CN106632338A - 9-subsituted-N-(2-chlorobenzyl)purine-6-amine derivative, as well as preparation method and application thereof - Google Patents
9-subsituted-N-(2-chlorobenzyl)purine-6-amine derivative, as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN106632338A CN106632338A CN201611168399.XA CN201611168399A CN106632338A CN 106632338 A CN106632338 A CN 106632338A CN 201611168399 A CN201611168399 A CN 201611168399A CN 106632338 A CN106632338 A CN 106632338A
- Authority
- CN
- China
- Prior art keywords
- purine
- chlorobenzyls
- amine
- replaces
- formula
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D473/00—Heterocyclic compounds containing purine ring systems
- C07D473/26—Heterocyclic compounds containing purine ring systems with an oxygen, sulphur, or nitrogen atom directly attached in position 2 or 6, but not in both
- C07D473/32—Nitrogen atom
- C07D473/34—Nitrogen atom attached in position 6, e.g. adenine
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a 9-subsituted-N-(2-chlorobenzyl)purine-6-amine derivative. The structure of the derivative is shown in a formula (I), where R is selected from a hydrogen atom, a C1-C4 alkyl group and a substituted or unsubstituted benzyl group, and a substituent on the benzyl group is one or more independently selected from halogen, -CF3, a C1-C4 alkoxy group, a C1-C4 alkyl group and a nitro group; R4 is a substituted or unsubstituted phenyl group or benzyl group, and a substituent on the phenyl group or the benzyl group is one or more of halogen and a methoxy group. Compared with a 6-benyl adenine compound complex gold ion (inhibitor 3), the 9-subsituted-N-(2-chlorobenzyl)purine-6-amine derivative is proved by testing results to have the advantages of higher inflammation factor inhibition rate, higher anti-inflammation activity and potential for use as an anti-inflammation medicament. (The formula (I) is shown in the description.).
Description
Technical field
The invention belongs to medicinal chemistry art, and in particular to a kind of 9- for anti-inflammatory replace-N- (2- chlorobenzyls) purine-
6- amine derivants and its preparation method and application.
Background technology
Inflammation (inflammation) is that body stimulates occurred defense reaction to pathogen, in being with vascular reaction
The heart, with the regeneration of essence and interstitial cell repairing damaged tissues.Under normal circumstances, inflammation is a self-limited course, with
Proinflammatory factors disappearance, proinflammatory reaction medium and anti-inflammatory response medium reach balance, inflammatory resolution, but in some special circumstances
Under, proinflammatory factors continuation low-intensity stimulates, and inflammatory reaction is persistently carried out, and switchs to chronic inflammation (chronic
Inflammation), it is this persistently exist, the inflammation that cannot disappear is also referred to as non-controllable property inflammation (non-resolving
inflammation).The inflammatory reaction of appropriateness shields to body, and the damage that chronic non-controllable property inflammation is caused to body
Wound is then far more than that proinflammatory factors body itself produces inflammation, can cause metabolism obstacle, cell degeneration and necrosis.In recent years,
Research finds that body inflammatory can induce the serious harm health of people such as angiocardiopathy and cancer under the influence of some factors, also
Disease.
6- benzyl purines compound complexing gold ion (inhibitor 3) can significantly drop with very strong anti-inflammatory activity
The expression of the inflammation factor that the low macrophage induced by LPS is produced, including TNF-α, IL-1 β etc., the anti-inflammatory of generation
Effect can reach the Indomethacin level for clinically using at present.But compound inhibitor 3 is carried out after structural analysis,
The part it was found that inhibitor 3 comes with some shortcomings, it is specific as follows：Because inhibitor 3 contains gold ion so that medicine is given birth to
Producing cost increases, and has increased the treatment burden of patient；If long-term taking, the accumulation of internal gold element can be caused, induce medicine
Side effect, limit its treatment to chronic inflammation；Compound contains heavy metal element, changes the polarity of purine compound,
Cause compound dissolubility in vivo and biology availability not high.Based on above-mentioned analysis, inhibitor 3 can be entered
Row targetedly design and structure optimization (see Fig. 1), to a kind of efficient and good chemical combination of cheap antiphlogistic effects to be obtained
Thing.
The content of the invention
The invention provides a kind of 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivants and preparation method thereof and answers
With the 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivants to have preferable anti-inflammatory activity, with as anti-inflammatory drug
Potentiality.
A kind of 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivants, shown in structure such as formula (I)：
In formula (I), R is selected from hydrogen atom, C1～C4One kind in alkyl, replacement or unsubstituted benzyl, wherein, benzyl
On substituent independently selected from halogen ,-CF3、C1～C4Alkoxyl, C1～C4One or more in alkyl and nitro；
R4To replace either unsubstituted phenyl or benzyl, wherein, the substituent on phenyl or benzyl be halogen or
One or more in person's methoxyl group.
Result of the test shows, compared with 6- benzyl purines compound complexing gold ion (inhibitor 3), the 9- of the present invention
Replace-N- (2- chlorobenzyls) purine -6- amine derivatives higher to the inhibiting rate of inflammatory factor, with more preferable anti-inflammatory activity, tool
There are the potentiality as anti-inflammatory drug.
Preferably, described R4ForWhereinRepresent link position.
I.e. described 9- replaces the structure of-N- (2- chlorobenzyls) purine -6- amine derivants as follows：
Preferably, described 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivatives, structure such as formula (II)～(IV)
In one kind shown in：
In formula (II), R1Independently selected from H ,-CH3；
In formula (III), R2Independently selected from F, Cl ,-C (CH3)3, isobutyl group ,-CF3、-OCH3With-NO2In one or
It is multiple.
Preferably, the compound shown in formula (II) is L1～L2In one kind, the compound shown in formula (III) be L3~
L10In one kind, the species of substituent and position are as shown in the table 1 in specific embodiment.
It is following materialization to replace-N- (2- chlorobenzyls) purine -6- amine derivatives as further preferred, described 9-
Compound
In one kind：
N- (2- chlorobenzyls) -9- methyl -9H- purine -6- amine, chemical constitution is as follows：
N- (2- chlorobenzyls) -9- (4- chlorobenzyls) -9H- purine -6- amine, chemical constitution is as follows：
N- (2- chlorobenzyls) -9- (3,5- dimethoxy-benzyl) -9H- purine -6- amine, chemical constitution is as follows：
Present invention also offers a kind of described 9- replaces the preparation method of-N- (2- chlorobenzyls) purine -6- amine derivatives,
Comprise the following steps
Step 1：6-chloropurine is that raw material is obtained N- (2- chlorobenzyls) -9H- purine -6- amine with o-chlorine benzylamine substitution reaction.
Step 2：Obtained N- (2- chlorobenzyls) -9H- purine -6- amine is intermediate through substitution reaction in the step 1
Introduce 9 bit substituents.
Further say, specifically include following steps：
Step 1：80mg 6-chloropurines are weighed in 25mL round-bottomed flasks and 5mL n-butanols are added, ultrasonic dissolution, then
147mg 2- chlorobenzylamines are added, 2- chlorobenzylamines are 2 with the mol ratio of 6-chloropurine:1, and 50 μ L triethylamines are added as catalysis
Agent.5h is refluxed in 110 DEG C of oil bath heatings, extracting reaction solution carries out TLC race plates, and observing response completely, is cooled down under Ultraluminescence,
Suction filtration obtains solid, is recrystallized to give 6- (2- benzyl chloride amidos) purine.
Step 2：Weigh 90mg 6- (2- benzyl chloride amidos) purine and L2-L9The halogenated hydrocarbons of corresponding different structure is in appropriate
Round-bottomed flask in, the mol ratio of halogenated hydrocarbons and 6- (2- benzyl chloride amidos) purine is 2：1, appropriate solvent acetonitrile is measured, and add
80mg potassium carbonate is used as catalyst.24h is refluxed in 80 DEG C of oil bath heatings, decompression is carried out and is spin-dried for.Suitable quantity of water is added, gained is solid
Body suction filtration takes out, and liquid is spin-dried for system sand after being extracted with ethyl acetate, merge all solids, is purified using column chromatography.It is described
R selected from methyl replace or unsubstituted benzyl.
Structure such as formula (I)～(III) has synthesized altogether 10 compounds, L1-10, anti-inflammatory activity L1It is best
Present invention also offers a kind of described 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivants anti-in preparation
Application in scorching medicine.
Preferably, 9- of the described anti-inflammatory drug comprising therapeutically effective amount replaces-N- (2- chlorobenzyls) purine -6- amine to spread out
Biological and pharmaceutic adjuvant.
The formulation of described anti-inflammatory drug is injection, tablet, capsule, aerosol, suppository, film, pill, ointment
Agent, controlled release agent, sustained release agent or nanometer formulation.
Compared with the existing technology, beneficial effects of the present invention are embodied in：
The 9- of the present invention replaces-N- (2- chlorobenzyls) purine -6- amine derivatives to have certain inhibitory action to test cell,
Show certain anti-inflammatory activity.The compound L of synthesis1、L4Positive control drug 6- benzyls are generally higher than to the inhibiting rate of inflammatory factor
Base purine compound complexing gold ion (inhibitor 3), so this kind of compound has preferable antiinflammatory action.
Description of the drawings
Fig. 1 be prior art in 6- benzyl purines compound be complexed gold ion (inhibitor 3) structure carry out it is excellent
The mode of change；
Fig. 2 is the schematic diagram of all target compound toxicity detections of the invention；
Fig. 3 is the schematic diagram that all target compounds of the invention act on the inhibiting rate for suppressing inflammatory factor；
Fig. 4 is the schematic diagram that all target compounds of the invention act on the inhibiting rate for suppressing inflammatory factor；
Fig. 5 is the schematic diagram of the inhibiting rate that all target compounds of the invention act on NO；
Fig. 6 is that all target compounds of the invention act on the schematic diagram for suppressing COX and iNOS.
Specific embodiment
Below in conjunction with drawings and Examples, the present invention will be further described.It should be noted that following embodiments
Described in technical characteristic or technical characteristic combination be not construed as it is isolated, they can be mutually combined so as to
Reach superior technique effect.
First, the synthesis of compound
The synthesis of the L1-L2 of embodiment 1～2
Step 1：80mg 6-chloropurines are weighed in 25mL round-bottomed flasks and 5mL n-butanols are added, ultrasonic dissolution, then
147mg 2- chlorobenzylamines are added, 2- chlorobenzylamines are 2 with the mol ratio of 6-chloropurine:1, and 50 μ L triethylamines are added as catalysis
Agent.5h is refluxed in 110 DEG C of oil bath heatings, TLC is carried out and is run plate monitoring, observing response completely, is cooled down, suction filtration under Ultraluminescence
Solid is obtained, 6- (2- benzyl chloride amidos) purine is recrystallized to give.
Step 2：90mg 6- (2- benzyl chloride amidos) purine and chloromethane are weighed in appropriate round-bottomed flask, chloro first
Alkane is 2 with the mol ratio of 6- (2- benzyl chloride amidos) purine：1, appropriate solvent acetonitrile is measured, and 80mg potassium carbonate is added as catalysis
Agent.24h is refluxed in 80 DEG C of oil bath heatings, decompression is carried out and is spin-dried for.Suitable quantity of water, gained solid suction filtration is added to take out, liquid is used
System is spin-dried for after ethyl acetate extraction husky, merges all solids, carried out purifying using column chromatography and obtain L1-L2The sterling of compound.Produce
Thing structure and molecular weight are shown in Table 1.
Reaction equation is as follows：
The L of embodiment 3～103-L10Synthesis
Step 1：80mg 6-chloropurines are weighed in 25mL round-bottomed flasks and 5mL n-butanols are added, ultrasonic dissolution, then
147mg 2- chlorobenzylamines are added, 2- chlorobenzylamines are 2 with the mol ratio of 6-chloropurine:1, and 50 μ L triethylamines are added as catalysis
Agent.5h is refluxed in 110 DEG C of oil bath heatings, extracting reaction solution carries out TLC race plates, and observing response completely, is cooled down under Ultraluminescence,
Suction filtration obtains solid and is recrystallized to give 6- (2- benzyl chloride amidos) purine.
Step 2：Weigh 90mg 6- (2- benzyl chloride amidos) purine and L3-L10The halogenated hydrocarbons of corresponding different structure is in suitable
In the round-bottomed flask of amount, halogenated hydrocarbons is 2 with the mol ratio of 6- (2- benzyl chloride amidos) purine：1, appropriate solvent acetonitrile is measured, and add
Enter 80mg potassium carbonate as catalyst.24h is refluxed in 80 DEG C of oil bath heatings, decompression is carried out and is spin-dried for.Add suitable quantity of water, gained
Solid suction filtration takes out and be spin-dried for after liquid is extracted with ethyl acetate system sand, merges all solids, is purified using column chromatography.Product
Structure and molecular weight are shown in Table 1.
Reaction equation is as follows：
R=F, Cl ,-C (CH3)3、-CF3、-OCH3Or-NO2
The W of embodiment 111Synthesis
The 6-chloropurine of 1mmol and the 4-Fluorobenzylamine of 2mmol are weighed in 25mL round-bottomed flasks, its two kinds of raw materials rub
You are than being 1：2, and 5mL solvent, n-butanols are added, and add the triethylamine of 50 μ L as catalyst, return in 110 DEG C of oil bath heatings
Stream stirring 5h, extracting reaction solution carries out TLC race plates, and completely, cooling, suction filtration is recrystallized to give W to observing response under Ultraluminescence1Produce
Thing structure and molecular weight are shown in Table 2.
Reaction equation is as follows：
Embodiment 12-18 W2-W8Synthesis
Weigh the 6-chloropurine of 1mmol and the W of 2mmol2-W8Corresponding amino benzenes compounds in 25mL round-bottomed flasks,
The mol ratio of its two kinds of raw materials is 1：2, and add 5mL solvent, n-butanols, and the triethylamine of 50 μ L is added as catalyst,
110 DEG C of oil bath heatings are refluxed 5h, and extracting reaction solution carries out TLC race plates, and observing response completely, is cooled down, suction filtration under Ultraluminescence,
It is recrystallized to give W2-W8.Product structure and molecular weight are shown in Table 2.
Reaction equation is as follows：
R=F, Cl, OH,-OCH3；Wherein,Represent the position of substitution
Embodiment 19-20 W9-W10Synthesis
Weigh the 6-chloropurine of 1mmol and the W of 2mmol9-W10Corresponding aminated compounds in 25mL round-bottomed flasks,
The mol ratio of its two kinds of raw materials is 1：2, and add 5mL solvent, n-butanols, and the triethylamine of 50 μ l is added as catalyst,
110 DEG C of oil bath heatings are refluxed 5h, and extracting reaction solution carries out TLC race plates, and observing response completely, is cooled down, suction filtration under Ultraluminescence,
It is recrystallized to give W9-W10。
Reaction equation is as follows：
Wherein,Represent the position of substitution
The compound L of table 11-L10Structure and physical data
The compound W of table 21-W10Structure and physical data
Compound L1-L10、W1-W10ESI-MS,1H-NMR and13C-NMR data
N-(2-chlorobenzyl)-9H-purin-6-amine(L1)
White powder,Yield：85.6%, Mp:156.1-158.9℃,ESI-MS[M+H]+:260.2,1H-NMR
(600MHz,DMSO-d6):δ(ppm):12.987(m,1H,9-Purine-H),8.140-8.157(m,3H,2,8-Purine-H
+NH),7.432-7.439(m,1H,3'-2-Cl-Ph-H),7.252-7.283(m,3H,4',5',6'-2-Cl-Ph-H),
4.760(s,2H,CH2).13C-NMR(600MHz,DMSO-d6):152.343,139.107,131.711,129.020,
128.226,127.970,127.052.
N-(2-chlorobenzyl)-9-methyl-9H-purin-6-amine(L2)
White powder,Yield:50.5%；Mp:120.1-123.2℃；ESI-MS[M+H]+:274.3；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.414(s,1H,2-Purine-H),7.752(s,1H,8-P urine-H),7.473-
7.487(m,1H,3-Ph-H),7.370-7.385(m,1H,6-Ph-H),7.201-7.260(m,2H,4,5-Ph-H),6.474
(s,1H,NH),4.975(s,2H,CH2),4.226(s,3H,9-CH3).13C-N MR(600MHz,CD3Cl):δ(ppm):
154.828,153.181,139.476,136.192,133.816,129.689128.912,127.083,120.112,
38.954,15.722.
N-(2-chlorobenzyl)-9-(4-fluorobenzyl)-9H-purin-6-amine(L3)
Light Yellow powder,Yield:45.2%；Mp:150.1-152.9℃；ESI-MS[M+H]+:368.2
；1H-NMR(600MHz,CD3Cl):δ(ppm):8.435(s,1H,2-Purine-H),7.678(s,1H,8-Purine-H),
7.493-7.502(m,1H,3'-2-Cl-Ph-H),7.363-7.366(m,1H,6'-2-Cl-Ph-H),7.260-7.286(m,
2H,4',5'-2-Cl-Ph-H),7.193-7.213(m,2H,2',6'-4-F-Ph-H),7.013-7.041(m,2H,3',5'-
4-F-Ph-H),6.459(s,1H,NH),5.319(s,2H,9-CH2),4.926(s,2H,NHCH2).13C-NMR(600MHz,
CD3Cl):163.612,161.971,154.872,139.684,136.095,133.853,131.658,129.956,
129.756,128.974,127.100,116.235,46.635,32.075,29.507.
9-(4-(tert-butyl)benzyl)-N-(2-chlorobenzyl)-9H-purin-6-amine(L4)
Yellow powder,Yield:45.2%；Mp:140.1-142.8℃；ESI-MS[M+H]+:406.2；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.440(s,1H,2-purine-H),7.673(s,1H,8-pur ine-H),7.192-
7.484(m,8H,Ph-H),6.465(s,1H,NH),5.434(s,2H,9'-CH2),4.966(s,2H,N-CH2),1.257(s,
9H,CH3).13C-NMR(600MHz,CD3Cl):154.916,153.709,139.803,139.671,133.894,130.029,
130.723,129.747,129.035,128.039,127.126,126.196,46.752.
N-(2-chlorobenzyl)-9-(4-chlorobenzyl)-9H-purin-6-amine(L5)
Green powder,Yield:56.2%；Mp:149.2-152.8℃；ESI-MS[M+H]+:384.6；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.412(s,1H,2-Purine-H),7.672(s,1H,8-Pur ine-H),7.474-
7.484(m,1H,3'-2-Cl-Ph-H),7.335-7.365(m,1H,6'-2-Cl-Ph-H),7.302-7.326(m,2H,4',
5'-2-Cl-Ph-H),7.183-7.236(m,4H,2',3',5',6'-4-Cl-Ph-H),6.456(s,1H,NH),5.316(s,
2H,9-CH2),4.964(s,2H,N-CH2).13C-NMR(600MHz,CD3C l):154.891,153.652,145.231,
139.710,136.027,133.176,130.419,129.394,129.099,128.721,128.929,127.142,
125.915,46.651,29.835.
N-(2-chlorobenzyl)-9-(3-nitrobenzyl)-9H-purin-6-amine(L6)
Yellow powder,Yield：46.9%；Mp:160.8-162.7℃；ESI-MS[M+H]+:395.1；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.425(s,1H,2-Purine-H),8.177(s,1H,2'-3-NO2Ph-H),8.163(m,
1H,4'-3-NO2Ph-H),7.744(s,1H,8-Purine-H),7.599-7.612(m,1H,2'-2-Cl-Ph-H),7.481-
7.536(m,2H,5',6'-3-NO2Ph-H),7.360-7.375(m,1H,6'-2-Cl-Ph-H),7.199-7.215(m,2H,
4',5'-2-Cl-Ph-H),6.456(s,1H,NH),5.316(s,2H,9-CH2),4.964(s,2H,N-CH2).13C-NMR
(600MHz,CD3Cl):154.921,153.728,148.732,139.484,137.947,135.928,130.332,
130.032,129.724,129.014,123.527,122.730,46.501.
N-(2-chlorobenzyl)-9-(4-methoxybenzyl)-9H-purin-6-amine(L7)
Light Yellow powder, Yield:47.3%；Mp:164.3-166.9℃；ESI-MS[M+H]+:380.7
；1H-NMR(600MHz,CD3Cl):δ(ppm):8.445(s,1H,2-Purine-H),7.675(s,1H,8-Purine-H),
7.498-7.513(m,1H,3'-2-Cl-Ph-H),7.362-7.373(m,1H,6'-2-Cl-Ph-H),7.210-7.289(m,
2H,4',5'-2-Cl-Ph-H),7.191-7.248(m,2H,2,6'-4-OCH3-Ph-H),6.860-6.886(m,2H,3',
5'-4-OCH3-Ph-H),6.350(s,1H,NH),5.277(s,2H,9-C H2),4.615(s,2H,NHCH2),3.801(s,
3H,OCH3).13C-NMR(600MHz,CD3Cl):159.831,154.802,154.402,139.833,133.864,
129.974,129.721,137.102,114.547,55.426,46.922.
N-(2-chlorobenzyl)-9-(3,5-dimethoxybenzyl)-9H-purin-6-amine(L8)
White powder,Yield:45.6%；Mp:175.2-178.1℃；ESI-MS[M+H]+:410.1；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.432(s,1H,2-Purine-H),7.665(s,1H,8-Pu rine-H),7.464-
7.578(m,1H,3'-2-Cl-Ph-H),7.352-7.365(m,1H,6'-2-Cl-Ph-H),7.174-7.210(m,2H,4',
5'-2-Cl-Ph-H),6.515-6.525(m,1H,4'-3,5-OCH3-Ph-H),6.404(s,2H,2',6'-3,5-OCH3-Ph-
H),6.388(s,1H,NH),5.268(s,2H,9-CH2),4.905(s,2H,N-CH2),3.737(s,6H,OCH3).13C-NMR
(600MHz,CD3Cl):161.441,154.862,153.439,139.934,137.936,136.123,133.822,
129.914,129.694,128.943,127.033,106.022,100.132,55.512,47.313.
N-(2-chlorobenzyl)-9-(4-(trifluoromethyl)benzyl)-9H-purin-6-amine(L9)
White powder,Yield:81.3%；Mp:170.7-172.5℃；ESI-MS[M+H]+:418.3；1H-NMR
(600MHz,CD3Cl)：δ(ppm)：8.343(s,1H,2-Purine-H),7.874(s,1H,8-Pur ine-H),7.593-
7.606(d,2H,3',5'-4-CF3- Ph-H, J=7.8Hz), 7.480-7.495 (m, 1H, 3'-2-Cl-Ph-H), 7.369-
7.383(m,3H,4',5',6'-2-Cl-Ph-H),7.191-7.229(m,2H,2',6'-4-CF3-Ph-H),6.251(s,1H,
NH),5.464(s,2H,9-CH2),4.872(s,2H,N-CH2).13C-NMR(600MH z,CD3Cl):154.922,153.714,
139.805,139.676,133.892,130.203,129.735,129.034,128.034,127.143,126.204,
46.745.
N-(2-chlorobenzyl)-9-(3-methoxybenzyl)-9H-purin-6-amine(L10)
White powder,Yield：47.3%；Mp:145.2-147.1℃；ESI-MS[M+H]+:380.4；1H-NMR
(600MHz,CD3Cl):δ(ppm):8.423(s,1H,2-Purine-H),7.654(s,1H,8-Purine-H),7.489-
7.532(m,1H,3'-2-Cl-Ph-H),7.384-7.396(m,1H,6'-2-Cl-Ph-H),7.195-7.213(m,2H,4',
5'-2-Cl-Ph-H),6.819-6.855(m,4H,2',4',5',6'-3-OCH3-Ph-H),6.591(s,1H,NH),5.834
(s,2H,9-CH2),4.956(s,2H,N-CH2),3.873(s,3H,-OCH3).13C-NMR(600MHz,CD3Cl):160.223,
154.821,153.452,139.953,137.251,136.121,133.833,130.237,129.492,129.751,
128.954,127.106,120.130,113.823,55.243,47.244,42.446.
N-(4-fluorobenzyl)-9H-purin-6-amine(W1)
Yellow powder,Yield：80.1%；Mp:155.2-157.1℃；ESI-MS[M+H]+:244.2；1H-NMR
(600MHz,DMSO-d6):δ(ppm):12.961(s,1H,9-Purine-H),8.653(s,1H,2-Purine-H),8.093
(s, 1H, 8-Purine-H), 7.285-7.337 (d, 2H, 2,6-Ph-H, J=8.0Hz), 7.124-7.243 (d, 2H, 3,5-
Ph-H, J=8.0Hz), 6.721 (s, 1H, NH), 5.901 (s, 2H, N-CH2).13C-N MR(600MHz,DMSO-d6):
154.787,152.314,151.236,139.154,128.546,126.784,119.414,43.024.
N-(3-methoxyphenyl)-9H-purin-6-amine(W2)
Yellow powder, Yield/%:76.5；Mp:146.2-149.1℃；ESI-MS[M+H]+:242.3；1H-NMR
(600MHz,DMSO-d6):δ(ppm):10.891(s,1H,9-Purine-H),8.621(s,1H,2-Purine-H),8.232
(s,1H,8-Purine-H),7.209-7.232(m,1H,6-Ph-H),7.120-7.134(m,2H,4,5-Ph-H),6.825-
6.825(m,1H,2-Ph-H),6.571(s,1H,NH),3.762(s,3H,CH3).13C-NMR(600MHz,DMSO-d6):
162.121,152.914,150.346,143.734,141.236,129.456,119.224,109.523,108.455,
100.235,56.348.
N-(3-chlorophenyl)-9H-purin-6-amine(W3)
Green powder,Yield：86.2%；Mp:135.1-137.9℃；ESI-MS[M+H]+:246.7；1H-NMR
(600MHz,DMSO-d6):δ(ppm):10.842(s,1H,9-Purine-H),8.622(s,1H,2-Purine-H),7.802
(s,1H,8-Purine-H),7.509-7.472(m,1H,6-Ph-H),7.220-7.324(d,2H,4,5-Ph-H),6.927-
7.125(d,1H,2-Ph-H),6.651(s,1H,NH).13C-NMR(600MHz,DMSO-d6):153.965,152.673,
144.984,139.761,136.128,131.245,121.786,118.745,117.563.
N-(4-chloro-3-fluorophenyl)-9H-purin-6-amine(W4)
White powder,Yield:73.9%；Mp:135.1-138.2℃；ESI-MS[M+H]+:264.6；1H-NMR
(600MHz,DMSO-d6):δ(ppm):10.636(s,1H,9-Purine-H),8.552(s,1H,2-Purine-H),7.792
(s,1H,8-Purine-H),7.420-7.424(m,1H,6-Ph-H),7.217-7.255(m,1H,5-Ph-H),7.127-
7.225(m,1H,2-Ph-H),6.672(s,1H,NH).13C-NMR(600MHz,D MSO-d6):164.39,151.93,
150.73,144.96,139.83,131.49,118.18,109.84,107.39.N-(4-chlorophenyl)-9H-purin-
6-amine(W5)
White powder,Yield：73.9%；Mp:156.7-158.2℃；ESI-MS[M+H]+:246.2；1H-NMR
(600 MHz,DMSO-d6):δ(ppm)：12.531(s,1H,9-Purine-H),8.141(s,1H,2-Purine-H),7.562
(s, 1H, 8-Purine-H), 7.485-7.524 (d, 2H, 2,6-Ph-H, J=7.6Hz), 6.934-7.143 (d, 2H, 3,5-
Ph-H, J=8.0Hz), 6.456 (s, 1H, NH).13C-NMR(600MHz,DM SO-d6):153.965,152.674,
144.984,139.763,136.124,131,245,121.784,118.741,117.568.
N-(furan-2-ylmethyl)-9H-purin-6-amine(W6)
White powder,Yield:76.4%；Mp:162.2-164.8℃；ESI-MS[M+H]+:216.2；1H-NMR
(600 MHz,DMSO-d6):δ(ppm)：12.942(s,1H,9-Purine-H),8.113-8.202(s,3H,2,8-Purine-
H+NH),7.538(s,1H,4'-Furan-H),6.358(s,1H,3'-Furan-H),6.230(s,1H,2'-Furan-H),
4.694(s,2H,N-CH2).13C-NMR(600MHz,DMSO-d6):154.846,152.795,151.592,146.713,
143.575,137.414,119.723,113.454,107.232,39.734.
N-(4-methoxyphenyl)-9H-purin-6-amine(W7)
Grey powder,Yield:74.8%；Mp:161.9-164.2℃；ESI-MS[M+H]+:242.2；1H-NMR
(600 MHz,DMSO-d6):δ(ppm):11.291(s,1H,9-Purine-H),8.742(s,1H,2-Purine-H),8.033
(s, 1H, 8-Purine-H), 7.585-7.624 (d, 2H, 2,6-Ph-H, J=8.0Hz), 7.034-7.123 (d, 2H, 3,5-
Ph-H, J=8.0Hz), 6.744 (s, 1H, NH), 3.963 (s, 3H ,-CH3).13C-N MR(600MHz,DMSO-d6):
153.756,153.746,149.243,136.794,133.722,129.563,122.135,119.233,114.483,
60.235.
N-((4-((9H-purin-6-yl)amino)phenyl)sulfonyl)acetamide(W8)
Grey powder,Yield：74.3%；Mp:200.1-202.7℃；ESI-MS[M+H]+:333.4；1H-NMR
(600MHz,DMSO-d6):δ(ppm):12.052 (s, 1H, 9-Purine-H), 11.461 (s, 1H, NH-C=O), 8.843 (s,
1H, 2-Purine-H), 8.731 (s, 1H, 8-Purine-H), 7.475-7.524 (d, 2H, 3,5-Ph-H, J=8.0Hz),
7.204-7.243 (d, 2H, 2,6-Ph-H, J=7.8Hz), 6.632 (s, 1H, NH), 1.923 (s, 3H ,-CH3).13C-NMR
(600MHz,DMSO-d6):172.095,154.283,152.863,144.264,143.791,139.855,129.986,
119.778,111.793,28.372.
4-((9H-purin-6-yl)amino)phenol(W9)
White powder, Yield：77.3%；Mp:156.1-157.3℃；ESI-MS[M+H]+:228.1；1H-NMR
(600MHz,DMSO-d6):δ(ppm):12.091(s,1H,9-Purine-H),8.782(s,1H,2-Purine-H),7.892
(s, 1H, 8-Purine-H), 7.285-7.324 (d, 2H, 2,6-Ph-H, J=7.6Hz), 6.934-7.143 (d, 2H, 3,5-
Ph-H, J=8.0Hz), 6.561 (s, 1H, NH), 5.534 (s, 1H, OH).13C-NMR(600MHz,DMSO-d6):153.236,
151.837,143.924,140.713,138.242,131.232,129.652,123.522,119.235.
6-(pyrrolidin-1-yl)-9H-purine(W10)
White powder,Yield：85.2%；Mp:162.1-164.2℃；ESI-MS[M+H]+:190.2；1H-NMR
(600MHz,DMSO-d6):δ(ppm):13.241(s,1H,9-Purine-H),8.742(s,1H,2-Purine-H),8.121
(s,1H,8-Purine-H),3.786(m,4H,N-CH2+N-CH2),1.879(m,4H,CH2CH2).13C-NMR(600MHz,
DMSO-d6):159.122,155.124,153.527,149.238,138.955,127.944,125.734,117.684,
60.235,42.824.
The proterties and its dissolubility of synthesized target compound of the invention is as follows：
Compound L1-2, L8-10, W4-6, W9-10For white solid.L3, L7For light yellow, W1-2, L4, L6For yellow, L5, W3For
Green, W7-8For grey.In being soluble in DMSO, DMF.
Compound synthesized by the present invention, carries out mass spectrometric measurement, and positive pole shows [M+1]+, and signal is stronger, this
Bright synthesized compound, is carried out1H-NMR and13C-NMR is tested, from1H-NMR and13Can be clearly seen that on C-NMR collection of illustrative plates
The hydrogen signal of compound and its residing chemical shift.
2nd, compound anti-inflammatory activity data
1st, Compound Cytotoxicity test is synthesized
(1) plating cells：1) density of cell needed for experiment with computing, carefully draws the nutrient solution in blake bottle, then
A certain amount of PBS liquid is added nutrient solution wash clean, then adherent growth cell 3min is dissolved with trypsin solution (0.25%), then
10% serum is added toward culture medium, for stopping pancreatin vitellophag is continued, blow and beat the cell that bottle wall causes adherent growth
Disengaging is entered and is homogeneously dispersed in nutrient solution, and RPMI-1640 is added in blake bottle, and needed for cell is diluted to
Density 44000cells/mL；2) by each hole the μ l/well of concentration 90 standard, by the cell solution for being prepared equably
In being added to 96 hole Mei Biao holes, with aseptic PBS filling edge holes；3) 96 hole enzyme mark culture plates are taken out, as requested reasonably
Set experimental group and control group.Wherein using inhibitor3 as positive control drug, experimental group each group uses a kind of compound,
Every kind of compound is set as respectively 9 identical concentration gradients, and each gradient concentration arranges three multiple holes, as repeating to test, protects
Accuracy and reliability that confirmation is tested, each hole in control group is then directly inoculated with 100 μ l cell suspensions, is added without any thing
Whether matter, can be contaminated with test experience；4) cultured cells under the conditions of last suitable, specific requirement is in 5%CO2, 37
Under conditions of DEG C, 24h is incubated.
(2) test compound is added：1) synthesized test compound and positive control are dissolved in into 100%
The solution that concentration is 200x is configured in DMSO；2) the good μ l of solution 7 of above-mentioned configuration are drawn exactly to containing 133 with liquid-transfering gun
(20 times are diluted, finally obtain the solution for 10x) in the complete medium of μ l；3) the μ L of solution 10 for drawing after above-mentioned dilution are equal
It is added to evenly in 96 hole elisa Plates (finally obtain the solution for 1x), 4) last cultured cells under suitable conditions, specifically
Requirement is in 5%CO2, under conditions of 37 DEG C, it is incubated 24h.
(3), result is determined：1) by step (2), take out through 96 hole elisa Plates of 24h incubations, be first placed on request
30min under room temperature, it is standby；2) according to the amount that is previously calculated, to every hole add 30 μ l Cell Titer-Glo reagents and
10min is rocked for inducing cell and promote cytolysis；3) it is placed on after room temperature 2min so that fluorescence signal reaches
Stable state；4) with the light absorption value in method Detection wavelength each hole at 570nm of enzyme linked immunological, and knot is recorded exactly
Really.Finally according to the formula for being given, the inhibiting rate of compound is calculated.Specific formula is as follows：Inhibiting rate (%)=(control wells
OD values-experimental port OD values)/control wells OD value X100%.
Experimental result：Fig. 2 is the schematic diagram of all target compound toxicity detections of the invention.As can be seen from Figure 2：Synthesis
Toxicity of compound generally be less than positive control drug inhibitor 3.
2nd, ELISA method detection TNF-α and IL-1 β contents
Method of operating：
1) meat soup is prepared --- stimulate mouse to produce a large amount of macrophages
Beef extract 0.15g, peptone 0.5g, NaCl 0.25g, soluble starch 3g are weighed, meat soup is boiled to transparent, drop
Just can be with lumbar injection to room temperature.
2) give injected in mice meat soup 2mL, carry after three days cell (compound can be prepared during this, it is molten with DMSO
Solution).
3) plating cells are carried：Mouse plucks eye, and bloodletting reduces red blood cell in abdominal cavity, and the marrow that breaks afterwards is put to death, 75% alcohol of body
Sterilization, faces upward position and is scheduled on foam, gland, four limbs, tail.At thorax median line middle position, barrier film is played with curved tweezer, use syringe
To intraperitoneal injection RPMI-1640 culture mediums (not containing FBS) 3～4ml, belly is gently rubbed, macrophage is mixed with culture medium.With
Curved tweezer plays medial septum, with operating scissors (vertical direction is taken), cuts off barrier film, is picked up intraperitoneal liquid with liquid-transfering gun, moves into
In 15ml centrifuge tubes, 1100r, 5min are centrifuged, abandon supernatant.To the intracellular addition about 2ml of the culture medium containing FBS being centrifuged,
Cell suspension is gently blown and beaten into repeatedly.Cell count (20 μ L/ holes), cell is assigned to and cultivate on six orifice plate 1ml (5 × 105/ hole)
In 37 DEG C, 5%CO2Culture.After 4～6h, taking-up is washed with PBS, changes liquid.
4) add the μ l of synthesis compound 1 of 10 μm of ol concentration, add LPS (0.5 μ g/ul) 1 μ l to stimulate after 30min, be divided into three
Group：With species medicine+LPS, LPS (stimulation group), con (control group, only cell and DMSO).
5) it is above-mentioned be disposed after place in incubator and be incubated>24h.
Detection method：
(1) it is coated with：The culture medium after hatching is taken out, one anti-(the capure antibody) of 40 μ l is added, 1mL's
Coating buffer (10X), are mixed with liquid-transfering gun piping and druming is uniform, and in being added to elisa plate, each hole adds 100 μ l, uses
Preservative film is embedded to elisa plate, under conditions of 4 DEG C overnight.PBST is configured during this period：The polysorbas20 of 500 μ l is molten
Solution is among the PBS solution of 1000mL.
(2) AD is added to be closed：Culture medium after incubated overnight is outwelled, is washed three times with PBST, each hole adds
The amount of 250 μ l, blows and beats 1～2min with liquid-transfering gun every time, for the last time turns around culture medium, gently pats dry on paper, by every
The amount of the μ l of hole 200 adds AD solution, after adding, is wrapped with preservative film, and 1h is closed on shaking table.When culture medium has closed it
Afterwards, continue to be washed three times with PBST solution, the amount of 250 μ l is still added every time, with liquid-transfering gun 1～2min is gently blown and beaten.Carry out
During above-mentioned closing, supernatant can be taken out defrosting.
(3) it is loaded：Amount according to the μ l of every hole 100 adds certain mixed solution, wherein sample to account for 5%, AD and account for 95%, use
Preservative film continues to wrap, and 2h is incubated on shaking table.
(4) two are added to resist：Two anti-40 μ l, AD100mL are taken out, after fully mixing, according to the amount of the μ l of every hole 100, is added
To in above-mentioned elisa plate, continuation is wrapped with preservative film, is placed on shaking table and is continued to be incubated 1h.
(5) enzyme is added：After taking out elisa plate, washed three times with PBST, the amount of 250 μ l is added per hole, blown with liquid-transfering gun every time
1～2min is made a call to, HRP enzymes are added, the amount per hole is 100 μ l, continuation is wrapped with preservative film, is then placed on shaking table and continues to incubate
Educate 1h.
(6) developer is added：Washed three times with PBST, the amount of 250 μ l added per hole, blow and beat 1～2min with liquid-transfering gun every time,
Under conditions of lucifuge, developer TMP is added according to the amount of the μ l of every hole 100, developed the color to blueness.
(7) terminating reaction：After taking out elisa plate, 50 μ l addition concentration is added for the H of 2mol/L to each hole2SO4。
(8) OD values are surveyed：Under conditions of wavelength is 450nm, the absorbance to inflammatory factor is determined, calculated according to formula.
Experimental result：Fig. 3 is the schematic diagram that all target compounds of the invention act on the inhibiting rate for suppressing inflammatory factor.
As can be seen from Figure 3：The compound L of synthesis1, L4, W2, W4It is higher than positive control drug inhibitor to the inhibiting rate of inflammatory factor
3, so this several compound has preferable antiinflammatory action.
It is can be found that by comparison object compound and positive control drug：Compound L1, L4, W2, W4To inflammatory factor TNF-
The inhibiting rate of a and IL-6 reaches and has been above 50%, is up to 80% or so, tentatively infers the 2, substituted purin derivatives pair of 9- bis-
The research and development of anti-inflammatory drug have certain potentiality.The further research of 4 preferred compound anti-inflammatory activities
At the beginning of TNF-α and IL-1 β content inhibitory action by Part I compound under 10 μM of concentration to LPS inductions
Sieve result, obtains compound L1, L4, W2And W4There is stronger inhibitory action to inflammatory factor TNF-α and IL-1 β.Therefore, originally
Part will choose this 4 compounds and further study its anti-inflammatory activity.
3rd, ELISA method detection TNF-α, the content of IL-1 β, PGE2 and IL-6
Specific laboratory operating procedures are as follows：
(1), it is coated with：The culture medium after hatching is taken out, one anti-(the capure antibody) of 40 μ l is added, 1mL's
Coating buffer (10X), are mixed with liquid-transfering gun piping and druming is uniform, and in being added to elisa plate, each hole adds 100 μ l, uses
Preservative film is embedded to elisa plate, under conditions of 4 DEG C overnight.PBST is configured during this period：The polysorbas20 of 500 μ l is molten
Solution is among the PBS solution of 1000mL.
(2), AD is added to be closed：Culture medium after incubated overnight is outwelled, is washed three times with PBST, each hole adds
The amount of 250 μ l, blows and beats 1～2min with liquid-transfering gun every time, for the last time turns around culture medium, gently pats dry on paper, by every
The amount of the μ l of hole 200 adds AD solution, after adding, is wrapped with preservative film, and 1h is closed on shaking table.When culture medium has closed it
Afterwards, continue to be washed three times with PBST solution, the amount of 250 μ l is still added every time, with liquid-transfering gun 1～2min is gently blown and beaten.Carry out
During above-mentioned closing, supernatant can be taken out defrosting.
(3), it is loaded：Amount according to the μ l of every hole 100 adds certain mixed solution, wherein sample to account for 5%, AD and account for 95%,
Continued to wrap with preservative film, and 2h is incubated on shaking table.
(4), two are added to resist：Two anti-40 μ l, AD100mL are taken out, after fully mixing, according to the amount of the μ l of every hole 100, is added
To in above-mentioned elisa plate, continuation is wrapped with preservative film, is placed on shaking table and is continued to be incubated 1h.
(5), enzyme is added：After taking out elisa plate, washed three times with PBST, the amount of 250 μ l is added per hole, liquid-transfering gun is used every time
1～2min of piping and druming, adds HRP enzymes, and the amount per hole is 100 μ l, and continuation is wrapped with preservative film, is then placed on shaking table and continues
Incubation 1h.
(6), developer is added：Washed three times with PBST, per hole add 250 μ l amount, every time with liquid-transfering gun piping and druming 1～
2min, under conditions of lucifuge, according to the amount of the μ l of every hole 100 developer TMP is added, and is developed the color to blueness.
(7), terminating reaction：After taking out elisa plate, 50 μ l addition concentration is added for the H of 2mol/L to each hole2SO4。
(8), OD values are surveyed：Under conditions of wavelength is 450nm, the absorbance to inflammatory factor is determined, calculated according to formula.
Experimental result：Fig. 4 is the schematic diagram that all target compounds of the invention act on the inhibiting rate for suppressing inflammatory factor.
As can be seen from Figure 4：The compound L of synthesis1, L4, W2And W4The positive is generally close to or higher than to the inhibiting rate of several inflammatory factors
Comparison medicine inhibitor 3, and have doses dependence, so this kind of compound has preferable antiinflammatory action.
It is can be found that by comparison object compound and positive control drug：Compound L1, L4, W2And W4To several inflammation because
Sub- inhibiting rate is generally close to or higher than positive control drug inhibitor 3, tentatively infers that the substituted purin derivatives of 2,9- bis- are resisted
The research and development of scorching medicine have certain potentiality.
4th, the measure of NO contents
Specific laboratory operating procedures are as follows：
(1) RAW264.7 cell culture：Cell line is bought in the cell bank of Shanghai Branch of the Chinese Academy of Sciences, condition of culture：
In the DMEM complete mediums of twin antibiotic (streptomysin and penicillin) and 10% hyclone, and 37 DEG C are placed on, 5%CO2
Cultivate in culture environment.
(2) Griess methods detect the content of NO：The RAW264.7 cells of phase of taking the logarithm carry out experimental implementation, add LPS, training
Foster 30min, adds 2.5,5,10,20 μm of ol of medicine, continues overnight incubation.Cell culture fluid is taken, is centrifuged (6000rpm, 5min),
10 μ l cell supernatants are taken, Griess reagents (2% P-aminobenzene-sulfonamide 5%H is added3PO4Prepare, 0.2% how ethene
Diamines) 100 μ l mix therewith, room temperature lucifuge stands 10min, with ELIASA at 540nm wavelength mensuration absorbance value, calculate sample
NO contents in product.
Suppress NO content results：Fig. 5 is the schematic diagram of the inhibiting rate that all target compounds of the invention act on NO.From figure
5 can be seen that：The compound L of the compound synthesis of synthesis1, L4, W2And W4The inhibiting rate of several inflammatory factors is generally close to or
Higher than positive control drug inhibitor 3, and there is doses dependence, so there is this kind of compound preferable anti-inflammatory to make
With.
It is can be found that by comparison object compound and positive control drug：Compound L1, L4, W2And W4To several inflammation because
The inhibiting rate of son is generally close to or higher than positive control drug inhibitor 3, and has doses dependence, tentatively infers 2,9-
Research and development of two substituted purin derivatives to anti-inflammatory drug have certain potentiality.
5th, the measure of RT-PCR
Specific laboratory operating procedures are as follows：
(1), the measure of rna content：RNA is extracted using TRIzol methods, is added and appropriate TRIzol examinations according to calculating
Agent, stands 5min, by TRIzol after mixing:Chloroform=5:1 amount adds chloroform, stands 3min, then in 12000rpm, 4 DEG C
Centrifugation 15min, draws and enters new centrifuge tube containing RNA water layers；By TRIzol:Isopropanol=1:2 amount adds isopropanol, quiet
10min is put, then 12000rpm, 4 DEG C of centrifugation 10min stay precipitation, abandon supernatant；By TRIzol:(DEPC matches somebody with somebody 75% ethanol
Put), centrifugation, careful supernatant discarded.
(2), the measure of RNA concentration and purity：Extract RNA with agarose gel electrophoresis and spectrophotometer detection respectively
Integrality and concentration.
(3)、RT-PCR:
Reaction system：
Primer sequence：qmCOX2(74bp)：
Forward Primer5'TGAGCAACTATTCCAAACCAGC3'
Reverse Primer5'GCACGTAGTCTTCGATCACTATC3'
qmGAPDH(149bp)：
Forward Primer5'TATGTCGTGGAGTCTACTGGT 3'
Reverse Primer 5'GAGTTGTCATATTTCTCGTGG 3'
qmiNOS(127bp)：
Forward Primer5'GTTCTCAGCCCAACAATACAAGA3'
Reverse Primer 5'GTGGACGGGTCGATGTCAC 3'
Experimental result：Fig. 6 is that all target compounds of the invention act on the schematic diagram for suppressing COX and iNOS.Can from Fig. 6
To find out：The compound L of synthesis1, L4, W2And W4Positive control drug is generally close to or higher than to the inhibiting rate of COX and iNOS
Inhibitor 3, and have doses dependence, so this kind of compound has preferable antiinflammatory action.
It is can be found that by comparison object compound and positive control drug：Compound L1, L4, W2And W4To several inflammation because
The inhibiting rate of son is generally close to or higher than positive control drug inhibitor 3, and has doses dependence, tentatively infers 2,9-
Research and development of two substituted purin derivatives to anti-inflammatory drug have certain potentiality.
The anti-inflammatory activity experimental summary of compound
Synthesized 20 substituted purin derivatives of 6,9- bis- first under 10 μM of concentration conditions, with ELISA method detection its
To TNF-α and the inhibitory action of IL-1 β, initial screening goes out the compound with good anti-inflammatory activity.We have found that compound L 1,
L4, W2 and W4 show good inhibiting effect to inflammatory factor, then start to carry out this 4 compounds deep anti-inflammatory work
Journal of Sex Research.The further investigation of anti-inflammatory activity is mainly reflected in three below aspect, is first the increase of compound test concentration, inspection
Concentration range is surveyed from 10 μM, increases to 5,2.5 μM, inquire into impact of the compound concentration to anti-inflammatory activity.Compound L 1, L4, W2
Linear with W4 concentration and inhibitory action, i.e., as the concentration of compound increases, its anti-inflammatory power strengthens.Next to that inflammation
Increasing for factor species, increases to including including IL-6, PGE2 and NO from two kinds of inflammatory factors (TNF-α and IL-1 β) of primary dcreening operation
Five kinds of inflammatory factors.Compound L 1, L4, W2 and W4 is respectively provided with inhibitory action to this five kinds of inflammatory factors.It is finally detection water
Flat increase, considers that merely inflammatory factor level considers the change of inflammation correlation mRNA level in-site to further investigation from primary dcreening operation.Chemical combination
Thing L1, L4, W2 and W4 can suppress COX-2 and iNOS, so as to play antiinflammatory action in mRNA level in-site.
Claims (9)
1. a kind of 9- replaces-N- (2- chlorobenzyls) purine -6- amine derivants, it is characterised in that shown in structure such as formula (I)：
In formula (I), R is selected from hydrogen atom, C1～C4One kind in alkyl, replacement or unsubstituted benzyl, wherein, on benzyl
Substituent is independently selected from halogen ,-CF3、C1～C4Alkoxyl, C1～C4One or more in alkyl and nitro；
R4To replace either unsubstituted phenyl or benzyl, wherein, substituent of the phenyl either on benzyl is halogen or methoxy
One or more in base.
2. 9- according to claim 1 replaces-N- (2- chlorobenzyls) purine -6- amine derivants, it is characterised in that R4ForWherein
3. 9- according to claim 2 replaces-N- (2- chlorobenzyls) purine -6- amine derivants, it is characterised in that structure
As shown in formula (II) or formula (III)：
In formula (II), R1Independently selected from H ,-CH3；
In formula (III), R2Independently selected from F, Cl ,-C (CH3)3, isobutyl group ,-CF3、-OCH3With-NO2In one or it is many
It is individual.
4. 9- according to claim 3 replaces-N- (2- chlorobenzyls) purine -6- amine derivants, it is characterised in that under being
One kind in row particular compound：
N- (2- chlorobenzyls) -9- methyl -9H- purine -6- amine, structural formula is as follows：
N- (2- chlorobenzyls) -9- (4- chlorobenzyls) -9H- purine -6- amine, structural formula is as follows：
N- (2- chlorobenzyls) -9- (3,5- dimethoxy-benzyl) -9H- purine -6- amine, structural formula is as follows：
5. a kind of 9- as described in any one of Claims 1 to 4 replaces the preparation of-N- (2- chlorobenzyls) purine -6- amine derivatives
Method, it is characterised in that comprise the following steps：
(1) in the presence of alkali, there is substitution reaction in 6-chloropurine with 2- chlorobenzylamines, and reaction obtains 6- (2- chlorobenzylamines after terminating
Base) purine；
When described R is H, 6- (2- benzyl chloride amidos) purine is target product；
(2) in the presence of alkali, 6- (the 2- benzyl chloride amidos) purine that step (1) is obtained reacts with halogenated hydrocarbons, and reaction terminates
Described 9- replacement-N- (2- chlorobenzyls) purine -6- amine derivatives are obtained by processing later.
6. 9- according to claim 5 replaces the preparation method of-N- (2- chlorobenzyls) purine -6- amine derivatives, its feature
It is that the alkali in step (1) is triethylamine, the alkali in step (2) is potassium carbonate.
7. a kind of 9- as described in any one of Claims 1 to 4 replaces-N- (2- chlorobenzyls) purine -6- amine derivants in system
Application in standby anti-inflammatory drug.
8. 9- according to claim 7 replaces-N- (2- chlorobenzyls) purine -6- amine derivants in anti-inflammatory drug is prepared
Application, it is characterised in that described anti-inflammatory drug comprising therapeutically effective amount 9- replace-N- (2- chlorobenzyls) purine -6- amine
Derivative and pharmaceutic adjuvant.
9. 9- according to claim 8 replaces-N- (2- chlorobenzyls) purine -6- amine derivants in anti-inflammatory drug is prepared
Application, it is characterised in that the formulation of described anti-inflammatory drug be injection, tablet, capsule, aerosol, suppository, film,
Pill, ointment, controlled release agent, sustained release agent or nanometer formulation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611168399.XA CN106632338B (en) | 2016-12-16 | 2016-12-16 | A kind of 9- substitution-N-（2- chlorobenzyl）Purine -6- amine derivant and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611168399.XA CN106632338B (en) | 2016-12-16 | 2016-12-16 | A kind of 9- substitution-N-（2- chlorobenzyl）Purine -6- amine derivant and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106632338A true CN106632338A (en) | 2017-05-10 |
| CN106632338B CN106632338B (en) | 2018-11-27 |
Family
ID=58823497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611168399.XA Active CN106632338B (en) | 2016-12-16 | 2016-12-16 | A kind of 9- substitution-N-（2- chlorobenzyl）Purine -6- amine derivant and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106632338B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108864099A (en) * | 2018-09-08 | 2018-11-23 | 湖北荆洪生物科技股份有限公司 | A kind of synthetic method of high-purity 6-Furfurylaminopurine |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1556808A (en) * | 2001-08-02 | 2004-12-22 | �ݿ˹�����������ʵ��ֲ��ѧ�� | Heterocyclic compound based on N6-substituted adenine, methods of their preparation, their use for preparation of drugs, cosmetic preparations and growth regulators, pharmaceutical preparations, cosme |
| WO2010130233A1 (en) * | 2009-05-14 | 2010-11-18 | Univerzita Palackeho V Olomouci | Substituted 6-(benzylamino) purine riboside derivatives, use thereof and compositions containing these derivatives |
| CN102993265A (en) * | 2012-10-10 | 2013-03-27 | 靳广毅 | Immune receptor regulator couplet as well as preparation method and application thereof, coupling precursor for preparing immune receptor regulator couplet and compound for compounding coupling precursor |
-
2016
- 2016-12-16 CN CN201611168399.XA patent/CN106632338B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1556808A (en) * | 2001-08-02 | 2004-12-22 | �ݿ˹�����������ʵ��ֲ��ѧ�� | Heterocyclic compound based on N6-substituted adenine, methods of their preparation, their use for preparation of drugs, cosmetic preparations and growth regulators, pharmaceutical preparations, cosme |
| WO2010130233A1 (en) * | 2009-05-14 | 2010-11-18 | Univerzita Palackeho V Olomouci | Substituted 6-(benzylamino) purine riboside derivatives, use thereof and compositions containing these derivatives |
| CN102993265A (en) * | 2012-10-10 | 2013-03-27 | 靳广毅 | Immune receptor regulator couplet as well as preparation method and application thereof, coupling precursor for preparing immune receptor regulator couplet and compound for compounding coupling precursor |
Non-Patent Citations (1)
| Title |
|---|
| ZDENĚK TRÁVNÍCEK ET AL: "Anti-inflammatory Active Gold(I) Complexes Involving 6-Substituted-Purine Derivatives", 《JOURNAL OF MEDICINAL CHEMISTRY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108864099A (en) * | 2018-09-08 | 2018-11-23 | 湖北荆洪生物科技股份有限公司 | A kind of synthetic method of high-purity 6-Furfurylaminopurine |
| WO2020048343A1 (en) * | 2018-09-08 | 2020-03-12 | 湖北荆洪生物科技股份有限公司 | Synthesis method for 6-furfurylaminopurine |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106632338B (en) | 2018-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102219725B (en) | Benzohetercyclic compound as well as preparation method and applications thereof | |
| CN105899498A (en) | Process for the synthesis of an indoleamine 2,3-dioxygenase inhibitor | |
| CN104797581B (en) | Heteroaryl alkyne compound and application thereof | |
| CN106661002A (en) | Optionally fused heterocyclyl-substituted derivatives of pyrimidine useful for the treatment of inflammatory, metabolic, oncologic and autoimmune diseases | |
| CN104367575B (en) | A kind of Bouchardatine and Bouchardatine derivatives and its preparation method and application | |
| CN110357885A (en) | A kind of pteridine compounds and its application pharmaceutically | |
| CN106632338A (en) | 9-subsituted-N-(2-chlorobenzyl)purine-6-amine derivative, as well as preparation method and application thereof | |
| CN104603133B (en) | For treating cancer and immunosuppressant combination treatment | |
| CN106632339B (en) | A kind of 6- substitution -9H- purine analog derivative and its preparation method and application | |
| CN104341416B (en) | Protein tyrosine kinase inhibitor and its application | |
| CN102614199B (en) | Application of (4-substituted benzoyl) fluorobenzene salicylamide compound in preparation of medicine for resisting cervical cancer | |
| CN110229166A (en) | A kind of furocoumarin compound and preparation method thereof and medical application | |
| CN106397207B (en) | Tree ketonic acid A structural analogue, composition thereof and application thereof in medicines | |
| CN101146804B (en) | 5-(1,3-diaryl-1h-pyrazol-4-ylmethylene)-thiazolidine-2,4-dione derivatives useful as anticancer agent | |
| CN104302639B (en) | As the piperazine piperidine compounds of hepatitis C virus inhibitor | |
| CN105777829B (en) | A kind of prodrug containing class nucleotide structure, preparation method, medical composition and its use | |
| CN109438279A (en) | A kind of small molecule compound and its preparation method and application overcoming EGFR medicament-resistant mutation | |
| CN114671861B (en) | Wogonin derivative and preparation method and application thereof | |
| US20230257373A1 (en) | Quorum sensing inhibitors and methods of use | |
| CN113185492A (en) | Synthesis and application of novel tetrahydrobenzothiophene-2-urea derivative | |
| CN102614200A (en) | Application of (4-substituted benzoyl) fluorobenzene salicylamide compound in preparation of medicine for resisting breast cancer | |
| KR101118768B1 (en) | 5-3-Aryl-1-pyridyl-1H-pyrazol-4-ylmethylene-thiazolidine-2,4-dione derivatives useful as antitumor agent | |
| CN104710382A (en) | Halogeneated phenyl thiazole carboxylic acid amides compounds containing tertiary butyl amidine structures and application | |
| CN104557766A (en) | Nitrobenzene thiazolecarboxylic acid amide compounds containing tert-butylformamidine structure and application thereof | |
| CN104610190A (en) | Halogenated phenyl thiazolecarboxamide type compound containing cyclopropyl amidine structure and application of halogenated phenyl thiazolecarboxamide type compound |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |