated using aforesaid muscles atrophy therapeutic agent
Improve muscular atrophy up to level to achieve the purpose that treatment.Specifically, DKK3 gene expression dose will be effectively reduced when treatment
Administering substances in patient.
Second aspect of the present invention, which discloses, a kind of treats amyotrophic isolated nucleic acid molecules, the nucleic acid molecules packet
Contain:
A) double-stranded RNA, containing being capable of nucleotides sequence under stringent condition with DKK3 gene recombination in the double-stranded RNA
Column;Or
B) containing being capable of nucleotide sequence under stringent condition with DKK3 gene recombination in shRNA, the shRNA.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and second chain are complementary common
Form RNA dimer, and the sequence of first chain and 15-27 in the DKK3 gene basic phases of continuous nucleotide sequence
Together.Preferably, the sequence of first chain and 19-23 in DKK3 gene continuous nucleotide sequences are essentially identical;More preferably,
The sequence of first chain and 19,20 or 21 in DKK3 gene continuous nucleotide sequences are essentially identical.
Further, the double-stranded RNA includes the first chain and the second chain, and first chain and the second chain complementation are total
With formation RNA dimer, and the sequence of first chain and the target sequence in DKK3 gene are essentially identical.
The length of first chain of double-stranded RNA and the second chain is 15-27 nucleotide;Preferably, length is 19-23
A nucleotide;Optimal, length is 19,20 or 21 nucleotide.
Further, the double-stranded RNA is siRNA (siRNA).Further, first chain of siRNA
Sequence as shown in SEQ ID NO:1, specially 5 '-CCAGGAAGUUCACAAGAUAUU-3 '.
SiRNA shown in SEQ ID NO:1 is with the sequence of DKK3 be RNA interfere target sequence design, for DKK3 base
One chain of the siRNA of cause, another chain i.e. sequence of the second chain is complementary with the first chain-ordering, which can play
The effect of endogenous DKK3 gene expression in specific silencing atrophy muscle.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment and
The sequence of the loop-stem structure of antisense strand segment, the positive-sense strand segment and the antisense strand segment is complementary, and the positive-sense strand
The sequence of segment and 15-27 in DKK3 gene continuous nucleotide sequences are essentially identical.It can become after the shRNA is processed
SiRNA (siRNA) plays the role of endogenous DKK3 gene expression in specific silencing atrophy muscle in turn.
Further, the shRNA includes positive-sense strand segment and antisense strand segment, and the connection positive-sense strand segment
With the loop-stem structure of antisense strand segment, the sequence of the positive-sense strand segment and the antisense strand segment is complementary, and the justice
The sequence of chain segment and the target sequence in DKK3 gene are essentially identical.
Preferably, the positive-sense strand segment and 19-23 in DKK3 gene continuous nucleotide sequences are essentially identical;More preferably
, the positive-sense strand segment and 19,20 or 21 in DKK3 gene continuous nucleotide sequences are essentially identical.
Further, the sequence of the positive-sense strand of the shRNA is as shown in SEQ ID NO:3, specifically: 5 '-TCGACC
AGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGGTTTTT-3’。
ShRNA can become siRNA after digestion is processed, and then play endogenous in specific silencing atrophy muscle cell
The effect of DKK3 gene expression.
Encode the genetic fragment of shRNA of the present invention viral interference carrier contain for DKK3 gene target sequence and
Its complementary series.
First chain of the double-stranded RNA or the positive-sense strand segment of the shRNA and the basic phase of target sequence in DKK3 gene
Together, it when the target sequence of the DKK3 gene is that siRNA is used for specific silencing DKK3 gene expression, is identified by the siRNA
And the segment in DKK3 gene corresponding to the mRNA segment of silencing.
Further, the DKK3 gene source is in people.
Third aspect present invention discloses a kind of DKK3 gene interfering nucleic acid construct, contains of the present invention point of coding
From nucleic acid molecules in shRNA genetic fragment, the shRNA can be expressed.
The DKK3 gene interfering nucleic acid construct, which can be, will encode the genetic fragment gram of aforementioned DKK3 gene shRNA
It is grand enter known carrier obtain.Further, the DKK3 gene interfering nucleic acid construct is DKK3 gene viral interference carrier.
DKK3 gene viral interference carrier of the invention is to be cloned into the DNA fragmentation for encoding aforementioned DKK3 gene shRNA
Known carrier obtains, and the known carrier can be any viral vectors, such as adenovirus, retrovirus, slow virus etc., this paper
Use adenovirus vector.The DKK3 gene viral interference carrier by virus packaging become infectious virion after,
Atrophy muscle is infected, and then transcribes out shRNA of the present invention, processed by digestion and etc., the siRNA is finally obtained,
Expression for specific silencing DKK3 gene.
Further, the DKK3 gene interference adenovirus vector also contains promoter sequence and/or coding atrophy muscle
In the nucleotide sequence of marker that can be detected;Preferably, the marker the being detected such as green fluorescent protein
(GFP)。
Further, the adenovirus vector can be selected from: appointing in pAdTrack, pShuttle, pAdTrack-GFP
One.
The embodiment of the present invention is specifically listed interferes adenovirus to carry by the DKK3 gene of vector construction of pAdTrack-GFP
Body.
The nucleic acid molecules that the present invention separates can be used for preparing the amyotrophic drug for the treatment of.
DKK3 gene siRNA of the invention can be used for treating amyotrophic drug or preparation.DKK3 gene interferes adenopathy
Poisonous carrier then can be used for preparing described using DKK3 gene as the siRNA of target spot.Amyotrophic drug or preparation are treated when being used as
When, it is that the nucleic acid molecules of safe and effective amount are applied to mammal.Specific dosage is also contemplated that administration route, Bing Renjian
The factors such as health situation, within the scope of these are all skilled practitioners technical ability.
Fourth aspect present invention discloses a kind of DKK3 gene interference adenovirus, interferes adenovirus by aforementioned DKK3 gene
Carrier adenovirus packaging plasmid, cell line auxiliary under, packed by virus.The adenovirus can infect atrophy muscle simultaneously
The small molecules interference RNA for being directed to DKK3 gene is generated, so as to improve muscular atrophy.DKK3 gene interference adenovirus can be used for making
It is standby to treat amyotrophic drug.
The fifth aspect of the present invention discloses one kind for treating amyotrophic pharmaceutical composition, and active principle contains
There are isolated nucleic acid molecules above-mentioned, one of DKK3 gene interfering nucleic acid construct or DKK3 gene viral interference or a variety of
Combination.
Further, described pharmaceutical composition contains double-stranded RNA described in 1~99wt%, shRNA, DKK3 gene interference core
Acid con-struct or DKK3 gene interference adenovirus and pharmaceutically acceptable carrier, diluent or excipient.
When preparing these compositions, usually active constituent is mixed with excipient, or with figuration dilution agent or Bao Ke
In carrier existing for capsule or sachet.When excipient plays diluent, it can be solid, semisolid or liquid
Medium of the material as excipient, carrier or active constituent.Therefore, composition can be tablet, pill, pulvis, solution, sugar
Starch agent, sterilizing injecting solution etc..The example of suitable excipient includes: lactose, glucose, sucrose, sorbierite, mannitol, shallow lake
Powder, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water etc..Preparation may also include that wetting agent, emulsifier, preservative (such as
Methyl hydroxybenzoate and propyl ester), sweetener etc..
The invention also discloses described pharmaceutical compositions to treat the application in amyotrophic therapeutic agent in preparation.
The application of the pharmaceutical composition is that amyotrophic treatment provides a method, specially a kind of prevention or treatment
The method of atrophy muscle in subject, including the pharmaceutical composition of effective dose to be applied in object.Further,
The muscular atrophy is selected from muscular atrophy caused by aging.
Described pharmaceutical composition in prevention or treatment object body for when atrophy muscle, needing the described of effective dose
Pharmaceutical composition is applied in object.Using this method, the intramuscular DKK3 gene expression of atrophy is suppressed.Further
, the expression at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% of the DKK3 gene or
99% part is suppressed.
The object of the method can be people.
In conclusion the present invention devises the RNAi target sequence for DKK3 gene, constructs corresponding DKK3RNAi and carry
Body, wherein the RNAi carrier of coded sequence SEQ ID NO:1 can significantly lower the mRNA level in-site and protein level of DKK3 gene.
Using adenovirus to carry shRNA as genetic manipulation tool will can efficiently lead with targeting for the siRNA sequence of DKK3 gene
Enter atrophy muscle, reduces the expression of DKK3 gene, significantly improve muscular atrophy.Therefore, adenovirus mediated DKK3 gene
Silencing is muscular atrophy potentially clinical non-operative treatment mode.
SiRNA provided by the invention or the nucleic acid construct comprising the siRNA sequence, virus being capable of specificity inhibition
The expression of DKK3 gene.It is especially viral, target cell can be efficiently infected, the table of DKK3 gene in target cell is expeditiously inhibited
It reaches, is effectively improved muscular atrophy, be of great significance in muscular atrophy treatment.
Detailed description of the invention
The ratio of Figure 1A: TA muscle percentage of liveweight, compared with the control group, after striking low DKK3 expression, TA weight is obviously increased.
Figure 1B: RT-qPCR detection muscular atrophy marker gene Atrogin 1.Experimental group DKK3mRNA level is substantially reduced,
Illustrate the success of RNA interference experiment;1 expression quantity of Atrogin is lowered, and is illustrated after interference DKK3 expression, muscular atrophy is changed
It is kind.
Fig. 1 C: immunofluorescence dyeing shows muscle cell profile;Compared with the control group, experimental group muscle cell cross-sectional area
It is significantly larger.
Fig. 1 D: the size distribution of statistical analysis muscle cell cross-sectional area;Compared with experimental group, control group muscle cell
The bigger proportion of cross-sectional area is more.
Fig. 2A: myotility tests TA muscle rigidity pulling force.Compared with the control group, experimental group myotility is remarkably reinforced,
It can reach 50% or so of 2 monthly age young mice myotilities, illustrate after striking low DKK3, the muscle function of mouse aging obtains very
Good recovery.
Fig. 2 B: recovery time after muscle rigidity is shunk;Compared with the control group, experimental group recovery time is considerably shorter, explanation
After striking low DKK3, muscle function is restored well.
Specific embodiment
The present invention relates to one group for small molecules interference RNA (siRNA) sequence of DKK3 gene, rna interference vector and
RNA viral interference.Target site of the DKK3mRNA coding region sequence as siRNA is chosen, according to 10-30 continuous in target site
(preferably 15-27, more preferable 19-23) a base sequence designs siRNA target sequence.By gene cloning, building expression is above-mentioned
The nucleic acid construct of siRNA, the virus of the above-mentioned siRNA of packaging expression.Cell experiment and zoopery prove, above-mentioned siRNA
Sequence is capable of the expression of specific silencing DKK3 gene, to treat muscular atrophy.
The present inventor has found after extensive and in-depth study, in musculature, DKK3 gene it is significantly high
Expression can cause muscular atrophy;Inventors have found that using RNAi method lower DKK3 gene expression after can effectively treat flesh
Meat atrophy, this research achievement show DKK3 gene, can be used as the target spot of muscular atrophy treatment.Inventor further synthesizes and surveys
The siRNA for DKK3 gene has been tried, the expression that DKK3 can be effectively suppressed has been filtered out and then has treated amyotrophic siRNA,
The present invention is completed on this basis.
The present invention provides siRNA (siRNA) sequence that one strikes low DKK3 gene, constructing can specific silencing
The adenovirus of DKK3 gene expression.The research of the invention finds that for the siRNA and RNAi adenovirus of the design of DKK3 gene,
Stablize and specifically lower the expression of DKK3 gene, and effectively improves muscular atrophy.Present invention demonstrates that inhibiting DKK3 gene can
Promote muscular atrophy to improve, is expected to become the target spot of muscular atrophy treatment.Moreover, passing through the table of RNAi mode silencing DKK3 gene
It reaches, can be used as the amyotrophic effective means for the treatment of.
Below with reference to embodiment, the present invention is further explained.It should be understood that embodiment is merely to illustrate the present invention, rather than limit
The scope of the present invention.The reagent of test method without specific conditions and undeclared formula is according to conventional strip in embodiment
Part, such as [beauty] Sambrook.J write;Huang Peitang etc. is translated.Molecular cloning texts guide, the third edition.Beijing: Science Press
The condition that condition described in 2002 or manufacturer suggest carries out or configuration.
Embodiment 1 is directed to the preparation of DKK3 gene RNAi adenovirus
1. the effective siRNA target spot that screening is directed to DKK3 gene
The mRNA sequence (NM_015814) of DKK3 is obtained from NCBI inquiry, as follows:
By using software, design specificity strikes the siDKK3 of low DKK3 protein expression, and sequence is as follows:
sense(5'-3')CCAGGAAGUUCACAAGAUAUU;(SEQ ID NO.1)
antisense(5'-3')UAUCUUGUGAACUUCCUGGUU(SEQ ID NO.2)。
ShRNADKK3 is synthesized to siRNA sequence with this, sequence is as follows:
TCGACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGGTTTTT;(SEQ ID NO.3)
AATTAAAAACCAGGAAGTTCACAAGATACTCGAGTATCTTGTGAACTTCCTGG(SEQ ID NO.4)。
Two sections of oligo anneal by following system:
10x annealing buffer 1ul;100um oligo f:4.5ul;100um oligo r:4.5ul;95℃
5min。
Automatically after being cooled to room temperature, it is used as clone insert with xhol1 and EcoR1 double digestion.
Adenovirus vector pAdTrack-GFP presses following system digestion:
Vector 1ug;Xhol 1ul;EcoR11ul;Cutsmart 5ul;ddH2O upto 50ul.
After glue recycling, after being connected 5 hours with the T4DNA ligase room temperature of 1 μ lNEB, transformed competence colibacillus cell BJ5183 is used
After the identification of Kpn1 and Xbal1 digestion with restriction enzyme, transfection DH5 α competent cell expands plasmid, after extracting plasmid, uses
The linearisation of Pac1 restriction enzyme can be used to the cell 293A of transfection packaging virus after glue recycling.10 μ g are taken to linearize
Expression plasmid, calcium phosphate precipitation transfect 293A cell (10 μ g plasmids are added in 250 μ l water, be added 250 μ l calcium chloride it is molten
Liquid mixes well spare;A 50ml centrifuge tube is taken, the 2xHBS solution of 500 μ l is added, dropwise by the plasmid-calcium solution got ready
It is added in HBS solution, side edged fullys shake;Be placed at room temperature for after adding 20 minutes it is spare;Grow to about 60% floor space
293A cell takes out, and inhales and abandons old culture solution, is added 10ml grown cultures (DMEM+10%FBS), the plasmid calcium that front is got ready is sunk
Shallow lake suspension is slowly added into culture medium, is gently shaken up and is placed on 37 degree, cultivates in 5% carbon dioxide incubator;16 after transfection
Hour, the growth medium more renewed continues to cultivate.After 48 hours, daily in fluorescence microscopy microscopic observation, until institute under mirror
Some cells all express green fluorescence (generally requiring 7-10 days).Collect all cell and cell culture fluid, 1500 revs/min
It is centrifuged room temperature to be centrifuged 5 minutes, abandons supernatant, stay cell precipitation.After being washed twice with PBS, 500 μ lPBS are added and are resuspended, with liquid nitrogen -37
It spends multigelation method lytic cell (freeze thawing 3 times), 2000 revs/min of room temperatures are centrifuged 5 minutes, and it is spare that supernatant goes to new pipe
(i.e. P1 generation virus).It cultivates 40 disks (10cm culture dish) 293A cell and 10 μ lP1 generation diseases is added to 60% floor space, every disk is grown to
Poison infection, daily microscopic observation after 24 hours, until after all cells expression green fluorescence (generally requiring 2-3 days), according to receipts
The same method of P1 generation virus is collected and is cracked releasing virus (the general 2ml PBS lytic cell that is added obtains virus), is so far
Obtain P2 generation virus.(subsequent viruses more if necessary, i.e., according to the method for obtaining P2 generation virus can be used after surveying titre
Amplification)
Embodiment 2 strikes amyotrophic application caused by low muscular atrophy mark of correlation DKK3 treatment aging
After embodiment 1 obtains the adenovirus of interference Dkk3, titre 1.3x107Tu/ml.Control group is the gland for expressing GFP
Virus, titre 1.3x107Tu/ml.Take the C57/BL wild-type mice at 20 monthly ages, left leg TA injection GFP virus, right leg TA note
Blackberry lily disturbs DKK3 virus.50 μ l every time after continuous injection 7 days, then is raised 7 days.By myotility tester, two are tested respectively
The tetanic myotility of leg TA muscle.After test, TA is taken out, half OCT is taken to embed, is used as frozen section after liquid nitrogen flash freezer.
1ml TriZol is added in the other half, and 200 μ l chloroforms are added, and mixing fullys shake, and 12000 revs/min 4 DEG C are centrifuged 15 minutes, takes
Upper layer clear liquid is transferred in new EP pipe;500 μ l isopropanols are added, mix well, 12000 revs/min of 4 DEG C of centrifugations 15
Minute, supernatant is abandoned, 75% ethyl alcohol of 1ml is added into precipitating and washes once, room temperature is dried in the air 10 minutes after abandoning supernatant;40 μ l are added without RNA
The water of enzyme dissolves, and obtains total mRNA.After spectrophotometry surveys mRNA concentration, 1 μ g total serum IgE is taken, 1 μ l (200units) is added
NEB company MuLV reverse transcriptase and its 1x reaction buffer, 0.5mM dNTP mixture, 4 μM of Oligo dT, 1 μ l RNase
42 DEG C of inhibitor are incubated for 1 hour, reverse transcription cDNA.CDNA is inactivated 10 minutes at 75 DEG C, as qPCR template.Frost
Slice does anti-Lammin B immunofluorescence dyeing, shows the profile of muscle cell, counts muscle cell with statistical software Image J
Cross-sectional area.
Firstly, by comparing the weight of experimental group and control group TA muscle, as shown in Figure 1A, it has been found that think to interfere
The experimental group of DKK3 expression, TA muscle weight have apparent increase compared with control group.
The cDNA that musculature RNA reverse transcription obtains is template, carries out the table of real-time fluorescence quantitative PCR testing goal gene
Up to amount.PCR condition be 95 DEG C 10 minutes, 95 DEG C 30 seconds, 60 DEG C 60 seconds, second and third step iterative cycles 40 times.Using
GAPDH is as internal reference, the primer sequence are as follows:
GAPDH forward:ACCCAGAAGACTGTGGATGG(SEQID NO.6)
GAPDH reverse:ACACATTGGGGGTAGGAACA(SEQID NO.7)
Muscular atrophy specific gene Atrogin1 (NM_026346.3) and Dkk3 (NM_ in muscle is detected simultaneously
015814), the primer sequence are as follows:
Atrogin 1forward:AGAGAGGCAGATTCGCAAGCGT (SEQID NO.8)
Atrogin 1reverse:TGCAAAGCTGCAGGGTGACCC (SEQID NO.9)
DKK3forward:TGAGGCAGTGGCTACACAAG (SEQID NO.10)
DKK3reverse:GCTGGTATGGGGTTGAGAGA (SEQID NO.11)
If Figure 1B show reduce DKK3 expression after the expression quantity of Atrogin 1 lower, partial rescue muscle withers
Contracting.Frozen tissue section carries out immunofluorescence dyeing and anti-Lammin B antibody (2 μ g/ml) is added after slice is fixed with 4%PFA
4 ° overnight, and the goat-anti rabbit secondary antibody (1:1000) that fluorescent marker is added for second day was incubated at room temperature 1 as a child, and DAPI contaminates core, and room temperature is incubated
It educates 5 minutes, takes pictures under the microscope after mounting in fluorescence microscopy.As a result, as Fig. 1 C is shown, after striking low DKK3 expression, TA muscle
The more unloaded control group of cross-sectional area obviously becomes larger, and muscular atrophy obtains after artificially striking low DKK3 expression caused by prompting because of aging
It significantly improves.By Image J software statistics muscle fibre cross-sectional area, such as Fig. 1 D, after striking low DKK3 expression, muscle is crosscutting
Face area becomes larger.
By myotility test experiments, as shown in Figure 2 A, after striking low DKK3 expression, the myotility of TA muscle is aobvious
Enhancing is write, 50% horizontal left and right of young mice myotility can be restored to.As shown in Figure 2 B, experimental group muscle rigidity is shunk
Recovery time religion control group is obviously shortened afterwards, and muscle function is prompted to obtain good reparation.
The above, only presently preferred embodiments of the present invention, not to the present invention in any form with substantial limitation,
It should be pointed out that under the premise of not departing from the method for the present invention, can also be made for those skilled in the art
Several improvement and supplement, these are improved and supplement also should be regarded as protection scope of the present invention.All those skilled in the art,
Without departing from the spirit and scope of the present invention, when made using disclosed above technology contents it is a little more
Dynamic, modification and the equivalent variations developed, are equivalent embodiment of the invention;Meanwhile all substantial technologicals pair according to the present invention
The variation, modification and evolution of any equivalent variations made by above-described embodiment, still fall within the range of technical solution of the present invention
It is interior.
Claims (3)
1. purposes of the pharmaceutical composition in preparation muscular atrophy therapeutic agent, described pharmaceutical composition contain active principle: controlling
Treat amyotrophic isolated nucleic acid molecules, DKK3 gene interfering nucleic acid construct and/or DKK3 gene viral interference;And medicine
Acceptable carrier, diluent or excipient on, the amyotrophic isolated nucleic acid molecules for the treatment of include:
A) double-stranded RNA, the double-stranded RNA are siRNA, the sequence of first chain of siRNA such as SEQ ID NO:1 institute
Show;Or
B) shRNA, the sequence of the shRNA positive-sense strand is as shown in SEQ ID NO:3;The DKK3 gene interfering nucleic acid building
Body can express the shRNA containing the genetic fragment for encoding the shRNA in the isolated nucleic acid molecules;The DKK3 gene
Viral interference by the interfering nucleic acid construct viral packaging plasmid, cell line auxiliary under, packed by virus.
2. purposes as described in claim 1, which is characterized in that the DKK3 gene interfering nucleic acid construct is viral interference load
Body.
3. purposes as claimed in claim 2, which is characterized in that the viral interference carrier will be by that will encode the base of the shRNA
It is obtained after being cloned into viral vectors because of segment, any of the viral vectors in adenovirus, retrovirus, slow virus
Kind.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510539931.3A CN106636085B (en) | 2015-08-28 | 2015-08-28 | The purposes and its related drugs of DKK3 gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510539931.3A CN106636085B (en) | 2015-08-28 | 2015-08-28 | The purposes and its related drugs of DKK3 gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106636085A CN106636085A (en) | 2017-05-10 |
CN106636085B true CN106636085B (en) | 2019-05-07 |
Family
ID=58815501
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510539931.3A Active CN106636085B (en) | 2015-08-28 | 2015-08-28 | The purposes and its related drugs of DKK3 gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106636085B (en) |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120284809A1 (en) * | 2011-05-06 | 2012-11-08 | National Institute Of Immunology | KNOCK DOWN MODEL OF DICKKOPF HOMOLOGUE 3 (Dkk3) FOR ASSESSING ROLE OF SAID Dkk3 IN SPERMATOGENESIS AND SEX REVERSAL |
CN106191215B (en) * | 2015-04-29 | 2020-03-24 | 中国科学院上海生命科学研究院 | Screening and application of protein molecular marker Dkk-3 related to muscular atrophy |
-
2015
- 2015-08-28 CN CN201510539931.3A patent/CN106636085B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN106636085A (en) | 2017-05-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP7239540B2 (en) | Optimized mini-dystrophin genes and expression cassettes and uses thereof | |
WO2021222304A1 (en) | Sars-cov-2 rna vaccines | |
EP3777843B1 (en) | Drug delivery particle and method for producing the same | |
JP6441372B2 (en) | Application of alphavirus to the production of antitumor drugs | |
Lentscher et al. | Chikungunya virus replication in skeletal muscle cells is required for disease development | |
KR20220132588A (en) | Deoptimized SARS-CoV-2 and methods and uses thereof | |
EP3394085B1 (en) | Feline calicivirus vaccine | |
JP6396891B2 (en) | Genetically modified Coxsackie virus | |
JP5619614B2 (en) | Method for producing virus strain for vaccine of reoviridae virus | |
AU2015259472A1 (en) | Evolution of high-titer virus-like vesicles for vaccine applications | |
CN113398260A (en) | New corona vaccine using vaccinia virus as vector | |
CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
CN112587660B (en) | Application of Seneca valley virus 3D protein in preparation of immune response inducer or adjuvant | |
Wu et al. | Identification of amino acid residues in infectious hematopoietic necrosis virus (IHNV) NV protein necessary for viral replication and pathogenicity | |
US7794928B2 (en) | Norovirus detection, methods and compositions therefor | |
JP6944692B2 (en) | Bornavirus vector and its use | |
CN105705639A (en) | Dengue virus-specific sirna, double helix oligo-rna structure comprising sirna, and composition for suppressing proliferation of dengue virus comprising rna structure | |
CN106636085B (en) | The purposes and its related drugs of DKK3 gene | |
Chen et al. | Construction and characterization of an improved DNA-launched infectious clone of duck hepatitis a virus type 1 | |
CN115068611B (en) | Application of ssc-miR-374b-3p in preparation of PDCoV proliferation resistant medicine | |
CN105602989B (en) | A kind of recombinant vector and its application in preparation or screening Tamiflu | |
US11268107B2 (en) | SMAD7 gene delivery into muscle cells | |
CN106191215A (en) | The screening of the protein molecular marker Dkk-3 that amyotrophy is relevant and application thereof | |
CN107227362A (en) | A kind of gene related to liver cancer and its application | |
Yu et al. | Generation and biological assessment of recombinant avian metapneumovirus subgroup C (aMPV-C) viruses containing different length of the G gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right |
Effective date of registration: 20200417 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
TR01 | Transfer of patent right |