CN106636036A

CN106636036A - Hyaluronidase mutant and application thereof

Info

Publication number: CN106636036A
Application number: CN201611152227.3A
Authority: CN
Inventors: 吴银娣
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-12-14
Filing date: 2016-12-14
Publication date: 2017-05-10

Abstract

The invention discloses a hyaluronidase mutant and application thereof, and belongs to the field of enzyme engineering. The hyaluronidase mutant is expressed by food stage safe industrial strains of bacillus subtilis; the hyaluronidase production strain is obtained. The recombinant bacillus subtilis strain is used for fermentation; the mutant coarse enzyme liquid of the hyaluronidase can be obtained through collection in fermentation supernatant; the hyaluronidase maintains good activity in a pH range of 4 to 9. Compared with that before the mutation, the acid-resistant performance is improved; under the condition that the temperature is 25 to 40 DEG C, high activity can be maintained. Compared with that before the mutation, the low-temperature-resistant performance is obviously improved.

Description

A kind of hyaluronic acid enzyme mutant and its application

Technical field

The present invention relates to a kind of hyaluronic acid enzyme mutant and its application, belong to enzyme engineering field.

Background technology

The main selectivity hydrolysis hyaluronic acid of hyaluronidase (hyaluronidase, HAase), is widely present in eucaryon In prokaryotes, participate in many important biological processes in animal body, for example cell division, intercellular connection, The activity of reproduction cell, the transfection of DNA, embryonic development, the reparation of wounded tissue, and normal cell and tumor cell proliferation, It is a kind of important physiological activator.And found first by Duran Reynals in nineteen twenty-eight and be referred to as " invasin ", Hyaluronidase was officially named by Chain and Duthie in 1940.

According to the substrate specificity and catalyst mechanism of hyaluronic acid enzyme effect, leech hyaluronidase belongs to hyaluronic acid 3- Glycosyl hydrolase family (EC 3.2.1.36), by the β -1, the 3- glycosidic bonds that hydrolyze HA, produces with four glycan molecule HA and reducing end With the product based on glucuronic acid.

The hyaluronidase in leech source is strong to the selectivity of substrate, and compared with the hyaluronidase that other are originated, it is right Chondroitin sulfate, chondroitin-4-suleate and 6- chondroitin sulfates be not active, and does not have transglycosylation, and activity is not received Heparin affects.Therefore, leech hyaluronidase is used for clinical medicinal more medical value meaning.Nineteen forty-one, Hirst confirmed first The strong antibiotic property of leech hyaluronidase.Correlative study experiment has confirmed hyaluronidase to treating miocardial infarction effect Significantly.Hyaluronidase also has important effect, malignant tissue's mucopolysaccharide Jing after hyaluronic acid ferment treatment in anti-tumor aspect Content increases, and is conducive to tumour cell to combine more cancer therapy drugs.Additionally, hyaluronidase is clinically as " medicine expands The scattered factor ", treatment thrombus, glaucoma and other medicinal aspects have bigger using value.

At present, the optimal pH of the hyaluronidase in leech source is 5～7, and optimal reactive temperature is 36 DEG C～38 DEG C.The spy Property is not appropriate for industrial applications.During commercial Application, often the temperature of reaction system is improved once from room temperature, be required for disappearing Consume more energy.

The content of the invention

The present invention is intended to provide a kind of hyaluronic acid enzyme mutant, the mutant has wider range of optimal reactive temperature, Catalysis activity is also improved.

The amino acid sequence of the hyaluronic acid enzyme mutant, is on the basis of amino acid sequence shown in SEQ ID NO.1, to incite somebody to action 121st glycine G sports leucine L, while the threonine T of 299 is sported into isoleucine I, while by 321 Alanine mutation is proline P.

The present invention also provides a kind of recombinant bacterium of expression hyaluronic acid enzyme mutant, is with bacillus subtilis 168 For host, with pMA5 carriers as expression vector, with the secreting, expressing that wapA signal peptides guide enzyme.

In one embodiment of the invention, signal peptide wapA is passed through into NdeI and EcoRI restriction enzyme site weights Group is to pMA5, then obtains coding N-terminal by PCR and have hyaluronic acid enzyme mutant gene H of 6 histidines, by gene H fragments and The pMA5 carriers for carrying signal peptide wapA are cut using EcoRI, BamHI restriction enzyme site is double, then connect, and convert withered grass Bacillus 168, obtains recombinant bacterium.

The present invention is also provided using the method for the recombinant bacterium fermenting and producing hyaluronic acid enzyme mutant, is connect by 10% Kind amount by seed culture fluid turn be inoculated in fermentation medium, fermentation medium consist of dusty yeast 18g/L, sucrose 20g/L, Sodium dihydrogen phosphate 15g/L, potassium sulfate 4g/L, 30 DEG C of 220rpm cultures, fermented and cultured 60h.

The present invention carries out the hyaluronic acid enzyme mutant using the industrial strain bacillus subtilis of grade-safe Expression, obtains hyaluronidase production bacterial strain.With the recombined bacillus subtilis fermentation, can collect in fermented supernatant fluid To the mutant crude enzyme liquid of hyaluronidase, the enzyme keeps activity well in the range of pH4～9, before comparing mutation, resistance to Acidity can on have been improved；Activity well can be kept under conditions of 25～40 DEG C of temperature, before comparing mutation, in tolerance low temperature Performance on be obviously improved.

Specific embodiment

Enzyme activity determination method：Reaction system is 1ml, is configured with the citrate-phosphate disodium hydrogen buffer solution of pH 5.5,50mM The HA of 2mg/ml, reaction system adds HA solution, the fermented supernatant fluid enzyme liquid of 100 μ l of 400 μ l, buffer solution to complement to 1ml； 38 DEG C of reaction 20min, immediately boiling water terminating reaction, the reduced sugar equivalent for producing is determined using DNS methods, and 1U is to hydrolyze in one hour Produce enzyme amount needed for 1 μ g reduced sugars.

The acquisition of the hyaluronic acid enzyme mutant of embodiment 1

(1) setting out the 121st glycine G, the threonine of 299 of encode in nucleotide sequence shown in SEQ ID NO.2 T, the sequence of the alanine A of 321 sport respectively coding leucine L, isoleucine I, the core of proline P by distribution PCR Nucleotide sequence.

(2) 6 histidines are introduced to hyaluronic acid enzyme mutant N-terminal, design primer PCR obtains coding N-terminal there are 6 group ammonia Hyaluronic acid enzyme mutant gene H of acid.Primer sequence is：

F：CCGGAATTCCACCACCACCACCACCACATGAAAGAGATCGCGGTGAC

R：CGCGGATCCTTATTTTTTGCAGGCTTCAACGTTAG

With B. subtilis-E. coli shuttle vector pMA5 as expression vector, by signal peptide wapA (MKKRKRRNFKRFIAAFLVLALMISLVPA) recombinated to pMA5 by NdeI and EcoRI restriction enzyme sites.

Gene H fragments and the pMA5 carriers for carrying signal peptide wapA are respectively adopted into the restricted digestion position of EcoRI, BamHI Point is double to be cut, and carrier and purpose fragment are respectively adopted agarose gel electrophoresis and cut glue reclaim, and recovery product is attached, the μ of system 10 l：The double carriers cut of 1 μ l, the double purpose fragments cut of 4 μ l, 5 μ l Solution ligases, 16 DEG C of connections overnight, convert JM109 Competent cell, picking single bacterium colony PCR checking, positive recombinant is sequenced, and is compared correct.Select the correct restructuring gram of sequencing Grand bacterium pMA5-wapA-H.Recombinant plasmid electricity is proceeded in expressive host Bacillus subtilis 168, the sub- Jing PCR of recombinant clone Checking is correct.Hyaluronidase before mutation is expressed with same policy, as control 1, with zero load as negative control.

(3) verify that correct recombined bacillus subtilis bacterial strain pMA5-wapA-H carries out fermented and cultured expression.Monoclonal connects Plant in the LB culture mediums of 5ml, 37 DEG C, 200rpm culture 16h.Transfer in the expression inorganic salts culture of 25ml by 10% inoculum concentration Base (dusty yeast 18g/L, sucrose 20g/L, sodium dihydrogen phosphate 15g/L, potassium sulfate 4g/L), 30 DEG C of 220rpm cultures, fermented and cultured 60h, is collected by centrifugation fermented supernatant fluid, and used as crude enzyme liquid, the result of SDS-PAGE electrophoretic analysis fermented supernatant fluids shows in 58kDa There is target stripe in left and right, and enzyme activity is 1945.5U/ml in fermented liquid supernatant, and the vigor of unmutated hyaluronidase is 15894U/ml, negative control does not detect hyaluronic acid enzyme activity.

The determination of activity of the hyaluronic acid enzyme mutant of embodiment 2

(1) impacts of the pH to enzyme activity

Before enzyme-added, enzyme activity determination system is adjusted with the HCl solution of the NaOH solution of 0.1mol/L or 0.1mol/L PH for not be 2,3,4,5,6,7,8,9, respectively measure hyaluronic acid enzyme mutant, the vigor of unmutated hyaluronidase.With Based on the enzyme activity reaction system of each comfortable pH 5.5 of two enzymes, respective remnant enzyme activity is calculated.

Table 1

(2) impact of the temperature to enzyme activity

By hyaluronic acid enzyme mutant, unmutated hyaluronidase crude enzyme liquid respectively 20 DEG C, 25 DEG C, 30 DEG C, 35 DEG C, 40 DEG C, under the conditions of 45 DEG C, be incubated 30min, be subsequently used for determining enzyme activity.Based on the enzyme activity of each comfortable 38 DEG C of two enzymes, meter Calculate respective remnant enzyme activity.

Table 2

Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention Enclosing should be by being defined that claims are defined.

SEQUENCE LISTING

<110>Wu Yindi

<120>A kind of hyaluronic acid enzyme mutant and its application

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 489

<212> PRT

<213>Leech

<400> 1

Met Lys Glu Ile Ala Val Thr Ile Asp Asp Lys Asn Val Ile Ala Ser

1 5 10 15

Val Ser Glu Ser Phe His Gly Val Ala Phe Asp Ala Ser Leu Phe Ser

20 25 30

Pro Lys Gly Leu Trp Ser Phe Val Asp Ile Thr Ser Pro Lys Leu Phe

35 40 45

Lys Leu Leu Glu Gly Leu Ser Pro Gly Tyr Phe Arg Val Gly Gly Thr

50 55 60

Phe Ala Asn Trp Leu Phe Phe Asp Leu Asp Glu Asn Asn Lys Trp Lys

65 70 75 80

Asp Tyr Trp Ala Phe Lys Asp Lys Thr Pro Glu Thr Ala Thr Ile Thr

85 90 95

Arg Arg Trp Leu Phe Arg Lys Gln Asn Asn Leu Lys Lys Glu Thr Phe

100 105 110

Asp Asp Leu Val Lys Leu Thr Lys Gly Ser Lys Met Arg Leu Leu Phe

115 120 125

Asp Leu Asn Ala Glu Val Arg Thr Gly Tyr Glu Ile Gly Lys Lys Met

130 135 140

Thr Ser Thr Trp Asp Ser Ser Glu Ala Glu Lys Leu Phe Lys Tyr Cys

145 150 155 160

Val Ser Lys Gly Tyr Gly Asp Asn Ile Asp Trp Glu Leu Gly Asn Glu

165 170 175

Pro Asp His Thr Ser Ala His Asn Leu Thr Glu Lys Gln Val Gly Glu

180 185 190

Asp Phe Lys Ala Leu His Lys Val Leu Glu Lys Tyr Pro Thr Leu Asn

195 200 205

Lys Gly Ser Leu Val Gly Pro Asp Val Gly Trp Met Gly Val Ser Tyr

210 215 220

Val Lys Gly Leu Ala Asp Gly Ala Gly Asp His Val Thr Ala Phe Thr

225 230 235 240

Leu His Gln Tyr Tyr Phe Asp Gly Asn Thr Ser Asp Val Ser Thr Tyr

245 250 255

Leu Asp Ala Thr Tyr Phe Lys Lys Leu Gln Gln Leu Phe Asp Lys Val

260 265 270

Lys Asp Val Leu Lys Asn Ser Pro His Lys Asp Lys Pro Leu Trp Leu

275 280 285

Gly Glu Thr Ser Ser Gly Tyr Asn Ser Gly Thr Lys Asp Val Ser Asp

290 295 300

Arg Tyr Val Ser Gly Phe Leu Thr Leu Asp Lys Leu Gly Leu Ser Ala

305 310 315 320

Ala Asn Asn Val Lys Val Val Ile Arg Gln Thr Ile Tyr Asn Gly Tyr

325 330 335

Tyr Gly Leu Leu Asp Lys Asn Thr Leu Glu Pro Asn Pro Asp Tyr Trp

340 345 350

Leu Met His Val His Asn Ser Leu Val Gly Asn Thr Val Phe Lys Val

355 360 365

Asp Val Ser Asp Pro Thr Asn Lys Ala Arg Val Tyr Ala Gln Cys Thr

370 375 380

Lys Thr Asn Ser Lys His Thr Gln Ser Arg Tyr Tyr Lys Gly Ser Leu

385 390 395 400

Thr Ile Phe Ala Leu Asn Val Gly Asp Glu Asp Val Thr Leu Lys Ile

405 410 415

Asp Gln Tyr Ser Gly Lys Lys Ile Tyr Ser Tyr Ile Leu Thr Pro Glu

420 425 430

Gly Gly Gln Leu Thr Ser Gln Lys Val Leu Leu Asn Gly Lys Glu Leu

435 440 445

Lys Leu Val Ser Asp Gln Leu Pro Glu Leu Asn Ala Asp Glu Ser Lys

450 455 460

Thr Ser Phe Thr Leu Ser Pro Lys Thr Phe Gly Phe Phe Val Val Ser

465 470 475 480

Asp Ala Asn Val Glu Ala Cys Lys Lys

485

<210> 2

<211> 1470

<212> DNA

<213>Leech

<400> 2

atgaaagaga tcgcggtgac aattgacgat aagaacgtta ttgcctctgt cagcgagtca 60

ttccatggtg ttgcctttga tgcgtcgtta ttttcaccga aggggttgtg gagctttgtt 120

gacattacct caccgaaatt gtttaaactc ttggagggtc tctctcctgg ttacttcagg 180

gttggaggaa cgtttgctaa ctggctgttc tttgacttag atgaaaataa taagtggaaa 240

gactattggg cttttaaaga taaaacaccc gagactgcaa caatcacaag gaggtggctg 300

tttcgaaaac aaaacaacct gaaaaaagag acttttgacg acttagtcaa actaaccaaa 360

ggaagcaaaa tgagactgtt atttgattta aacgctgaag tgagaactgg ttatgaaatt 420

ggaaagaaaa tgacatccac ttgggatagc tcggaagctg aaaaattatt caaatactgt 480

gtgtcaaaag gttatggaga taatattgat tgggaacttg gtaatgaacc ggaccatacc 540

tccgcacaca atcttactga aaagcaagtt ggagaggact ttaaagccct gcataaagtg 600

ctagagaaat atccgacgtt gaataaagga tcgcttgttg gacctgacgt tggatggatg 660

ggagtctctt atgtgaaagg attagcagac ggggctggtg atcacgtaac cgcttttact 720

cttcatcagt attattttga cggcaatacc tcagatgtgt caacatacct tgacgctact 780

tattttaaaa aacttcaaca gctgtttgac aaagttaagg atgtcttgaa aaattctcca 840

cataaagata aaccgctctg gcttggagaa acaagttctg gatacaacag cggcacaaaa 900

gatgtatccg atcgatatgt tagcggattt ctaacattgg acaagttggg actcagtgca 960

gcgaacaatg tgaaagttgt gataagacaa acgatctata atggatacta cggacttctt 1020

gataaaaata ctctagagcc aaatccggat tattggctaa tgcatgttca caattctctg 1080

gttggaaata cggtttttaa agttgacgtt agtgacccta caaataaagc tagagtttat 1140

gcacagtgca ccaaaacaaa tagcaaacat actcagagta gatactacaa gggctcattg 1200

acgatctttg ctcttaatgt tggagatgaa gatgtgacgt tgaagattga tcaatacagt 1260

ggaaaaaaga tttattcata tattctgacc ccagaaggcg gccaacttac atcacaaaaa 1320

gttcttttga atggaaaaga attaaaatta gtgtcggatc aattgccaga actgaatgca 1380

gacgagtcga aaacctcttt cactctgtct ccaaagacat ttggattttt tgttgttagc 1440

gatgctaacg ttgaagcctg caaaaaataa 1470

<210> 3

<211> 47

<212> DNA

<213>Artificial sequence

<400> 3

ccggaattcc accaccacca ccaccacatg aaagagatcg cggtgac 47

<210> 4

<211> 35

<212> DNA

<213>Artificial sequence

<400> 4

cgcggatcct tattttttgc aggcttcaac gttag 35

<210> 5

<211> 28

<212> PRT

<213> wapA

<400> 5

Met Lys Lys Arg Lys Arg Arg Asn Phe Lys Arg Phe Ile Ala Ala Phe

1 5 10 15

Leu Val Leu Ala Leu Met Ile Ser Leu Val Pro Ala

20 25

Claims

1. a kind of hyaluronic acid enzyme mutant, it is characterised in that the amino acid sequence of the hyaluronic acid enzyme mutant, is in SEQ On the basis of amino acid sequence shown in ID NO.1, the 121st glycine G is sported into leucine L, while by the threonine of 299 T sports isoleucine I, while being proline P by the alanine mutation of 321.

2. the gene of hyaluronic acid enzyme mutant described in claim 1 is encoded.

3. the carrier or cell of gene described in claim 2 are carried.

4. it is a kind of expression claim 1 described in hyaluronic acid enzyme mutant recombinant bacterium, it is characterised in that be with bacillus subtilis Bacterium 168 is host, with pMA5 carriers as expression vector, with the secreting, expressing that wapA signal peptides guide enzyme.

5. recombinant bacterium according to claim 4, it is characterised in that signal peptide wapA is restricted by NdeI and EcoRI Restriction enzyme site is recombinated to pMA5, then has hyaluronic acid enzyme mutant gene H of 6 histidines by PCR acquisition coding N-terminals, will The pMA5 carriers of gene H fragments and carrying signal peptide wapA are cut using EcoRI, BamHI restriction enzyme site is double, Ran Houlian Connect, convert bacillus subtilis 168, obtain recombinant bacterium.

6. using recombinant bacterium fermenting and producing hyaluronic acid enzyme mutant described in claim 4 method, it is characterised in that be by 10% inoculum concentration turns seed culture fluid to be inoculated in fermentation medium, and fermentation medium consists of dusty yeast 18g/L, sugarcane Sugared 20g/L, sodium dihydrogen phosphate 15g/L, potassium sulfate 4g/L, 30 DEG C of 220rpm cultures, fermented and cultured 60h.

7. application of the hyaluronic acid enzyme mutant in hyaluronic acid is prepared described in claim 1.

8. application of the hyaluronic acid enzyme mutant described in claim 1 in the medicine for treating miocardial infarction is prepared.

9. application of the hyaluronic acid enzyme mutant described in claim 1 in preparing for anti-tumor drug.