CN106591329B - CYP3A4 gene segment containing 337T & gtA mutation, coded protein segment and application thereof - Google Patents

Abstract

The invention discloses a CYP3A4 gene segment containing 337T & gtA mutation, a coded protein segment and application thereof, belonging to the technical field of biology. A nucleic acid fragment comprising a nucleotide sequence corresponding to SEQ ID NO:1, and is a mutation site at position 1012 of the sequence table SEQ ID NO:1, wherein the nucleotide at position 1012 is a; or the complement of the nucleic acid fragment. The invention provides a method for rapidly amplifying a target gene by using an oligonucleotide fragment; rapidly analyzing the allele of the biological sample and indicating whether variation exists; the activity of the variant protein is studied, and the amount of the drug to be used is recommended to be adjusted according to experimental data.

Description

CYP3A4 gene segment containing 337T & gtA mutation, coded protein segment and application thereof

Technical Field

The invention belongs to the field of biotechnology, and comprises a CYP3A4 gene segment with 337T & gtA mutation, an encoded protein segment and application thereof.

Background

CYP3A4 is the most important member of the large family CYP3A subfamily of cytochrome P450 enzymes, accounting for approximately 60% of the total human liver microsomal CYP enzymes and 70% of the total intestinal microsomes. About 40-50% of the clinically used drugs are oxidized and metabolized by CYP3A4, which mainly comprise macrolide antibiotics, antifungal drugs, H1 receptor antagonists, HMG-CoA reductase inhibitors, benzodiazepines, proton pump inhibitors, calcium channel blockers, antitumor drugs, antipsychotics and the like.

The CYP3A4 gene is highly polymorphic. To date, there are 26 alleles named internationally (http:// www.cypalleles.ki.se), and in addition to the wild type (CYP3A4 x 1), there are 25 mutation types that cause changes in the amino acid composition of the CYP3A4 protein, and there are many newly discovered mutations that have been named but not yet published on the website. The mutants which have wide human species distribution, most research and relatively most abundant research data of Chinese population are CYP3A 4X 4(352A & gtG), CYP3A 4X 5(653C & gtG) and CYP3A 4X 18(878T & gtC).

According to the current clinical research, the polymorphism of the CYP3A4 gene is the main reason for the great difference of the CYP3A4 enzyme activity among individuals, so that the great difference of the drug curative effect can be caused among the individuals carrying different CYP3A4 genotypes, and even serious drug toxic and side effects or insufficient treatment can be generated. Therefore, the research on the influence of the CYP3A4 gene polymorphism on the curative effect of the medicament provides important scientific basis for clinical rational medicament application.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a novel single-base mutation site of CYP3A4 gene, a nucleic acid fragment containing the mutation site, a protein fragment coded by the mutation site and application of identifying the mutation site in medication guidance.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention relates to a novel single-base mutation site based on CYP3A4 gene. The mutation site is positioned in a coding region of a CYP3A4 gene and corresponds to a sequence table SEQ ID NO:2, the position is mutated from T of a wild type to A (337T is more than A); in addition, phenylalanine was mutated to isoleucine at position 113 of the protein encoded by the mutated CYP3A4 gene (F113I).

A nucleic acid fragment comprising a sequence corresponding to SEQ ID NO:1, and is a mutation site at position 1012 of the sequence table SEQ ID NO:1, wherein the nucleotide at position 1012 is a; or the nucleic acid fragment comprises a nucleotide sequence corresponding to SEQ ID NO:2, and is a mutation site at position 337 of the sequence listing SEQ ID NO:2, wherein the nucleotide at position 337 is a; or a sequence complementary to the above-mentioned nucleic acid fragment.

The length of the nucleic acid fragment is 10-100, 100-200, 200-500 or 500-1000 nucleotides; preferably, the nucleic acid fragment is 10-20, 20-30, 30-40, 40-50, 50-60, 60-100 or 100-300 nucleotides in length; further preferably, the nucleic acid fragment is a nucleic acid fragment represented by SEQ ID NO: 1. 2, 33-40.

The mutation site may be located at any position of the nucleic acid fragment.

In another embodiment, the nucleic acid fragment is a fragment of SEQ ID NO:1, or a fragment thereof.

In another embodiment, the nucleic acid fragment is a fragment of SEQ ID NO:2, or a pharmaceutically acceptable salt thereof.

In other embodiments, the nucleic acid fragment may be a sequence set forth in SEQ ID NO: 33-40.

Further, the present invention provides an allele-specific oligonucleotide that hybridizes to a nucleic acid molecule comprising a nucleotide sequence corresponding to SEQ ID NO:1 or a sequence corresponding to SEQ ID NO:2 or the complement thereof, wherein the sequence listing SEQ ID NO:1, 1012 th position or sequence listing SEQ ID NO:2 is a at the 337 th mutation site; the allelic fragment is shown in a sequence table SEQ ID NO:1 or SEQ ID NO:2 or a complement thereof.

The oligonucleotide is a probe or primer; preferably, when the oligonucleotide is a probe, the oligonucleotide is 5-100 nucleotides in length; when the oligonucleotide is a primer, the oligonucleotide is 15-40 nucleotides in length; preferably, when the oligonucleotide is a probe, the mutation site is located at or about the center of the probe sequence; when the oligonucleotide is a primer, the mutation site is located at the 3' end of the primer.

In one embodiment, the oligonucleotide is used as a probe. The probe is capable of specifically hybridizing to a target sequence comprising a mutation site under stringent conditions. It is known to those skilled in the art that the probe need not be perfectly complementary to the target sequence, so long as it specifically hybridizes to the target sequence. In a preferred embodiment, the hybridization conditions are such that the probe specifically hybridizes only to the target sequence. The probe may be 5-100 nucleotides in length, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. The mutation site may be present at any position of the probe. In preferred embodiments, the mutation site occurs at or about the center of the probe sequence.

In another embodiment, the oligonucleotide is used as a primer for directing DNA synthesis, such as sequencing primers or synthetic primers, etc., as are well known in the art. The primer need not be perfectly complementary to the template, but should hybridize complementarily to the template to direct DNA synthesis. The length of the primer may be 15-40 nucleotides in length, preferably 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. The mutation site may be present at any position of the primer; preferably, the mutation site is present at the 3' end of the primer.

Further, the present invention provides a kit for detecting and/or analyzing single base mutation, the kit comprising the nucleic acid fragment or allele-specific oligonucleotide of the present invention, or comprising the nucleic acid fragment of the sequence listing SEQ ID NO: 10 and/or SEQ ID NO: 11 and/or SEQ ID NO: 25, or a fragment thereof.

Further, the present invention provides the use of the allele-specific oligonucleotide for detecting mutations in the CYP3a4 gene, wherein the nucleic acid fragment or the oligonucleotide is used as a probe or a primer.

Further, the invention provides a medication guide, which comprises the following steps of detecting the CYP3A4 gene in a sample to be detected, wherein the gene corresponds to SEQ ID NO:1 or the sequence listing SEQ ID NO:2, single base mutation at position 337; the amount of the drug metabolized by CYP3A4 to be administered is adjusted based on the detected mutation. In a specific example, when the CYP3a4 gene is represented in the sequence listing SEQ ID NO:2 at position 337 is A, the CYP3A4 protease activity encoded by the gene is increased, and therefore, it is necessary to increase the amount of the drug metabolized by CYP3A 4.

The drug metabolized by CYP3A4 in the present invention includes: anticancer drugs, such as cyclophosphamide, ifosfamide or paclitaxel; anticoagulants, such as warfarin, viniferin, anticonvulsants, or mephenytoin; hypoglycemic agents such as tolbutamide, nateglinide, pioglitazone or rosiglitazone; antiepileptic drugs such as phenytoin or zonisamide; antimalarial/antiparasitic agents such as amodiaquine, proguanil hydrochloride or quinine; antipsychotics, such as amitriptyline, citalopram, imipramine, perospirone, sertraline, thioridazine, or venlafaxine; hypotensive agents such as losartan, irbesartan or valsartan; non-steroidal anti-inflammatory drugs such as diclofenac, aminopyrine, antipyrine, celecoxib, flurbiprofen, ibuprofen, indomethacin, lornoxicam, mefenamic acid, naproxen, piroxicam or tenoxicam; analgesics such as loperamide, methadone or morphine; proton pump inhibitors such as lansoprazole or omeprazole; sedatives such as clobazam, meparbital or zopiclone.

Preferably, the drug is cyclosporine, tacrolimus, rapamycin, docetaxel, erlotinib, cyclophosphamide, tamoxifen, teniposide, vinblastine, gefitinib, vemurafenib, sunitinib, sorafenib, irinotecan, imatinib, ketoconazole, itraconazole, clarithromycin, citalopram, amitriptyline, clomipramine, venlafaxine, risperidone, ziprasidone, alprazolam, midazolam, diazepam, zopiclone, lovastatin, simvastatin, diltiazem, nifedipine, amlodipine, nitrendipine, estradiol, testosterone, progesterone, terfenadine, chlorpheniramine, dexamethasone, hydrocortisone, clopidogrel or warfarin.

Further, the present invention provides a method for analyzing nucleic acid, comprising analyzing a sample to be tested for a nucleic acid comprising a nucleotide sequence corresponding to SEQ ID NO:1 or a nucleotide corresponding to position 1012 in a nucleic acid or a nucleic acid sequence comprising a nucleotide sequence corresponding to SEQ ID NO:2 corresponding to nucleotide 337; preferably, the method is a sequencing method, a restriction fragment length polymorphism assay or a probe hybridization method.

In one embodiment, the method may be restriction fragment length polymorphism analysis (RFLP). One skilled in the art can design experiments to analyze the sequence listing SEQ ID NO:1 or the nucleotide sequence at position 1012 in the nucleic acid of the sequence of SEQ ID NO:2 is a at nucleotide 337 in the nucleic acid of the sequence of seq id No. 2.

In another embodiment, the method may be a sequencing method comprising isolating and determining a nucleic acid sequence from genomic DNA or RNA and analyzing a nucleic acid sequence comprising a nucleotide sequence corresponding to SEQ ID NO:1 or a nucleic acid comprising a nucleotide sequence corresponding to position 1012 of the sequence of SEQ ID NO:2 corresponding to position 337 is a. The sequencing method can be any available sequencing method known in the art. The sequencing primer may be designed according to the common knowledge of those skilled in the art, for example, primers are designed at appropriate positions upstream and downstream of the site to be detected to expand the fragment containing the site to be detected, thereby determining the nucleotide of the site. The oligonucleotides of the invention may also be used as primer sequences.

Further, the invention provides CYP3A4 protein or fragment or variant thereof, wherein the protein sequence is represented by SEQ ID NO: 3; the fragment or variant comprises a sequence corresponding to SEQ id no:3, isoleucine at position 113 of the sequence listing SEQ ID NO:3, such as 10-20, 20-50, or 50-100 amino acids.

Further, the present invention provides a gene of CYP3a4 corresponding to SEQ ID NO:1 or the sequence listing SEQ ID NO:2 for the preparation of a gene panel (gene panel).

The present invention provides CYP3A4 gene and coding sequence containing new single base mutation. The gene is expressed in a gene corresponding to SEQ ID NO:2 from T to A (337T > A), thereby causing the amino acid coded by the nucleotide to be mutated from phenylalanine to isoleucine, namely the nucleotide sequence corresponding to the sequence table SEQ ID NO: isoleucine at position 113 of 3. The mutant CYP3a4 protein (designated F113I) had increased metabolic activity to drugs compared to the wild type. The single base mutation has guiding significance for the administration of individuals carrying the mutation site.

The invention has the advantages that:

1. a method for rapidly amplifying a target gene by using an oligonucleotide fragment is provided.

2. The alleles of the biological sample are rapidly analyzed and suggested for the presence of variation.

3. Activity studies are performed on the variant proteins present and produced, and adjustments to drug use levels can be recommended based on experimental data.

The invention is further described below in conjunction with the drawings and the detailed description, but the following specific examples are for illustrative purposes only and are not intended to limit the invention. Equivalents of the art made in accordance with the present disclosure are intended to be covered by the present invention.

Drawings

FIG. 1 is the sequence listing SEQ ID NO:1, 1012 th nucleotide sequencing map of mutation-containing site

FIG. 2 is a diagram showing the construction of an insect expression vector pFastBac-dual vector

FIG. 3 is a Western result chart of each microsomal expressed protein in example 2

FIG. 4 is a graph of data for testosterone metabolism by each microsome in example 3

FIG. 5 is a graph showing data on the metabolism of nifedipine by each microsome in example 4

Detailed Description

Unless otherwise specified, the "nucleic acid fragment" of the present invention is composed of nucleotides or analogs thereof, and may be a fragment of DNA, RNA or analogs thereof; may be single-stranded or double-stranded; may be natural (e.g. genomic) or synthetic.

In the present invention, the "mutation" refers to the presence of a nucleotide site different from the sequence of the wild-type CYP3A4 gene in the gene to be detected, i.e., CYP3A4 gene. "mutation site" refers to the position at which a base is mutated. In the present invention, the mutation site is a sequence corresponding to SEQ ID NO:1 or the sequence table SEQ ID NO: position 337 in the sequence indicated in FIG. 2.

In the present invention, "allele-specific" refers to specific hybridization with an allele, such as hybridization under stringent conditions, so as to identify a nucleic acid sequence corresponding to SEQ ID NO:1 or the sequence table SEQ ID NO:2 is A at the 337 th nucleotide of the sequence shown in the sequence.

The present disclosure relates to non-synonymous mutations of the CYP3a4 gene. Since the mutation site is located in the coding sequence of the gene, it will be appreciated by those skilled in the art that the mutation site may be expressed in either the genomic DNA or the coding sequence (i.e., CDS, corresponding to the mRNA sequence). The skilled person can, depending on the sample to be tested, detect this mutation site on the genomic DNA or mRNA level. In the present application, the sequence listing SEQ ID NO:1 is a genome DNA sequence which takes the mutation site of the application as the center and is about 1kb before and after the mutation site, namely a sequence table SEQ ID NO:1 is the site of mutation related to the present invention at position 1012. Sequence listing SEQ ID NO:2 is a cDNA sequence of CYP3A4 gene having said mutation site, wherein position 337 is the mutation site related to the present invention. As will be appreciated by those skilled in the art, the sequences herein correspond to those of SEQ id nos: 2 and a nucleotide sequence corresponding to position 337 of the sequence listing SEQ ID NO:1, is used synonymously with the 1012. sup. th site.

In the present invention, the abbreviations for nucleotides and amino acids are used in the manner known in the art, such as nucleotides wherein A represents adenine, G represents guanine, C represents cytosine and T represents thymine. In the amino acids, A represents alanine, R represents arginine, N represents asparagine, D represents aspartic acid, C represents cysteine, Q represents glutamine, E represents glutamic acid, G represents glycine, H represents histidine, I represents isoleucine, L represents leucine, K represents lysine, M represents methionine, F represents phenylalanine, P represents proline, S represents serine, T represents threonine, W represents tryptophan, Y represents tyrosine, and V represents valine.

In the present invention, the sample may be any sample containing nucleic acids, such as blood; preferably the sample is from a human. The nucleic acid may be DNA or coding RNA, preferably genomic DNA. The method for analyzing nucleic acid of the present invention may use DNA or RNA as a target. As known to those skilled in the art, when DNA is used as a detection target, a sample to be tested is analyzed for DNA containing a nucleotide sequence corresponding to SEQ ID NO:1, and the probe or primer used is a probe or primer that is based on the sequence of SEQ ID NO:1, designing a sequence; when RNA is taken as a detection target object, analyzing the RNA in a sample to be detected, wherein the RNA comprises a nucleotide sequence corresponding to SEQ ID NO:2, the probe or primer used is a probe or primer that is based on the nucleotide sequence of SEQ ID NO: 2.

Example 1: identification of novel mutation site of human CYP3A4 gene

In this example, 1114 blood samples of healthy volunteers were collected, genomic DNA in blood was extracted, sequencing primers were designed to amplify and sequence 13 exons of CYP3a4 gene, and the presence of mutation sites in CYP3a4 gene was analyzed.

1. And (3) extracting DNA:

taking 5ml of venous EDTA anticoagulant liquid sample from a tested person; the genomic DNA of the blood sample to be tested is then extracted according to the ordinary salting-out method and/or by using a special DNA extraction kit (DNA extraction kit from Omega, USA).

2. And (3) PCR amplification:

amplification primers were designed to amplify 13 exon sequences of the CYP3a4 gene in the obtained genomic DNA sample. The sequences of the amplification primer pairs are shown in Table 1.

A50 μ LPCR reaction system was used, comprising: 1 XPCR buffer, 1.5mM MgCl ₂100 to 150ng of genomic DNA and 0.2. mu. M, dNTP of 0.4mM for both upstream and downstream primers, and 1.5U of LATaq DNA polymerase from TaKaRa. The PCR amplification cycle parameters were as follows: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30 sec, annealing at 30 sec, extension at 72 ℃ for 2min and 30 sec, and re-extension after 30 cycles for 5 min. The annealing temperature is related to the length of the primer, and the specific temperature is shown in Table 1.

The amplification was carried out using a GeneAmp PCR System 9700 amplification apparatus from ABI, USA.

Table 1: sequencing primer pair and annealing temperature

3. And (3) purifying an amplification product:

50 μ l of PCR amplification product was separated by agarose gel electrophoresis, and the band of interest was excised with a razor blade. The DNA of the target band was recovered and purified according to the E.Z.N.A. gel recovery kit (Omega).

4. Sequencing:

the recovered product is used as a template, sequencing PCR reaction is carried out by using a sequencing primer according to the requirements of an CEQTM DTCS-Quick Start Kit sequencing Kit (Beckman company, USA), and after the reaction is finished and purified, the sequence of the amplification product is judged by separating by using a CEQ8000 type gene sequencer of Beckman company, USA. The sequencing primers are shown in Table 2.

Table 2: sequencing primer

5) And (3) data analysis:

the determined sequence was aligned with the wild-type CYP3a4 x 1 sequence (GenBank accession No. NM — 017460.5).

By alignment analysis, the 337 th nucleotide of the coding region of the CYP3A4 gene was found to be changed from T to A (as shown in FIG. 1, where M represents A or T), and the mutation was located in exon 5 of the CYP3A4 gene. Accordingly, it was concluded that in the protein encoded by the CYP3A4 gene, the 113 th amino acid was mutated from phenylalanine (F) to isoleucine (I). This mutation has been named by the P450 naming committee as the new allele CYP3a4 x 29, but has not been published externally.

Methods for identifying new mutation sites are presented in this example. From the above, it is clear for those skilled in the art to specifically detect the presence of a nucleic acid sequence corresponding to SEQ ID NO:1 at nucleotide 1012: the nucleic acids in the sample were isolated and the amplification reaction was carried out under the experimental conditions corresponding to this example, using primers to the primers shown in SEQ ID NO: 10 and 11; sequencing primer sequence table SEQ ID NO: 25 sequencing the amplified product; comparing the sequencing result with the wild type result, and analyzing the sequence corresponding to the sequence table SEQ ID NO:1 at position 1012.

Example 2: expression of target genes

The Open Reading Frames (ORFs) of CYP3a4 × 4, CYP3a4 × 5, CYP3a4 × 18 and the F113I mutant of the present invention were obtained using site-directed mutagenesis with a plasmid vector (presented by professor peritrexate peak of university of south florida, usa) to which the open reading frame of wild-type CYP3a4 × 1 was ligated, as a template, respectively. Site-directed mutagenesis techniques are well known in the art and one skilled in the art would know without doubt how to accomplish this step based on the defined template and target.

Then, the CYP3A4 x 1 gene and ORFs of the four mutant genes subjected to site-directed mutagenesis are cloned into a vector pFastBac-dual connected with cytochrome P450 Oxidoreductase (OR), so that the CYP3A4 gene and the OR are respectively placed in PH and P10 promoters, and a double expression vector for simultaneously expressing the OR and the CYP3A4 (OR mutants thereof) is constructed. The structure of the pFastBac-dual vector and the insertion sites of the CYP3A4 gene and OR are shown in FIG. 2. A vector containing no CYP3A4 gene but only OR gene was used as a negative control vector (pOR).

According to the use instruction of Bac-to-Bac baculovirus expression system kit (purchased from Invitrogen company in America, and used for expressing a large amount of exogenous target genes in insect cells), constructed double expression vectors and control vectors are used for packaging insect viruses of P1 generation and P2 generation respectively, and the obtained viruses of P2 generation are used for measuring the titer and then infecting sf21 insect cells according to the infection amount of MOI (multiple-of-infection) of 4. After 72 hours of infection, the cells were collected by centrifugation, disrupted by ultrasonication using an ultrasonicator (SONIC) at 40% energy, and the insect cell microsomes were extracted by differential centrifugation. Detecting the expression level of CYP3A4 and OR in each microsome by using a Western method; the obtained microsomes were quantified by CO differential method using CYP3A4 standard (STD, BD Gentest, USA).

The Western results are shown in FIG. 3. The first row shows the amount of CYP3A4 expression, and the second row shows the amount of OR expression. It can be seen from the figure that the control vector po r only expressed the OR protein, that 5 double expression vectors all expressed the OR protein, and that 1, 4, 18-type CYP3a4 and the F113I protein of the invention, respectively.

Enzyme metabolic activity assay

According to the results of the present study, the metabolic activity of the wild type (type x 1) was higher for each drug, while the metabolic activity of type x 4 was significantly lower than that of the wild type, and the metabolic activity of type x 18 was higher than that of type x 1. Thus, there is a consensus in the art that: the metabolic activity of an enzyme expressed by the same genotype on a specific substrate may represent the metabolic activity on other substrate drugs. Thus, the metabolic activity of an enzyme expressed by a certain genotype on a specific substrate can be analogized from the metabolic activity data of the enzyme expressed by that genotype on other substrate drugs (e.g., the metabolic activity of the enzyme expressed by that genotype can be compared with the metabolic activity of the enzyme expressed by the wild-type).

Example 3: in vitro analysis of testosterone Metabolic Properties Using obtained insect microsomes

1. Chromatographic conditions are as follows: the column was a ZORBAX SB-C18 column (2.1 x 150mm, 5-Micron, Agilent, USA); the mobile phase is 0.05% TFA and acetonitrile which are 55: 45; the column temperature was 35 ℃; the detection wavelength is as follows: 240 nm.

2. Incubation conditions were as follows:

the total reaction volume was 200. mu.L, which included: 100mM Tris-HCl (pH 7.4), 1 XNADPH coenzyme production system (Promega, USA), 2pmol cytochrome b5 and diclofenac (purchased from Sigma, USA, and the final concentration of the reaction is 1-100. mu.M). After preincubation at 37 ℃ for 5min, 2-5pmol of recombinant microsomes constructed in example 2 (expressing x 1, x4, x5, x18 type CYP3a4, respectively, F113I of the present invention) were added to initiate the reaction. After incubation at 37 ℃ for 20min, 50. mu. L0.1M HCl and 20. mu.L of 25 ng/. mu.L internal standard desipramine (from Sigma, USA) were added and vortexed for 2 min. Add 800. mu.L of ethyl glacial acetate and vortex for 2min, centrifuge at 10,000 Xg for 5min at 4 ℃. The organic layer was carefully transferred, blown dry under nitrogen blower, 100. mu.L of mobile phase was added for redissolution and 20. mu.L was taken and examined by Agilent model 1260 HPLC. The results of the Michaelis-Menten data analysis of this example are shown in FIG. 4. Further pharmacokinetic analysis was performed.

3. The results are shown in Table 3:

table 3: results of pharmacokinetic analysis of Each microsomal metabolizing Testosterone

Wherein Vmax represents the maximum reaction rate (the larger the value is, the higher the catalytic efficiency is), Km is the Michaelis constant (the larger the value is, the lower the catalytic efficiency is), Vmax/Km reflects the overall drug clearance rate, and for comprehensive assessment index, the higher the value is, the stronger the overall enzymatic activity of the mutant is, the faster the drug metabolism rate is, the larger the drug requirement of the individual carrying the mutant is, otherwise, the phenomena of unobvious drug effect and the like are easy to occur.

As can be seen from fig. 4 and table 3, the overall enzymatic activity of F113I of the present invention was significantly higher than that of the wild type x 1 type and also higher than that of the mutant type x 4, x 18 type.

Example 4: in-vitro analysis of metabolic properties of nifedipine by using obtained insect microsomes

1. Chromatographic conditions are as follows: the column was a ZORBAX SB-C18 column (2.1 x 150mm, 5-Micron, Agilent, USA); the mobile phase is 0.1% TFA, water and acetonitrile which are 20: 40; the column temperature was 40 ℃; the detection wavelength is as follows: 230 nm.

2. Incubation conditions were as follows:

the total reaction volume was 200. mu.L, which included: 100mM Tris-HCl (pH 7.4), 1 XNADPH coenzyme production system, 10pmol cytochrome b5 and tolbutamide (purchased from Sigma, USA, 10-1000. mu.M final concentration). After preincubation at 37 ℃ for 5min, 10-20pmol of recombinant microsomes constructed in example 2 was added to initiate the reaction. After incubation at 37 ℃ for 60min, 40. mu.L of 0.1M HCl and 50. mu.L of 20 ng/. mu.L internal standard chlorpropamide (from Sigma, USA) were added and vortexed for 2 min. Add 800. mu.L of ethyl glacial acetate and vortex for 2min, centrifuge at 10,000 Xg for 5min at 4 ℃. The organic layer was carefully transferred, blown dry under nitrogen blower, 100. mu.L of mobile phase was added for redissolution and 20. mu.L was taken for detection on Waters' model e2695 HPLC. The results of the Michaelis-Menten data analysis of this example are shown in FIG. 5. Further pharmacokinetic analysis was performed.

3. The results are shown in Table 4:

table 4: pharmacokinetic analysis result of nifedipine metabolized by each microsome

As can be seen from fig. 5 and table 4, the overall enzymatic activity of F113I of the present invention was significantly higher than that of the wild type × 1 and mutant × 4 types, and the × 18 type.

As can be seen from the above examples, the metabolic activity of the F113I mutant enzyme of the present invention was entirely higher than that of the wild type, type 1, type 4, type 18. Therefore, in practice, it is necessary to consider the appropriate adjustment of the dosage for the individual carrying the genotype, such as increasing the drug usage, so that the drug is in steady state blood concentration and the therapeutic effect is better exerted. This gene-directed drug modulation is more important for drugs that treat window stenosis (e.g., warfarin, clopidogrel, etc.).

Sequence listing

<110> Wenzhou university of medical science

<120> CYP3A4 gene segment containing 337T > A mutation, coded protein segment and application thereof

<130>

<160>40

<170>PatentIn version 3.5

<210>1

<211>2039

<212>DNA

<213> genus, species

<400>1

atatgccttg agattttaca cattgtcagt tatgtcactt gaaaatagag acaattcttt 60

tatttccttt ccaatctgta tgccttttat ttcttttctt ttgtctattg cactaggact 120

tcccagtata atgttgagta aatgtggtga atttttgaat tgttcctaat cttaggaggg 180

aagccttcag ttctttcatc attaagcatc atttagatga agtgggctgt ttttttgtag 240

attctcttta tcaaattgag gaattttctc tccctagttt gctgagtttt tatcataaat 300

gaatgctgga agtactcatt ataaaaaaaa tggctatgga agatgaaaga aagtttcaag 360

catgttggct tgataggcca gttccaagtt ggcaaaaata attatctctt ttttctttct 420

atccatgaaa taaaaaatta agagacaaga atgtttatgg aattgcatta tttcttcaaa 480

atatgttcct agttttaaag gtattaccta ctattttttt taaaaccatc acattgaggc 540

acttcttttt cacgttgccc atgctgcagg agaacataaa gacagcttgt ctgaggcaac 600

atacaatcca ccaaagtcac ctgcttgtct gtctccactc cgtctctaca ctgcagaagt 660

gctaggtctt gattctgttt attgtactgg aagaacacat tctctaccac gtggataatt 720

tgcatgtaaa agaagactgg gatatagagg ctggagacga catcagggtc tcctgaacac 780

tgccgccacc cccccgcccc gccccacaca aatacatccc aggacactgg gcatctggga 840

taaatctcta ttgagcatct agcatagggc ccatcaccca gtagacagtc actaaatagt 900

tgttgaataa gtgttcctgt ttaacacatt ttctacaacc atggagacct ccacaactga 960

tgtaggacaa aatgtttctg ctttgaactc tagccttttg gtccagtggg aattatgaaa 1020

agtgccatct ctatagctga ggatgaagaa tggaagagat tacgatcatt gctgtctcca 1080

accttcacca gtggaaaact caaggaggta tgaaaataac atgagtttta ataagaaact 1140

taaagaatga atctggtggg gacaggtata aaataagatc acagtccctt tccaaggggt 1200

agtccactga atttgagctg cctaaaaatg gtcttttatc tttatgtaca gaaaacacat 1260

cacaaaattc attataaaat gtcacttact gctccatgct ggggaaagcc atgtccttct 1320

gggactagag tctgcacatt taactatggg tggtgttgtg ttttgtgctt agatggtccc 1380

tatcattgcc cagtatggag atgtgttggt gagaaatctg aggcgggaag cagagacagg 1440

caagcctgtc accttgaaag agtaagtaga agcgcagcca tggggttctg agctgtcatg 1500

aacccctcca gctgcctgcc atggagctga tattcctgct gttgggttat tccagtgacc 1560

agacaaaagg agggctgtgg taatgcaact tcaatgggtc tcccaagatg gggcagctcc 1620

gatgaggagg tggggcagct ggaggaaaag gatcttctcc cctgtgcaca ggggccaggg 1680

tttacatatc cattaaattg tcaccttgga tattctagaa gactaaatat atcctttagg 1740

gggaaaaagt gtgattgtac caaagtttta agcatggagt gtatgggatg gtggaagggg 1800

aaggcacttg gtatctgttg gttggcagtg agtaggttgg gagagttata atggagaact 1860

tagaataact ttgatcattt catgtttttt tctgaggata tcagtagaat actaaatatt 1920

aaaattccta ccatttcttt ttcctccagt ctcaaagaga gagggtggta aaaacactat 1980

aggtagggca agcctattat ttgctatcta cacttatgca gtaaaaacag gtgtaatct 2039

<210>2

<211>1512

<212>DNA

<213> genus, species

<400>2

atggctctca tcccagactt ggccatggaa acctggcttc tcctggctgt cagcctggtg 60

ctcctctatc tatatggaac ccattcacat ggacttttta agaagcttgg aattccaggg 120

cccacacctc tgcctttttt gggaaatatt ttgtcctacc ataagggctt ttgtatgttt 180

gacatggaat gtcataaaaa gtatggaaaa gtgtggggct tttatgatgg tcaacagcct 240

gtgctggcta tcacagatcc tgacatgatc aaaacagtgc tagtgaaaga atgttattct 300

gtcttcacaa accggaggcc ttttggtcca gtgggaatta tgaaaagtgc catctctata 360

gctgaggatg aagaatggaa gagattacga tcattgctgt ctccaacctt caccagtgga 420

aaactcaagg agatggtccc tatcattgcc cagtatggag atgtgttggt gagaaatctg 480

aggcgggaag cagagacagg caagcctgtc accttgaaag acgtctttgg ggcctacagc 540

atggatgtga tcactagcac atcatttgga gtgaacatcg actctctcaa caatccacaa 600

gacccctttg tggaaaacac caagaagctt ttaagatttg attttttgga tccattcttt 660

ctctcaataa cagtctttcc attcctcatc ccaattcttg aagtattaaa tatctgtgtg 720

tttccaagag aagttacaaa ttttttaaga aaatctgtaa aaaggatgaa agaaagtcgc 780

ctcgaagata cacaaaagca ccgagtggat ttccttcagc tgatgattga ctctcagaat 840

tcaaaagaaa ctgagtccca caaagctctg tccgatctgg agctcgtggc ccaatcaatt 900

atctttattt ttgctggcta tgaaaccacg agcagtgttc tctccttcat tatgtatgaa 960

ctggccactc aacctgatgt ccagcagaaa ctgcaggagg aaattgatgc agttttaccc 1020

aataaggcac cacccaccta tgatactgtg ctacagatgg agtatcttga catggtggtg 1080

aatgaaacgc tcagattatt cccaattgct atgagacttg agagggtctg caaaaaagat 1140

gttgagatca atgggatgtt cattcccaaa ggggtggtgg tgatgattcc aagctatgct 1200

cttcaccgtg acccaaagta ctggacagag cctgagaagt tcctccctga aagattcagc 1260

aagaagaaca aggacaacat agatccttac atatacacac cctttggaag tggacccaga 1320

aactgcattg gcatgaggtt tgctctcatg aacatgaaac ttgctctaat cagagtcctt 1380

cagaacttct ccttcaaacc ttgtaaagaa acacagatcc ccctgaaatt aagcttagga 1440

ggacttcttc aaccagaaaa acccgttgtt ctaaaggttg agtcaaggga tggcaccgta 1500

agtggagcct ga 1512

<210>3

<211>503

<212>PRT

<213> genus, species

<400>3

Met Ala Leu Ile Pro Asp Leu Ala Met Glu Thr Trp Leu Leu Leu Ala

1 5 10 15

Val Ser Leu Val Leu Leu Tyr Leu Tyr Gly Thr His Ser His Gly Leu

20 25 30

Phe Lys Lys Leu Gly Ile Pro Gly Pro Thr Pro Leu Pro Phe Leu Gly

35 40 45

Asn Ile Leu Ser Tyr His Lys Gly Phe Cys Met Phe Asp Met Glu Cys

5055 60

His Lys Lys Tyr Gly Lys Val Trp Gly Phe Tyr Asp Gly Gln Gln Pro

65 70 75 80

Val Leu Ala Ile Thr Asp Pro Asp Met Ile Lys Thr Val Leu Val Lys

85 90 95

Glu Cys Tyr Ser Val Phe Thr Asn Arg Arg Pro Phe Gly Pro Val Gly

100 105 110

Ile Met Lys Ser Ala Ile Ser Ile Ala Glu Asp Glu Glu Trp Lys Arg

115 120 125

Leu Arg Ser Leu Leu Ser Pro Thr Phe Thr Ser Gly Lys Leu Lys Glu

130 135 140

Met Val Pro Ile Ile Ala Gln Tyr Gly Asp Val Leu Val Arg Asn Leu

145 150 155 160

Arg Arg Glu Ala Glu Thr Gly Lys Pro Val Thr Leu Lys Asp Val Phe

165 170 175

Gly Ala Tyr Ser Met Asp Val Ile Thr Ser Thr Ser Phe Gly Val Asn

180 185 190

Ile Asp Ser Leu Asn Asn Pro Gln Asp Pro Phe Val Glu Asn Thr Lys

195 200 205

Lys Leu Leu Arg Phe Asp Phe Leu Asp Pro Phe Phe Leu Ser Ile Thr

210 215220

Val Phe Pro Phe Leu Ile Pro Ile Leu Glu Val Leu Asn Ile Cys Val

225 230 235 240

Phe Pro Arg Glu Val Thr Asn Phe Leu Arg Lys Ser Val Lys Arg Met

245 250 255

Lys Glu Ser Arg Leu Glu Asp Thr Gln Lys His Arg Val Asp Phe Leu

260 265 270

Gln Leu Met Ile Asp Ser Gln Asn Ser Lys Glu Thr Glu Ser His Lys

275 280 285

Ala Leu Ser Asp Leu Glu Leu Val Ala Gln Ser Ile Ile Phe Ile Phe

290 295 300

Ala Gly Tyr Glu Thr Thr Ser Ser Val Leu Ser Phe Ile Met Tyr Glu

305 310 315 320

Leu Ala Thr Gln Pro Asp Val Gln Gln Lys Leu Gln Glu Glu Ile Asp

325 330 335

Ala Val Leu Pro Asn Lys Ala Pro Pro Thr Tyr Asp Thr Val Leu Gln

340 345 350

Met Glu Tyr Leu Asp Met Val Val Asn Glu Thr Leu Arg Leu Phe Pro

355 360 365

Ile Ala Met Arg Leu Glu Arg Val Cys Lys Lys Asp Val Glu Ile Asn

370 375380

Gly Met Phe Ile Pro Lys Gly Val Val Val Met Ile Pro Ser Tyr Ala

385 390 395 400

Leu His Arg Asp Pro Lys Tyr Trp Thr Glu Pro Glu Lys Phe Leu Pro

405 410 415

Glu Arg Phe Ser Lys Lys Asn Lys Asp Asn Ile Asp Pro Tyr Ile Tyr

420 425 430

Thr Pro Phe Gly Ser Gly Pro Arg Asn Cys Ile Gly Met Arg Phe Ala

435 440 445

Leu Met Asn Met Lys Leu Ala Leu Ile Arg Val Leu Gln Asn Phe Ser

450 455 460

Phe Lys Pro Cys Lys Glu Thr Gln Ile Pro Leu Lys Leu Ser Leu Gly

465 470 475 480

Gly Leu Leu Gln Pro Glu Lys Pro Val Val Leu Lys Val Glu Ser Arg

485 490 495

Asp Gly Thr Val Ser Gly Ala

500

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

ggctgggacc atcttactgg 20

<210>5

<211>22

<212>DNA

<213> Artificial sequence

<400>5

ccaacactta agctactgct cc 22

<210>6

<211>20

<212>DNA

<213> Artificial sequence

<400>6

agtggctgca gtgatgcaaa 20

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<400>7

ctctgtgcag tggggtaaac t 21

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<400>8

cgtatgcacc acccagctta 20

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<400>9

ggagccacat ggagacagag 20

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<400>10

tggagacgac atcagggtct 20

<210>11

<211>20

<212>DNA

<213> Artificial sequence

<400>11

gcattaccac agccctcctt 20

<210>12

<211>20

<212>DNA

<213> Artificial sequence

<400>12

ctccatcaca cccagcgtag 20

<210>13

<211>20

<212>DNA

<213> Artificial sequence

<400>13

gtaggtgatc cacagaccgc 20

<210>14

<211>20

<212>DNA

<213> Artificial sequence

<400>14

tggcccacat tctcgaagac 20

<210>15

<211>22

<212>DNA

<213> Artificial sequence

<400>15

gcagaatatg cttgaaccag gc 22

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<400>16

agtgtggaca catcaccacc 20

<210>17

<211>20

<212>DNA

<213> Artificial sequence

<400>17

tggttgggaa gagcagcatt 20

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<400>18

ttgagaggtt ccccacttgc 20

<210>19

<211>20

<212>DNA

<213> Artificial sequence

<400>19

ggtctctggt gttctcaggc 20

<210>20

<211>22

<212>DNA

<213> Artificial sequence

<400>20

atctttacct atgcctggag tg 22

<210>21

<211>20

<212>DNA

<213> Artificial sequence

<400>21

ggcctgatta gcaccccaag 20

<210>22

<211>22

<212>DNA

<213> Artificial sequence

<400>22

ttcttgcctt aatgttacct cg 22

<210>23

<211>20

<212>DNA

<213> Artificial sequence

<400>23

ttccctggtg tctgtaactt 20

<210>24

<211>18

<212>DNA

<213> Artificial sequence

<400>24

aacagaaatg agggcaca 18

<210>25

<211>20

<212>DNA

<213> Artificial sequence

<400>25

gcccatcacc cagtagacag 20

<210>26

<211>18

<212>DNA

<213> Artificial sequence

<400>26

tggcacctga taacacct 18

<210>27

<211>18

<212>DNA

<213> Artificial sequence

<400>27

ggggctgctg atctcact 18

<210>28

<211>18

<212>DNA

<213> Artificial sequence

<400>28

gtcgttctgc tatgtggc 18

<210>29

<211>19

<212>DNA

<213> Artificial sequence

<400>29

tctgccagta gcaaccatt 19

<210>30

<211>18

<212>DNA

<213> Artificial sequence

<400>30

agcaatgggc atgacagt 18

<210>31

<211>19

<212>DNA

<213> Artificial sequence

<400>31

ttcaatgacc agcccacaa 19

<210>32

<211>20

<212>DNA

<213> Artificial sequence

<400>32

cagtttgcca tcatacctaa 20

<210>33

<211>16

<212>DNA

<213> genus, species

<400>33

gtgggaatta tgaaaa 16

<210>34

<211>22

<212>DNA

<213> genus, species

<400>34

ccagtgggaa ttatgaaaag tg 22

<210>35

<211>29

<212>DNA

<213> genus, species

<400>35

ttggtccagt gggaattatg aaaagtgcc 29

<210>36

<211>37

<212>DNA

<213> genus, species

<400>36

gccttttggt ccagtgggaa ttatgaaaag tgccatc 37

<210>37

<211>44

<212>DNA

<213> genus, species

<400>37

tagccttttg gtccagtggg aattatgaaa agtgccatct ctat 44

<210>38

<211>49

<212>DNA

<213> genus, species

<400>38

ccttttggtccagtgggaat tatgaaaagt gccatctcta tagctgagg 49

<210>39

<211>33

<212>DNA

<213> genus, species

<400>39

ccagtgggaa ttatgaaaag tgccatctct ata 33

<210>40

<211>54

<212>DNA

<213> genus, species

<400>40

tttggtccag tgggaattat gaaaagtgcc atctctatag ctgaggatga agaa 54

Claims (4)

1. The nucleic acid fragment is a nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2, or a complementary sequence of the nucleic acid sequence.

2. A kit for detecting mutations in CYP3a4 gene, comprising the nucleic acid fragment of claim 1.

3. Use of the nucleic acid fragment of claim 1 for detecting mutations in the CYP3a4 gene.

The CYP3A4 protein has a sequence shown in SEQ ID NO. 3.

Images