CN106596931B - A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip - Google Patents
A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip Download PDFInfo
- Publication number
- CN106596931B CN106596931B CN201610844103.5A CN201610844103A CN106596931B CN 106596931 B CN106596931 B CN 106596931B CN 201610844103 A CN201610844103 A CN 201610844103A CN 106596931 B CN106596931 B CN 106596931B
- Authority
- CN
- China
- Prior art keywords
- cmv
- tobacco
- specific antibodies
- pad
- guangdong
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention discloses a kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip.Test strips are adhered to by sample pad, bonding pad, nitrocellulose filter, absorption pad on the support slice not absorbed water successively, it is characterized in that, the CMV specific antibodies of colloid gold label are adsorbed on the bonding pad, and also the CMV specific antibodies of colloid gold label are fixed on ribbon at the detection line T lines of nitrocellulose membrane, and the secondary antibody of the anti-CMV specific antibodies of colloid gold label is fixed at the control line C of nitrocellulose membrane；Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present invention is small, easy to carry, does not need to instrument and equipment, easy to operate.Can Site Detection, go out result in 3 10min；As a result can be judged by naked eyes according to the depth of T line colors.This method is very suitable for carrying out batch samples live primary dcreening operation, there is very much application value in actual production.
Description
Technical field：
The invention belongs to tobacco virus detection fields, and in particular to a kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold is quick
Test strip.
Background technology：
Cucumber mosaic virus (Cucumber mosaic virus, CMV) is to infect one of main virus of tobacco.It draws
The virosis of hair leads to the huge economic loss of tobacco industry every year.Quickly and accurately qualitative detection CMV is the upper anti-disease-control of production
Evil reduces one of the important means of loss.
In scientific research, the detection method of plant virus mainly has biology detection, and (symptom type distinguishes, differentiates and post
It is main etc.), electron microscopy, serological detection method (Enzyme-linked Immunosorbent Assay react (Enzyme linked immunosorbent
Assay, ELIS A) etc.) and molecular biological assay (including round pcr, Nucleic Acid Probe Technique etc.) etc..Isolated viral is according to electricity
Although mirror is to diagnose viral effective means, high specificity, but very time-consuming and laborious, needs technical professional, uncomfortable
Conjunction is promoted the use of；Serology test is relatively time-consuming, laborious, although the methods of immunofluorescence, ELLSA have it is micro, special,
Fast and accurately advantage, but more complete test apparatus and experienced technical staff are needed to operate and judging result,
The a collection of sample whole flow process of detection needs 4~8 hours, is difficult to accomplish for grass-roots work place；The diagnosis of PCR and nucleic acid probe
With greater need for having special instrument and drug, technology content is very high, is generally adapted only to laboratory diagnosis or research application, it is difficult in base
Layer is promoted.
Colloidal gold in 1971 starts as marker for immunohistochemistry.Faulk etc. applies Electronic Speculum immune colloid gold
Decoration method observes salmonella.Many scholars further confirm that colloidal gold can stablize promptly adsorbed proteins, and protein
Bioactivity is without substantially changeing.It can be used as probe to carry out cell surface and intracellular polysaccharide, protein, polypeptide, antigen, swash
The large biological molecules such as element, nucleic acid are accurately positioned, and can be used for daily immunodiagnosis, carry out immunohistochemical localization.
Colloidal gold solution refers to aurosol of the dispersed phase particles diameter between l~150nm, belongs to multiphase heterogeneous body
System, color is in salmon pink to aubergine.Immune colloidal gold chromatography technology (Gold immunochromatography assay,
GICA it is to be established in immuno-gold labeling technical foundation the 1980s) as a kind of new immunological detection method
The novel unique diagnostic techniques of one kind got up.This technology is by colloidal gold-labeled method, immunoassay technology, chromatographic analysis skill
A variety of methods such as art, list (more) Monoclonal Antibody Technology and new material technology organically combine, have it is simple, quick, accurate,
It is pollution-free, easy to operate and the advantages that without special installation, it is obtained in medicine, the animal and plant quarantine, each field of food safety supervision
Increasingly extensive application.
Early 1990s, Gold-immunochromatography assay diagnostic techniques initially entered commercial applications to mid-term.Profit
With the colloidal gold fast detecting test paper strip of this technological development have it is easy to operate, quick, can single part of detection, convenient for preserving, no
The advantages that needing special installation, (clinic) can carry out primary dcreening operation to target cause of disease at the scene, save a large amount of human and material resources.In medicine
Field, this technology except for the antigen of hormone, infectious disease pathogens and antibody, bacterium, parasite detection in addition to, also develop to
Detection to small-molecule substances such as drugs.The specimen types of detection also contemplated serum, blood plasma, whole blood, urine, excrement and saliva
Deng showing wide prospect and huge application value.
Colloidal gold strip is mainly used in medical domain and animal and veterinary field at home.It is rarer in agriculture and animal husbandry field
Ripe product, more appears in relevant scientific research project.Sun Yan etc. (2011) has carried out cucumber using colloidal gold technique
The quick detection research of bacterial angular leaf spot (Pseudomona.s.syringae pv.Lachrymans).The country is related to cigarette
The commercial colloidal gold strip of careless virosis detection is considerably less.External commercialization test strips are very expensive, and price is 50~60
Yuan/, the detection for being unsuitable for the upper large quantities of tobacco seedlings of production use.
Therefore, there is an urgent need to establish a kind of viral diagnosis that is simple, quick, sensitive, cheap and being suitable for base's application
Method.
Invention content：
The object of the present invention is to provide a kind of quick, accurate, sensitive, qualitative detection Tobacco-growing areas in Guangdong cucumber mosaic virus wide
Eastern cigarette district cucumber mosaic virus colloidal gold fast detecting test paper strip.
Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present invention, test strips are by sample pad, combination
Pad (colloidal gold pad), nitrocellulose filter (NC films), absorption pad and backing composition, the sample pad, bonding pad and cellulose nitrate
Plain film is incorporated according to sequence from left to right, from top to bottom on backing the same face successively, bonding pad and nitrocellulose filter
End is overlapped, and the absorption pad is incorporated in the other end of nitrocellulose filter, which is characterized in that is coated on the bonding pad
There are the CMV specific antibodies of colloid gold label, detection line and control line are provided with, and detection line is located on the nitrocellulose membrane
Position between bonding pad and control line, antigen of the coating CP-C-GD albumen as CMV viruses in detection line are wrapped on control line
There is the secondary antibody of the anti-CMV specific antibodies of colloid gold label；
The CMV specific antibodies are using CP-C-GD albumen as mice immunized with antigen, carry out test for fusion, obtain sun
Property hybridoma cell strain, positive hybridoma cell strain is cultivated, purifying obtain the monoclonal antibody of anti-CP-C-GD albumen,
As CMV specific antibodies, the nucleotide sequence of the encoding gene of the CP-C-GD albumen is as shown in SEQ ID NO.1.
The CMV specific antibodies are to be by preserving number：The BAL B/c mouse hybridoma cell strains of CGMCC No.12679
BAL B/c-15-27 secretions generate.
Second object of the present invention is to provide a kind of BAL B/c mouse hybridoma cells that can generate CMV specific antibodies
Strain BAL B/c-15-27, deposit number are：CGMCC No.12679.
The present invention successfully constructs Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper using A competitive inhibition method
Item.Its basic principle is as follows：
The CMV specific antibodies of colloid gold label are adsorbed on bonding pad (i.e. colloidal gold pad), the specific antigen of CMV viruses
On (CP-C-GD albumen) is fixed on ribbon at the detection line (T lines) of nitrocellulose membrane, the secondary antibody of colloid gold label is fixed on
At the control line (C lines) of nitrocellulose membrane.After sample to be checked is added in the sample pad of test strips one end, through capillary action to
Preceding movement reacts to each other after dissolving the colloid gold label specific reagent on bonding pad, then when being moved to fixed antigenic domains, treats
Inspection object and the conjugate of golden labelled antibody are specifically bound therewith again.
When sample to be tested contains CMV viruses, the specific antibody of its colloid gold label with being dissolved in sample pad is mutual
Reaction；When being moved to fixed antigenic domains again, without enough gold labeling antibodies and fixed antigen-reactive, do not have at T lines
There is the appearance of rufous lines, experimental result is the positive.When free gold labeling antibody or gold labeling antibody complex logistics are through at C, with
There is rufous quality control band in two anti-bindings at this.
When sample to be tested does not have CMV viruses, it does not react with the colloidal gold labeled monoclonal antibody being dissolved on bonding pad；
When being moved to fixed antigenic domains again, there are enough gold labeling antibodies and fixed antigen-reactive, and be trapped and be gathered in T lines
On, rufous band can be observed by the naked eye, experimental result is feminine gender.
The invention has the advantages that：
Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present invention, high specificity, the pass used
The popular strain that key antibody is specific to Tobacco-growing areas in Guangdong CMV builds to obtain, specifically for the CMV of Tobacco-growing areas in Guangdong.Due to the use of
Specific antibody be BAL B/c mouse hybridoma cell strain BAL B/c-15-27 secretion monoclonal antibody, sensitivity is very
Height can reach 1g/100ml.
Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present invention is small, easy to carry, is not required to
Instrument and equipment is wanted, it is easy to operate.Can Site Detection, go out result in 3-10min；It as a result can be by naked eyes according to the depth of T line colors
Judged.This method is very suitable for carrying out batch samples live primary dcreening operation, there is very much application value in actual production.
The BAL B/c mouse hybridoma cell strain BAL B/c-15-27 of the present invention, on 06 30th, 2016 are preserved in
State's Microbiological Culture Collection administration committee common micro-organisms center (CGMCC), address：BeiChen West Road, Chaoyang District, BeiJing City 1
No. 3 Institute of Microorganism, Academia Sinica of institute, deposit number are：CGMCC No.12679.
Description of the drawings：
Fig. 1 is the structure diagram of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip；
Wherein 1, sample pad；2nd, bonding pad；3rd, nitrocellulose filter；4th, absorption pad；5th, detection line T lines；6th, control line C；
7th, support slice.
Fig. 2 is test strips test result, and left side is negative sample, and right side is positive.
Specific embodiment：
Following embodiment is the further explanation to the present invention rather than limitation of the present invention.
Embodiment 1：The preparation (i.e. specific antigen) of CP-C-GD albumen
1st, the nucleotide sequence of the encoding gene (can be artificial synthesized) of CP-C-GD albumen is as shown in SEQ ID NO.1,
Enzyme enzyme site EcoR I and the Xho I in its both ends, sequence are as follows：
5’-GAATTCATGGATAAAAGTGAATCAACGTCAGCAGGTCGTAACCGCCGCCGCCGTC
CGCGTCGTGGTAGCCGTAGTGCCCCGTCATCAGCCGATGCCAACTTTCGTGTTCTGAGTCAGCAACTGTCCCGCCTG
AACAAAACCCTGGCAGCAGGTCGTCCGACCATTAATCATCCGACGTTTGTGGGCTCAGAACGTTGCCGCCCGGGTTA
TACCTTCACGTCGATTACCCTGAAACCGCCGAAAATCGATCGTGGCTCATATTACGGTAAACGCCTGCTGCTGCCGG
ATAGCGTTACGGAATTTGACAAAAAACTGGTCTCTCGTATTCAGATCCGCGTGAATCCGCTGCCGAAATTCGATTCC
ACCGTGTGGGTTACGGTCCGCAAAGTTCCGGCGAGCTCTGATCTGTCAGTCGCAGCTATTTCGGCAATGTTCGCTGA
CGGCGCGAGTCCGGTGCTGGTTTATCAGTACGC
GGCCTCCGGTGTGCAAGCTAACAATAAACTGCTGTACGATCTGAGCGCCATGCGTGCAGATATCGGCGACATGCGCA
AATATGCGGTCCTGGTGTACTCTAAAGATGACACCCTGGAAACGGATGAACTGGTTCTGCATGTCGACATTGAACAC
CAACGTATCCCGACCAGCGGTGTGCTGCCGGTTCTCGAG-3’。
By encoding gene segment EcoR I and the Xho I of the CP-C-GD albumen containing restriction enzyme site EcoR I and Xho I
Double digestion obtains CP-C-GD endonuclease bamhis；
PUC57 carriers pET30a-GST is subjected to double digestion with EcoR I and Xho I, obtains carrier endonuclease bamhi, digestion
System is：43 μ l carriers (pET30a-GST) plasmids, 1 μ l EcoR I, 1 μ l Xho I, 5 10 × Buffer of μ l, 37 DEG C overnight
Then reaction recycles carrier endonuclease bamhi with Ago-Gel DNA QIAquick Gel Extraction Kits.
2nd, connection conversion
(1) it connects：
1 μ l carriers (pET 30a-GST), 3 μ l segments, 1 μ l ligases (BPI), 5 μ l 2 × Rapid Buffer, mixing,
React at room temperature 30min.
(2) it converts：
1) 100 μ l competent cells (BL21) of -80 DEG C of preservations are taken out, are placed on ice slowly defrosting.
2) competent cell is added in the pipe of 1 μ l recombinant plasmids, mixing places 30min on ice.
3) 42 DEG C of heat shock 90s.
4) after ice bath 2min, the LB culture mediums of 800 μ l non-resistants are added in.
5) 37 DEG C of culture 45min.
6) 5000rpm centrifuges 3min, abandons most of supernatant, stays about 100-150 μ l, and thalline is resuspended, and selection has corresponding resistant
LB tablets, coated plate.
7) it dries, overnight incubation is inverted in 37 DEG C of incubators.
3rd, sequence verification
Sequence verification is correct, and sequencing peak figure is seen appendix.
4th, a small amount of detection of expression
(1) it is chosen in monoclonal to 1.5ml LB fluid nutrient mediums from the tablet of conversion, 37 DEG C, 200rpm cultures.
(2) culture is induced to OD=0.6, IPTG (0.5mM), and 37 DEG C, 200rpm cultivates 2h.
(3) bacterium solution that 1ml is taken to induce, 12000rpm centrifuge 1min, abandon supernatant, precipitation 50-100 μ l 10mM Tris-
HCl (pH8.0) solution dispels and (adds in the amount of buffer solution depending on biomass), adds in the 2 × loading isometric with buffer solution
Buffer, 100 DEG C are boiled 5min, and electrophoresis detection, the results are shown in Figure 1.As a result：No. 1 clone has correct band of expression.
5th, great expression
(1) the correct bacterial strain of verification is selected, is connect in the bacterium solution to 5ml LB fluid nutrient mediums that 5-10 μ l are activated, 37 DEG C,
200rpm, culture.
(2) bacterium solution of culture is transferred to 500mL LB fluid nutrient mediums to mix, 37 DEG C, 200rpm is cultivated to OD=
0.6, IPTG (0.5mM) induces 4h.
(3) bacterium is largely received：With the big concentrator bowls of 400ml, 6000rpm centrifuges 5min.Abandon supernatant.
(4) carrying out ultrasonic bacteria breaking：Precipitation is dispelled with 25ml 10mM Tris-HCl (pH 8.0) solution, ultrasound.
(5) electrophoresis determines expression-form：The bacteria suspension after 100 μ l ultrasounds (500W 90 times, each 3s, is spaced 6s) is taken,
12000rpm centrifuges 10min, and 50 μ l supernatants is taken to be managed to another EP, are precipitated after supernatant removal is clean with 50 μ l10mM Tris-HCl
(pH 8.0) solution dispels, and adds in 50 μ 2 × loading of l buffer, and 100 DEG C are boiled 5min, electrophoresis, and electrophoretogram is as shown in Figure 2.
As a result：Albumen has expression, and main expression is in precipitation.
6th, protein purification (washing inclusion body)
The precipitation that ultrasound centrifugation obtains is resuspended in (1) 20~30ml 10mM Tris-HCl (pH8.0) solution, stands 10min.
(2) 12000rpm, centrifuges 10min, and supernatant is transferred in another pipe and preserves.
Precipitation is resuspended in (3) 20~30ml 10mM Tris-HCl (pH8.0) solution, stands 10min.
(4) 12000rpm centrifuges 10min, abandons supernatant.
(5) (3), (4) are repeated once.
(6) it first adds in a small amount of 10mM Tris-HCl (pH8.0) solution and precipitation is resuspended, then add 5~10ml urea containing 8M
10mM Tris-HCl (pH8.0) solution soluble protein.
(7) 12000rpm centrifuges 10min, collects supernatant, takes 50 μ l electrophoresis.As a result：Purifying obtains destination protein (C P-
C-GD albumen).
Embodiment 2：The preparation of BAL B/c mouse hybridoma cell strain BAL B/c-15-27
1st, it is immunized
2015-07-22 uses " CMV ", by the amount of 60ug albumen/mouse, subcutaneous 4 SPF BALB/c females of initial immunity
Mouse, number are：1st, 2,3,4.
The subcutaneous first time booster immunizations of 2015-08-05, be immunized amount for 30ug albumen/only.
Subcutaneous second of the booster immunization of 2015-08-19, be immunized amount for 30ug albumen/only.
The subcutaneous third time booster immunizations of 2015-09-02, be immunized amount for 30ug albumen/only.
2015-09-10 eye sockets take blood, survey serum titer.
2015-09-28 immunogene 50ug, abdominal cavity impact #4 mouse.
2nd, immunizing potency detects：
Step：With " CMV ", 2ug/ml, 4 DEG C of coatings are overnight；2% milk, 37 DEG C of closing 2h；Serum is 2 times since 200 times
Gradient dilution, blank control (blank) are PBS, and negative control (negative) is 200 times of dilutions of negative serum.
As a result：It chooses impact #4 mouse and does cell fusion experiment.
Add potency：
2.2 cell fusions are tested
2015-10-01 takes mouse boosting cell and SP2/0 cells, is merged using PEG methods.It is solid with half cell has been merged
Body culture medium (containing HAT) carries out screening and culturing.
2.2.1 experiment equipment
The surgical instrument of sterilizing：Three scissors, three tweezers, a cell sieve, the inner core of syringe, one it is flat
Ware.Wet box, 2 500ml beakers, 2 50ml centrifuge tubes, 3 15ml centrifuge tubes.
2.2.2 experiment reagent
IMDM culture mediums, IMDM complete mediums (containing 15% serum), 2.2% methylcellulose：Producer：SIGMA；Goods
Number：M0262-100G, newborn bovine serum：10ml、PEG1500：Producer：Roche；Article No.：78364、HAT：Producer：Sigma；Goods
Number：H0262-10VL、HT：Producer：Sigma；Article No.：H0137-10VL
2.2.3 fusion experiment step
1) it is blown and beaten from culture bottle wall by sp2/0 cells in good condition are soft, is drawn into 50ml centrifuge tubes.
2) mouse plucks eyeball and takes blood, then neck is drawn to put to death, is put into 75% alcohol and impregnates 5min.
3) IMDM of a small amount of serum-free is poured into plate, cell sieve and plunger are put into plate.Use scissors
The spleen of mouse is removed with tweezers, is put into cell sieve.Lightly spleen is fully pulverized with the inner core of syringe, it is thin by what is ground
Born of the same parents are drawn into the centrifuge tube of dress sp2/0, centrifuge 1500rad/min, 5min.
4) thymus gland of mouse is removed with scissors and tweezers, is pulverized.By in the thymocyte ground to 15ml centrifuge tubes, then add
Enter the HAT of 1ml, be placed on spare in incubator.
5) cell that will have been centrifuged outwells supernatant, and cell is carefully gently blown to even, centrifugation with the IMDM of serum-free
(1500rad/min, 5min).
6) cell conditioned medium centrifuged is outwelled as possible.The abundant suspension cell in centrifuge tube bottom is patted, centrifuge tube is put into 37
In DEG C warm water, the PEG of 1ml was slowly added in 1 minute, after adding, 1min is stood in warm water.Then it is slowly added in 2min
The IMDM of the serum-free of 2ml is then slowly added to the IMDM of 8ml serum-frees in 2min.Centrifuge 1000rad/min, 5min.
7) supernatant is outwelled, adds in the serum of 10ml, careful blow cell is even, pours into the ready thymocyte in front.
Add the sterilized semisolid culturemediums of 25ml, abundant mixing.Then it uniformly pours into 30 Tissue Culture Dish.Cell is trained
Foster ware is put into wet box, is then placed in incubator and is cultivated.
2.3 choose clone
2015-10-13 chooses 10 plateshttp://192.168.5.97:801/index.jspModule=business＆ Way=normal× 93 cell monoclonals are incubated at 96 porocyte culture plates (in advance with thymocyte bed board, 100ul/
Hole).
2.4 monoclonal cells 1 sieve
2015-10-16 " CMV " wrapper sheets, the clone to selecting are done and screened for the first time, obtained using ELISA method
48http://192.168.5.97:801/login.loginbusiness.doStrain positive hybridoma cell strain.
2.4.1 experiment reagent
Coating buffer：Sodium carbonate-bicarbonate buffer solution, pH9.6, PBS buffer solution pH7.4, confining liquid：2% milk in
PBS, washing lotion：PBS-T (0.05% tween, PBS), developing solution:1%A liquid+10%B liquid (A liquid：1%TMB in DMSO；B liquid：
0.1%H2O2In citrate buffer solutions), terminate liquid：2M sulfuric acid, secondary antibody：Goat anti-mouse IgG/HRP.
2.4.2 experimental procedure
1) it is diluted " CMV " with coating buffer, final concentration of 2ug/ml, 100ul/ holes, 4 DEG C, overnight；Wash liquid is used afterwards 3 times.
2) 2% milk confining liquid is closed, 200ul/ holes, 37 DEG C of incubators, 2h；Wash liquid is used afterwards 3 times.
3) addition primary antibody (cells and supernatant), negative control (SP2/0 culture supernatants), blank control (PBS), the positive are right
It is 100ul/ holes according to (positive serum PBS 1000 times dilution), 37 DEG C of incubators, 1h；Wash liquid is used afterwards 3 times.
4) secondary antibody that PBS dilutes 20000 times, 100ul/ holes, 37 DEG C of incubators, 1h are added in；Wash liquid is used after taking-up 3 times.
5) it develops the color, developing solution 100ul/ holes, developing time is 5min or so.
6) 50ul terminate liquids are added in per hole to terminate.
7) dual wavelength (450,630) surveys light absorption value, and record preserves data
2.4.3 experimental data
2.5 monoclonal cells 2 sieve
2015-10-19 http://192.168.5.97:801/index.jspModule=business＆way= normal, by 48http://192.168.5.97:801/index.jspModule=admin＆way=normalStrain is positive
Cell strain, with " CMV " and label protein wrapper sheet again, using ELISA method, do programmed screening, obtain 24http:// 192.168.5.97:801/login.loginbusiness.doStrain positive hybridoma cell strain.
Experimental data
2.6 monoclonal cell subgroup identifications
2015-10-20 will screen 24http://192.168.5.97:801/index.jspModule= Business＆way=normalThe strain of strain positive cell carries out subgroup identification,http://192.168.5.97:801/ login.loginadmin.doFinally obtain the positive hybridoma cell strain of 13 plants of IgG types.
2.6.1 experiment reagent
Coated antibody：(Southern Biotech)
Confining liquid：2%BSA+3% sucrose in PBS；
Developing solution:0.2ml A liquid+10ul 30%H2O2In 10ml B liquid
(A liquid：15mg/ml ABTS in H2O；B liquid：Citrate buffer solution, pH4.0)
Various subclass secondary antibody:(Southern Biotech)
2.6.2 experimental procedure
1) coated antibody is diluted to 0.5ug/ml with 100mM PBS (pH7.4), 0.1ml is added per hole, 4 DEG C, is stayed overnight.
2) PBS-T is washed 2 times, and 200ul confining liquids, 37 DEG C of incubation 2h are added in per hole.
3) PBS-T is washed 3 times；100ul hybridoma supematants, 37 DEG C of incubation 1h are added in per hole.
4) PBS-T is washed 3 times；With confining liquid 1：10000 (κ, λ) or 1：The antibody of the diluted HRP labels of 20000 (others)
0.1ml is separately added into per hole in appropriate hole, 37 DEG C of incubation 1h.
5) PBS-T is washed 3 times；Adding 50ul substrate solutions per hole, 10-20min is interior to survey light absorption value in dual wavelength (450,630),
Record preserves data.
6) experimental data
3. monoclonal cell strain relevant information
The cell strain that screening number is 27 carries out preservation, is named as BAL B/c mouse hybridoma cell strain BAL B/c-
15-27 was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on 06 30th, 2016
(CGMCC), address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, deposit number are：
CGMCC No.12679。
Embodiment 3：The preparation of CMV specific antibodies
1st, culture BAL B/c mouse hybridoma cell strain BAL B/c-15-27；
2nd, Protein A cross column purification and obtain CMV specific antibodies.
Embodiment 4：The preparation and use of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip
1st, experiment material：
Colloid gold particle：It is prepared (30nm) with sodium citrate reduction method；
The CMV specific antibodies of colloid gold label
Labeling method：Colloid aurosol is adjusted to pH 8.5,1mL colloidal golds are respectively added in 11 test tubes, adds people respectively
20th, the CMV specific antibodies of 18,16,14,12,10,8,6,4,2 and 0ug/mL, after reacting 10min, each pipe plus people 10%NaCL
Solution 100uL stands 2h, observes each pipe color change, and then 12,000rpm centrifuges 10min, removes supernatant, and people is added to contain 1%
The PBS dissolving precipitations of OVA, observation colloidal sol cohesion situation.
It is completely dissolved with precipitation and adds 20% for optimum mark in the minimum antibody concentration of the claret solution conduit of homogeneous transparent
Antibody concentration.As a result the optimum mark amount of antibody is 8ug/mL.
Secondary antibody：Goat-anti-Rabbit IgG are (purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd, article No.
For：IH-0011)；
(purchased from company of Shanghai Jinbiao Bio-Tech Co., Ltd., article No. is JY-D101 DB-6 bottom plates：plastic
backing card)
(purchased from company of Shanghai Jinbiao Bio-Tech Co., Ltd., article No. is JY-X115 H5072 blotting papers：
Absorbent Paper)
(purchased from company of Shanghai Jinbiao Bio-Tech Co., Ltd., article No. is JY-BX101 gold-labelled pads：Polyester fiber film)
(purchased from company of Shanghai Jinbiao Bio-Tech Co., Ltd., article No. is 3 sample pads of JY-JZ112 fusion：Glass
Glass tunica fibrosa)
(purchased from company of Shanghai Jinbiao Bio-Tech Co., Ltd., article No. is JY-C111 A-11 plastic clips：plastic
cassette)
2nd, laboratory apparatus：
JY-EQ03 continous ways draw film instrument JY-EQ02 metal spraying machines
JY-EQ01 cuts formula cutter-I JY-EQ05 case pressing machines.
3rd, the assembling of test strip：
The assembling environment of test strip is assembled under the conditions of 25 DEG C of room temperature, relative humidity are less than 40%.
As shown in Figure 1, Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present embodiment is by sample pad 1
(3 sample pads of JY-JZ112fusion), bonding pad 2 (JY-BX101 gold-labelled pads), nitrocellulose filter 3,4 (JY- of absorption pad
X115 H5072 blotting papers) it is adhered to successively on the support slice 7 (JY-D101 DB-6 bottom plates) not absorbed water, in the combination
Be adsorbed with the CMV specific antibodies of colloid gold label on pad, and also CP-C-GD albumen as CMV viruses specific antigen with
Ribbon is fixed at the detection line T lines 5 of nitrocellulose membrane, the secondary antibody (Goat- of the anti-CMV specific antibodies of colloid gold label
Anti-Rabbit IgG) it is fixed at the control line C 6 of nitrocellulose membrane.
It takes and has infected the tobacco of CMV and the blade of health tobacco as experiment material, each 0.2g adds PBS buffer solution
(pH8.0,0.01M), is ground, and not dilute leaf with tap water.50uL lapping liquids is respectively taken to be added to the test strips prepared
In sample pad, five minutes sentence read results.Having infected does not have rufous band, experimental result at the test strips T of the tobacco sample of CMV
For positive (Fig. 2).There is band at the test strips T of health tobacco sample, experimental result is feminine gender, and detection result is good (Fig. 2).
Embodiment 5：Sensitivity test
The 0.1g tobacco diseases sample PBS of 0.01mol/L is diluted into 6 series concentrations, is mixed in equal volume with sample treatment liquid
Afterwards, final concentration of 10,1,10-1、10-2、10-3、10-4Mg/mL is mixed into negative control in equal volume with PBS and sample treatment liquid,
Measure test strips sensitivity.
The results show that the sensitivity of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip of the present invention is
10-2mg/mL。
Claims (2)
1. a kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip, test strips are by sample pad, bonding pad, nitric acid
Cellulose membrane, absorption pad and backing composition, the sample pad, bonding pad and nitrocellulose filter according to from left to right, from up to
Under sequence be incorporated in successively on backing the same face, the end of bonding pad and nitrocellulose filter overlapping, the absorption pad combines
In the other end of nitrocellulose filter, which is characterized in that the CMV that colloid gold label is coated on the bonding pad specifically resists
Body is provided with detection line and control line, and position of the detection line between bonding pad and control line on the nitrocellulose membrane
It puts, antigen of the CP-C-GD albumen as CMV viruses is coated in detection line, the anti-CMV that colloid gold label is coated on control line is special
The secondary antibody of xenoantibody；
The CMV specific antibodies are using CP-C-GD albumen as mice immunized with antigen, carry out test for fusion, are obtained positive miscellaneous
Tumor cell strain is handed over, positive hybridoma cell strain is cultivated, purifying obtains the monoclonal antibody of anti-CP-C-GD albumen, as
CMV specific antibodies, the nucleotide sequence of the encoding gene of the CP-C-GD albumen is as shown in SEQ ID NO.1；Described
CMV specific antibodies are to be by preserving number：The BAL B/c mouse hybridoma cell strain BAL B/c-15-27 of CGMCC No.12679
Secretion generates.
2. a kind of BAL B/c mouse hybridoma cell strain BAL B/c-15-27 that can generate CMV specific antibodies, deposit number
For：CGMCC No.12679.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610844103.5A CN106596931B (en) | 2016-09-22 | 2016-09-22 | A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610844103.5A CN106596931B (en) | 2016-09-22 | 2016-09-22 | A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106596931A CN106596931A (en) | 2017-04-26 |
| CN106596931B true CN106596931B (en) | 2018-06-26 |
Family
ID=58556090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610844103.5A Expired - Fee Related CN106596931B (en) | 2016-09-22 | 2016-09-22 | A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106596931B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106479984A (en) * | 2016-09-23 | 2017-03-08 | 华南农业大学 | A kind of dual virus colloidal gold Rapid detection test strip of CMV PVY |
| CN106526180B (en) * | 2016-09-23 | 2018-08-07 | 华南农业大学 | A kind of dual virus colloidal gold Rapid detection test strips of TMV-CMV |
| CN106636004B (en) * | 2016-09-23 | 2020-02-04 | 华南农业大学 | TMV-CMV-PVY triple virus colloidal gold rapid detection test strip |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1996020A (en) * | 2005-12-31 | 2007-07-11 | 中国科学院寒区旱区环境与工程研究所 | Double-antibody sandwich enzyme-linked immunologic adsorption detection kit for cucumber mosaic virus and method for preparing same |
| CN101210924A (en) * | 2006-12-30 | 2008-07-02 | 河南农业大学 | Tobacco cucumber mosaic virus field rapid detection test paper preparation method |
| CN101294963A (en) * | 2007-04-26 | 2008-10-29 | 福建农林大学 | Immune colloidal gold reagent for detecting orchid virus series and its preparation |
| CN101556282A (en) * | 2008-04-09 | 2009-10-14 | 河南农业大学 | Field rapid detection test strip for tobacco compound virus and preparation method thereof |
-
2016
- 2016-09-22 CN CN201610844103.5A patent/CN106596931B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1996020A (en) * | 2005-12-31 | 2007-07-11 | 中国科学院寒区旱区环境与工程研究所 | Double-antibody sandwich enzyme-linked immunologic adsorption detection kit for cucumber mosaic virus and method for preparing same |
| CN101210924A (en) * | 2006-12-30 | 2008-07-02 | 河南农业大学 | Tobacco cucumber mosaic virus field rapid detection test paper preparation method |
| CN101294963A (en) * | 2007-04-26 | 2008-10-29 | 福建农林大学 | Immune colloidal gold reagent for detecting orchid virus series and its preparation |
| CN101556282A (en) * | 2008-04-09 | 2009-10-14 | 河南农业大学 | Field rapid detection test strip for tobacco compound virus and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Identification and Subgrouping of Cucumber mosaic virus with Mouse Monoclonal Antibodies;H.T.Hsu et al;《Virology》;20001231;第90卷(第6期);第615-620页 * |
| 黄瓜花叶病毒CP基因原核表达及抗血清的制备;秦云霞 等;《中国生物工程杂志》;20040831;第24卷(第8期);摘要 * |
| 黄瓜花叶病毒亚组研究进展;徐平东 等;《福建农业大学学报》;19980331;第82-91页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106596931A (en) | 2017-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104007261B (en) | Fowl three kinds of breathing problem three quick detection kit and application | |
| CN102659923B (en) | Epitope minimal motif peptides of human zona pellucida protein-4 and extended short peptides and application thereof | |
| CN106596931B (en) | A kind of Tobacco-growing areas in Guangdong's cucumber mosaic virus colloidal gold fast detecting test paper strip | |
| CN106636004B (en) | TMV-CMV-PVY triple virus colloidal gold rapid detection test strip | |
| CN109187967B (en) | Duplex rapid detection card for detecting and distinguishing O-type and A-type foot-and-mouth disease viruses and preparation method thereof | |
| CN101363867B (en) | Test paper strip for detecting clostridium difficile toxin A and toxin B colloidal gold, method for making same | |
| CN101130765B (en) | Reagent kit for detecting syncytial virus of respiratory passage | |
| CN108084255A (en) | A kind of preparation of canine recombinant c reactive protein and its monoclonal antibody | |
| CN104357401B (en) | Hybridoma, monoclonal antibody and the application of anti-II types dengue virus NS 1 monoclonal antibody can be secreted | |
| CN106244561A (en) | A kind of TMV PVY dual virus colloidal gold Rapid detection test strip | |
| CN103333864B (en) | Monoclonal antibody of toxoplasma gondii resistant MIC3 protein and application monoclonal antibody | |
| CN101363859B (en) | Test paper strip for rapidly detecting brucellosis antibody | |
| CN110144007B (en) | anti-H7N 9 avian influenza virus hemagglutinin protein monoclonal antibody ZJU79-01 and application thereof | |
| CN101887061A (en) | Colloidal gold immuno-chromatography test paper strip used for detecting escherichia coil F5 pilus and preparation method thereof | |
| CN101362801A (en) | Rapid detection test strip for detecting campylobacter jejuni specific antigen | |
| CN106479984A (en) | A kind of dual virus colloidal gold Rapid detection test strip of CMV PVY | |
| CN106526179B (en) | A kind of PVY substances virus colloidal gold Rapid detection test strip | |
| CN111505289A (en) | Peste des petits ruminants detection kit | |
| CN105296435B (en) | The monoclonal antibody specific and application of hybridoma cell strain and its O-shaped (O/GX/09-7) virus of the resistant to foot and mouth disease of secretion | |
| CN101692089A (en) | Immunochromatographic test paper for detecting mycobacterium bovis antibodies and preparation method thereof | |
| CN101363864B (en) | Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications | |
| Zhou et al. | Development of a novel antibody probe useful for domoic acid detection | |
| CN106526180B (en) | A kind of dual virus colloidal gold Rapid detection test strips of TMV-CMV | |
| CN102608330A (en) | Immunochromatographic strip for detecting alveolar echinococcosis and preparation method thereof | |
| CN106497887A (en) | A kind of TMV substances virus colloidal gold Rapid detection test strip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180626 Termination date: 20180922 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |