CN106636047A - Protein capable of catalyzing decarboxylation of alanine, as well as gene and application thereof - Google Patents

Protein capable of catalyzing decarboxylation of alanine, as well as gene and application thereof Download PDF

Info

Publication number
CN106636047A
CN106636047A CN201611029174.6A CN201611029174A CN106636047A CN 106636047 A CN106636047 A CN 106636047A CN 201611029174 A CN201611029174 A CN 201611029174A CN 106636047 A CN106636047 A CN 106636047A
Authority
CN
China
Prior art keywords
alanine
gene
decarboxylation
amino acid
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201611029174.6A
Other languages
Chinese (zh)
Other versions
CN106636047B (en
Inventor
王丽鸳
成浩
白培贤
韦康
阮丽
张成才
李海琳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tea Research Institute Chinese Academy of Agricultural Sciences
Original Assignee
Tea Research Institute Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tea Research Institute Chinese Academy of Agricultural Sciences filed Critical Tea Research Institute Chinese Academy of Agricultural Sciences
Priority to CN201611029174.6A priority Critical patent/CN106636047B/en
Publication of CN106636047A publication Critical patent/CN106636047A/en
Application granted granted Critical
Publication of CN106636047B publication Critical patent/CN106636047B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)

Abstract

The invention discloses a protein capable of catalyzing decarboxylation of alanine, as well as a gene and application thereof, and belongs to the technical field of biological gene engineering. The amino acid sequence of the protein is (1) an amino acid sequence as shown in SEQ ID No. 2, or (2) an amino acid sequence which is as shown in SEQ ID No.2 and formed by replacement, deletion and/or adding of one or several amino acid residues and has the identical function. An experiment shows that an alanine decarboxylase protein CsAlaDC is found in a tea tree; the gene corresponding to the protein is over-expressed in escherichia coli, so that a purified recombinant protein has the activity of catalyzing decarboxylation of alanine, therefore, that the gene has the function of catalyzing the decarboxylation of the alanine is verified.

Description

A kind of protein of catalysis alanine decarboxylation and its gene and application
Technical field
The invention belongs to technical field of biological genetic engineering, and in particular to a kind of protein of catalysis alanine decarboxylation and its Gene and application.
Background technology
Theanine（L-Theanine）It is distinctive free amino acid in tealeaves, theanine is glutamic acid gamma-buserelin, It is pleasantly sweet.Contain substantial amounts of theanine in tealeaves, be the main component to form tealeaves local flavor.Theanine content is generally accounted in tealeaves More than the 50% of other total amino acid contents.
Research finds that theanine synthesis is regulated and controled by premise material ethamine.Synthesize grinding for theanine in Plant Tissue Breeding In studying carefully, when having scholar to have confirmed addition precursor substance-ethylamine hydrochloride in culture medium, can increase substantially in callus Theanine synthetic quantity, and directly add alanine, then it is little to theanine cumulative effect.Theanine synthesis in ethamine by Alanine decarboxylation（CsAlaDC）, it is catalyzed the reaction and is alanine decarboxylase.Enzyme activity in cotyledon and root is high, Activity is higher than etiolated seedling in green seedlings root, imply that it plays an active part in the formation of ethamine needed for theanine synthesis.
At present, the clone identification about CsAlaDC genes has no any report.In view of the addition of ethamine can be greatly improved Callus in Camellia sinensis and suspension cell synthesis theanine, therefore the discovery of CsAlaDC genes is for research tea tree nitrogen absorbs and turns Transport mechanism has great importance.
The content of the invention
For the problem that prior art is present, it is an object of the invention to design a kind of peculiar alanine decarboxylation of tea tree of offer PROTEIN C sAlaDC and its encoding gene and the technical scheme of application.
The protein of described a kind of catalysis alanine decarboxylation, it is characterised in that the amino acid sequence of the protein is：
1）Amino acid sequence shown in SEQ ID No.2；Or
2）Amino acid sequence Jing shown in SEQ ID No.2 is replaced, is lacked and/or add one or several amino acid residue shapes Into the amino acid sequence with equal function.
The gene of the code for said proteins, it is characterised in that the nucleotides sequence of the gene is classified as：
1）Nucleotides shown in SEQ ID No.1；Or
2）Nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotides, obtains encoding the core of CsAlaDC Nucleotide sequence.
The recombinant vector of the encoding gene.
Described encoding gene forms the application in ethamine in the decarboxylation of catalysis alanine.
Application of the described encoding gene in the theanine synthesis of regulation and control tea tree.
The method that a kind of described catalysis alanine decarboxylation forms ethamine, it is characterised in that comprise the steps：Will coding In channel genes Escherichia coli, abduction delivering obtains recombinant protein, carries out mixing with alanine solution after recombinant protein purification Catalysis obtains ethamine, and the nucleotides sequence of described encoding gene is classified as：
1）Nucleotides shown in SEQ ID No.1；Or
2）Nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotides, obtains encoding the core of CsAlaDC Nucleotide sequence.
The method that a kind of described catalysis alanine decarboxylation forms ethamine, it is characterised in that the catalysis of alanine decarboxylase is anti- The condition answered is 10mM alanine, and the kaliumphosphate buffer of 100mM, 0.08-0.12 mM phosphopyridoxal pyridoxal phosphates, the sulphur of 5mM bis- is revived Sugar alcohol, 1mM K2EDTA, 10% glycerine, reaction solution pH is：The reaction temperatures of pH 7.2-pH 7.8 are 35 DEG C -45 DEG C.
The experiment proves that, the present invention has found alanine decarboxylase protein CsAlaDC in tea tree, by the albumen pair The gene answered overexpression in Escherichia coli, the recombinant protein of purifying has the activity of catalysis alanine decarboxylation simultaneously, demonstrates The gene has the function of catalysis alanine decarboxylation.
Description of the drawings
Fig. 1 alanine depicklings enzymic catalytic reaction is illustrated；
The gene order of Fig. 2 tea tree CsAlaDC；
Fig. 3 different tissues CsAlaDC gene qPCR relative quantification results；
The SDS-PAGE of Fig. 4 CsAlaDC albumen pronucleus purifying；
The decarboxylation of Fig. 5 recombinant C sAlaDC proteins carry alanine forms the efficient liquid phase of ethamine（HPLC）Detection collection of illustrative plates；
After Fig. 6 catalytic reactions 2h and 24h, the concentration of ethamine is generated in reactant liquor.
Specific embodiment
With reference to embodiments further illustrating the present invention.
Embodiment
（1）Gene cloning：Young root with Dragon Well tea 43 extracts total serum IgE as material with RNA isolation kit；According to CsAlaDC's MRNA sequence designs primer, and with reverse transcription PCR method the total length of the gene, and sequence verification are obtained.Retroviral gene clone adopted Primer is SDC-RT-F1: 5′- CTCCTCGGATTCTCAAACCTC AC-3′；SDC-RT-R: 5′- CACACAAACGATAGTAGAACCAACA-3′。
（2）Real time PCR：Quantitative fluorescent PCR adopts the real-time PCR systems of ABI 7500（Applied Biosystems）, it is marked with SYBR Green dyestuffs.Reference gene selects tea tree GAPDH genes (GE651107).Using Primer be SDC-QRT-F: 5′-GGGAAGAACGTGCACACAAC-3′； SDC-QRT-R: 5′- CTAACCAAGACACCGGCCAT-3′； GAPDH-F:5 '-TTGGCATCGTTGAGGG TCT-3 ' and GAPDH-R:5′- CAGTGGGAACACGGAAAGC-3′.Reaction system is 25ml, comprising 0.5mL LATaq, 5mL PCR buffer solutions, 2 mL DNTP (2.5 mM), 0.5mL primers (10 M), 1mL cDNA (40 ng) and 15.5mL ddH2O.Reaction condition is: 94 DEG C, 3 minutes；95 DEG C, 30 seconds；59 DEG C, 30 seconds；72 DEG C, 1 minute；30 circulations.72 DEG C, 10 minutes；4 DEG C of preservations.Every group of sample 3 repetitions of product.As shown in figure 3, the different tissues position such as root, mature leaf, two leaves and a bud CsAlaDC bases in three tea tree breeds Because of qPCR relative quantification results, tea tree CsAlaDC genes specifically expressing in tea root is illustrated.The gene sequence of tea tree CsAlaDC Row are as shown in Figure 2.The gene order of tea tree CsAlaDC as shown in SEQ ID No.1, its coding protein amino acid sequence As shown in SEQ ID No.2.
（3）The recombinant expressed purifying of transgene protein：The encoder block of tea tree CsAlaDC full-length cDNAs is cloned into and is opened containing T7 On the prokaryotic expression carrier pET28b of mover.Concrete steps include：Design special primer：- CGGGATCC (the BamH of forward primer 5 ' I)ATGGAAGGGACTGTGTCAGTGCTATC and reverse primer 5’-CCCAAGCTT(Hind III) GTTTATGAAGATCACAATCACAATT CTCAC；Expression vector establishment：CsAlaDC gene Jing phenol, the phenol/chlorine of PCR amplifications It is imitative（1:1）, chloroform/isoamyl alcohol（24:1）After extracting and purifying, with BamH I and Hind III double digestions, low melting point gel electrophoresis point From the segment for reclaiming 1 500 bp or so.The expression vector pET-28b connections of fragment double digestion identical with Jing will be reclaimed again, from And by CsAlaDC genes directed cloning to expression vector pET-28b, and the recombinant plasmid containing insertion is named as PET-AlaDC, recombinant plasmid pET-AlaDC is transformed into E.coli BL21, builds engineering bacteria；IPTG induces large intestine table Up to and protein purification：The single bacterium colony of the engineering bacteria of picking Jing DNA sequence verifications, accesses 5 ml and contains ampicillin（50μg/ ml）LB culture mediums, 37 DEG C of shaken cultivations overnight, take 50 μ l access 5 ml contain ampicillin（50μg/ml）LB training Foster base, 37 DEG C of h of shaken cultivation 2 or so, add IPTG to the mmol/L of final concentration 0.05, in 16-22 DEG C of abduction delivering 12-18 H, the r/min of room temperature 5 000 are centrifuged 5 min collects thallines.After bacterial cell disruption, affinity chromatography purification of recombinant proteins is used, washed De- liquid is 160mM imidazoles, and dislysate is 25mM Tris-HCl（pH 7.4）, 150mM NaCl, 10% glycerine.As shown in figure 4, The polyacrylamide gel electrophoresis of CsAlaDC albumen pronucleus purifying（SDS-PAGE）Figure.
（4）Alanine decarboxylation activity is verified
The pure enzyme liquids of 10 μ L are added in 90 μ L reaction buffer A（10mM alanine, the phosphoric acid of 100mM pH 7.2-pH 7.8 Potassium buffer solution, 0.08-0.12 mM phosphopyridoxal pyridoxal phosphates, 5mM dithiothreitol (DTT)s, 1mM K2EDTA, 10% glycerine）, after mixing, In 35 DEG C of -45 DEG C of water-baths 2h and 24h, 45 μ L reactant liquors are taken respectively in new centrifuge tube, plus the trichloroacetic acid of 5 μ L 10% stops Reaction, after standing 5min, adds the dilution of 400 μ L ultra-pure waters, enters according to the method in Waters AccQ Tag amino acid analysis bags Row is derivative, high performance liquid chromatograph detection product assay.Wherein alanine depickling enzymic catalytic reaction is as shown in Figure 1.HPLC is detected It was found that, ethamine is detected during catalytic reaction 2h, during catalytic reaction 24h, ethamine is accumulated in a large number（Increased 6 times）, illustrate the restructuring There is albumen the decarboxylation of catalysis alanine to form ability (Fig. 5 of ethamine；Fig. 6).
SEQUENCE LISTING
<110>Tea Inst., Chinese Academy of Agricultural Sciences
<120>A kind of protein of catalysis alanine decarboxylation and its gene and application
<130> 11
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 1437
<212> DNA
<213>Tea tree
<400> 1
atggaaggga ctgtgtcagt gctatcgaat gtgagcaagg tggagctgtt gtcgaagtgc 60
tttgatctca ttaccatccc tgtggaaccc ttgcctccgg ttgtggcttc caacggagtt 120
gctggcggag agacgaagaa gatgaaggag aaggatattg ttctggggaa gaacgtgcac 180
acaacaagcc tcaccatcac ggagcctgat gtggacgatg actccaccag cgatatggag 240
gccttcatgg ccggtgtctt ggttaggtat cgcaaaactc tcattgagaa gaccaagtat 300
catttaggct atccatttaa tctggacttg gattatggtc ctctagcgga attgcagcat 360
ttcgccataa acaaccttgg cgatccattt attgaaagca actatggtgt tcattcaaga 420
caatttgaag tgggtgtttt ggattggttt gcccgtctat gggaaataga gcagaaagaa 480
tactggggat acattacaaa tggtggcaca gaaggcaatc ttcatggaat cctggttgga 540
agagaagtgt ttccagatgg aattttttat acgtcgcaag aatcacatta ctctatcttc 600
aaagcagcac ggatgtacag aatggaatgc gttaaggtcg gcactttaat caatggggag 660
attgattgtg cagatttcaa agcaaagcta ctttctaaca aggacaaacc agccataatt 720
aatttgaaca taggtactac tgtcaaagga gcggttgatg atattgatct tgttatacaa 780
acccttgaag aatgtggatt ctcgcatgat cgattctaca tccactgtga tggggctctg 840
tttggattca tgatgccatt tctcaaccgt ggaccgaaaa taaccttcaa gaagcccatt 900
ggaagtgtga gtgtttctgg ccacaagttt atgggatgtc caacgccgtg cggtgtccag 960
ataacaaggc ttgagcacat taatgcctta tcaaggaatg tcgaatacct tgcttcaagg 1020
gatgccacaa tcacaggaag ccggaacggc cactctccaa tcattctgtg gtacgcgctg 1080
aacagaaaag gtttcaaggg gttccagaaa gaagtccaaa agtgcctcag aaatgctcac 1140
tatttgaaag accgccttag ggaagcaggt attagtgcca tgctaaatga gcttagtagc 1200
acggttgtgt ttgagcgacc tctagatgag gagtttgttc ggcgttggca acttgcatgc 1260
gagggaaata tggcacatgt tattgtgatg cctaatgtca ccattgagaa gctggatgaa 1320
ttcttgaatg aattagttca aaagcgcgcg aattggtaca acgatgggaa agctggacct 1380
ccttgtcttg caccagatat aggaagtgag aattgtgatt gtgatcttca taaatga 1437
<210> 2
<211> 478
<212> PRT
<213>Tea tree
<400> 2
Met Glu Gly Thr Val Ser Val Leu Ser Asn Val Ser Lys Val Glu Leu Leu Ser Lys Cys
1 5 10 15 20
Phe Asp Leu Ile Thr Ile Pro Val Glu Pro Leu Pro Pro Val Val Ala Ser Asn Gly Val
25 30 35 40
Ala Gly Gly Glu Thr Lys Lys Met Lys Glu Lys Asp Ile Val Leu Gly Lys Asn Val His
45 50 55 60
Thr Thr Ser Leu Thr Ile Thr Glu Pro Asp Val Asp Asp Asp Ser Thr Ser Asp Met Glu
65 70 75 80
Ala Phe Met Ala Gly Val Leu Val Arg Tyr Arg Lys Thr Leu Ile Glu Lys Thr Lys Tyr
85 90 95 100
His Leu Gly Tyr Pro Phe Asn Leu Asp Leu Asp Tyr Gly Pro Leu Ala Glu Leu Gln His
105 110 115 120
Phe Ala Ile Asn Asn Leu Gly Asp Pro Phe Ile Glu Ser Asn Tyr Gly Val His Ser Arg
125 130 135 140
Gln Phe Glu Val Gly Val Leu Asp Trp Phe Ala Arg Leu Trp Glu Ile Glu Gln Lys Glu
145 150 155 160
Tyr Trp Gly Tyr Ile Thr Asn Gly Gly Thr Glu Gly Asn Leu His Gly Ile Leu Val Gly
165 170 175 180
Arg Glu Val Phe Pro Asp Gly Ile Phe Tyr Thr Ser Gln Glu Ser His Tyr Ser Ile Phe
185 190 195 200
Lys Ala Ala Arg Met Tyr Arg Met Glu Cys Val Lys Val Gly Thr Leu Ile Asn Gly Glu
205 210 215 220
Ile Asp Cys Ala Asp Phe Lys Ala Lys Leu Leu Ser Asn Lys Asp Lys Pro Ala Ile Ile
225 230 235 240
Asn Leu Asn Ile Gly Thr Thr Val Lys Gly Ala Val Asp Asp Ile Asp Leu Val Ile Gln
245 250 255 260
Thr Leu Glu Glu Cys Gly Phe Ser His Asp Arg Phe Tyr Ile His Cys Asp Gly Ala Leu
265 270 275 280
Phe Gly Phe Met Met Pro Phe Leu Asn Arg Gly Pro Lys Ile Thr Phe Lys Lys Pro Ile
285 290 295 300
Gly Ser Val Ser Val Ser Gly His Lys Phe Met Gly Cys Pro Thr Pro Cys Gly Val Gln
305 310 315 320
Ile Thr Arg Leu Glu His Ile Asn Ala Leu Ser Arg Asn Val Glu Tyr Leu Ala Ser Arg
325 330 335 340
Asp Ala Thr Ile Thr Gly Ser Arg Asn Gly His Ser Pro Ile Ile Leu Trp Tyr Ala Leu
345 350 355 360
Asn Arg Lys Gly Phe Lys Gly Phe Gln Lys Glu Val Gln Lys Cys Leu Arg Asn Ala His
365 370 375 380
Tyr Leu Lys Asp Arg Leu Arg Glu Ala Gly Ile Ser Ala Met Leu Asn Glu Leu Ser Ser
385 390 395 400
Thr Val Val Phe Glu Arg Pro Leu Asp Glu Glu Phe Val Arg Arg Trp Gln Leu Ala Cys
405 410 415 420
Glu Gly Asn Met Ala His Val Ile Val Met Pro Asn Val Thr Ile Glu Lys Leu Asp Glu
425 430 435 440
Phe Leu Asn Glu Leu Val Gln Lys Arg Ala Asn Trp Tyr Asn Asp Gly Lys Ala Gly Pro
445 450 455 460
Pro Cys Leu Ala Pro Asp Ile Gly Ser Glu Asn Cys Asp Cys Asp Leu His Lys
465 470 475

Claims (7)

1. a kind of protein of catalysis alanine decarboxylation, it is characterised in that the amino acid sequence of the protein is：
1）Amino acid sequence shown in SEQ ID No.2；Or
2）Amino acid sequence Jing shown in SEQ ID No.2 is replaced, is lacked and/or add one or several amino acid residue shapes Into the amino acid sequence with equal function.
2. the gene of protein described in claim 1 is encoded, it is characterised in that the nucleotides sequence of the gene is classified as：
1）Nucleotides shown in SEQ ID No.1；Or
2）Nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotides, obtains encoding the core of CsAlaDC Nucleotide sequence.
3. the recombinant vector of encoding gene as claimed in claim 2 is contained.
4. the encoding gene as described in claim 2 forms the application in ethamine in the decarboxylation of catalysis alanine.
5. application of the encoding gene as described in claim 2 in the theanine synthesis of regulation and control tea tree.
6. the method that a kind of decarboxylation of catalysis alanine forms ethamine, it is characterised in that comprise the steps：Encoding gene is imported In Escherichia coli, abduction delivering obtains recombinant protein, and will mix with alanine solution after recombinant protein purification carries out catalysis and obtain Ethamine, the nucleotides sequence of described encoding gene is classified as：
1）Nucleotides shown in SEQ ID No.1；Or
2）Nucleotide sequence shown in SEQ ID No.1 is substituted one or several nucleotides, obtains encoding the core of CsAlaDC Nucleotide sequence.
7. the method that a kind of catalysis alanine as claimed in claim 6 decarboxylation forms ethamine, it is characterised in that alanine decarboxylation The condition of the catalytic reaction of enzyme be 10mM alanine, the kaliumphosphate buffer of 100mM, 0.08-0.12 mM phosphopyridoxal pyridoxal phosphates, 5mM dithiothreitol (DTT)s, 1mM K2EDTA, 10% glycerine, reaction solution pH is：The reaction temperatures of pH 7.2-pH 7.8 be 35 DEG C- 45℃。
CN201611029174.6A 2016-11-22 2016-11-22 A kind of protein being catalyzed alanine decarboxylation and its gene and application Active CN106636047B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611029174.6A CN106636047B (en) 2016-11-22 2016-11-22 A kind of protein being catalyzed alanine decarboxylation and its gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611029174.6A CN106636047B (en) 2016-11-22 2016-11-22 A kind of protein being catalyzed alanine decarboxylation and its gene and application

Publications (2)

Publication Number Publication Date
CN106636047A true CN106636047A (en) 2017-05-10
CN106636047B CN106636047B (en) 2019-03-19

Family

ID=58808807

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611029174.6A Active CN106636047B (en) 2016-11-22 2016-11-22 A kind of protein being catalyzed alanine decarboxylation and its gene and application

Country Status (1)

Country Link
CN (1) CN106636047B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022014196A1 (en) * 2020-07-14 2022-01-20 太陽化学株式会社 Method for producing theanine-producing microorganism
CN115612691A (en) * 2021-07-15 2023-01-17 安徽农业大学 Method for synthesizing L-theanine in non-tea plant

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
WEI-WEIDENG等: "Biosynthesis of theanine (γ-ethylamino-l-glutamic acid) in seedlings of Camellia sinensis", 《PHYTOCHEMISTRY LETTERS》 *
无: "HP746974.1", 《EMBL》 *
陈琪: "茶树茶氨酸代谢相关基因表达组织特异性分析", 《核农学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022014196A1 (en) * 2020-07-14 2022-01-20 太陽化学株式会社 Method for producing theanine-producing microorganism
CN115612691A (en) * 2021-07-15 2023-01-17 安徽农业大学 Method for synthesizing L-theanine in non-tea plant
CN115612691B (en) * 2021-07-15 2024-04-23 安徽农业大学 Method for synthesizing L-theanine in non-tea plant

Also Published As

Publication number Publication date
CN106636047B (en) 2019-03-19

Similar Documents

Publication Publication Date Title
CN108424900A (en) A kind of nitrilase mutants and its construction method and application
CN103865952B (en) The auxin response factor gene PeARF17.1 of a kind of poplar adjusted and controlled growth promoter and application thereof
CN109554414B (en) Application of flammulina velutipes genes Fvegt1, Fvegt2 and Fvegt3 in synthesis of ergothioneine
Radwanski et al. Arabidopsis thaliana tryptophan synthase alpha: gene cloning, expression, and subunit interaction
CN105481955A (en) Fast-growing aquatic plant nitrate transport protein GeNRT2.1 and coding gene and application thereof
CN106636047A (en) Protein capable of catalyzing decarboxylation of alanine, as well as gene and application thereof
JPS584799A (en) Dna arrangement
CN114164187B (en) Tea tree caffeine transport protein, and encoding gene and application thereof
CN109337918A (en) A kind of tobacco protein kinase gene NtCIPK1 and its cloning process and application
CN103103234A (en) Method for synthesizing nicotinamide adenine dinucleotide (NAD) by immobilized enzyme
CN109468329A (en) A kind of tobacco outward rectification potassium-channel gene NtSKOR1 and its cloning process and application
CN109468334A (en) A kind of tobacco protein kinase gene NtCIPK25-1 and its cloning process and application
CN106047895B (en) Artemisia apiacea bZIP transcription factor coding sequence, cloning method and application
CN109337884B (en) Pyruvate kinase gene and application thereof
CN107365777A (en) One grows tobacco nicotine content controlling gene NtCLC b and its cloning process and application
CN110229828A (en) The mutated gene soxR of the Escherichia coli global regulation factor and application
CN112342224B (en) Porphyra haitanensis glutamate dehydrogenase gene and application thereof
CN109371037A (en) Tobacco AKT1 gene and application
CN108977455A (en) For producing the recombinant plasmid, escherichia expression system and methods and applications of oxalate decarboxylase
CN112142853B (en) Cabbage type rape BnTLK1 gene related to fungal disease and application thereof
CN106906216B (en) Soybean anther, ovule and root cap specific promoter GmFTL2 and application thereof
CN105017399A (en) Schistosoma japonicum SjPPase recombinant antigen protein and preparation method and application thereof
CN106086038B (en) Artemisia apiacea WRKY transcription factor coding sequence, cloning method and application
CN106795511A (en) Oxidizing ferment, the polynucleotides for encoding the enzyme and their application
JPH04330285A (en) Phenylalanine ammonialyase gene of pea and its use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant