CN106568975A - Concentration detection method of plurality of target molecules - Google Patents
Concentration detection method of plurality of target molecules Download PDFInfo
- Publication number
- CN106568975A CN106568975A CN201610956612.7A CN201610956612A CN106568975A CN 106568975 A CN106568975 A CN 106568975A CN 201610956612 A CN201610956612 A CN 201610956612A CN 106568975 A CN106568975 A CN 106568975A
- Authority
- CN
- China
- Prior art keywords
- probe
- target molecules
- magnetic bead
- various
- molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/533—Production of labelled immunochemicals with fluorescent label
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/137—Metal/ion, e.g. metal label
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/143—Magnetism, e.g. magnetic label
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/149—Particles, e.g. beads
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a concentration detection method of a plurality of target molecules The concentration detection method comprises following steps: S1, corresponding first probe molecules of the plurality of target molecules are coupled with magnetic beads so as to obtain magnetic bead probes, and corresponding second probe molecules of the plurality of target molecules are coupled with the surfaces of a plurality of different labeled particles so as to obtain a plurality of labeled probes; S2, target molecule-magnetic bead probe compounds are prepared; S3, magnetic bead probe-target molecule-labeled probe compounds are prepared; S4, the unreacted labeled probes are removed; S5, an eluent is delivered into a reaction vessel used in step S4 so as to realize structure dissociation of the magnetic bead probe-target molecule-labeled probe compounds; S6, a silicane solution containing one or a plurality of groups selected from amino, carboxyl, hydrosulfuryl, and hydroxyl is adopted for surface modification of glass slides; and S7, the concentration of the target molecules is calculated. The concentration detection method can be used for realizing high throughput detection of the concentration of the plurality of target molecules, and is high in sensitivity.
Description
【Technical field】
The present invention relates to biological detecting method, more particularly to a kind of while the method for detecting various concentration of target molecules.
【Background technology】
Diagnosis and treatment (especially disease develop early stage), antibacterial of highly sensitive, the high-throughout biological detection in disease
It is significant in Viral diagnosis and clinical basic.Highly sensitive characteristic refers to low-down in concentration of target molecules
In the case of, detected reliablely；And high-throughout characteristic refer to can once while detecting the relatively low target of various concentration
Molecule, had both shortened the time of detection, reduced the cost of detection again, both of the above be in outstanding biological detecting method not
The characteristic that can or lack.At present, the characteristics of many detection methods more pursue high sensitivity and cannot be while meeting high-throughout
Require.The highly sensitive Detection Techniques based on single-molecule detection as caused people's greatly concern in recent years, the technology is expected in inspection
Survey in sensitivity, significantly the detection pattern based on fluorescence intensity signals of beyond tradition.However, common single-molecule detection technology
It is difficult to while determining various target molecules, it is impossible to meet high-throughout requirement, and the technology generally requires the instrument support of costliness,
Confocal fluorescent microscope, the utilizing total internal reflection fluorescence microscope of single photon detection ability are such as configured with, the often mistake on cost
In costliness, in being difficult to apply to actual highly sensitive detection.The concentration of target molecules inspection proposed in patent application CN105132533A
Survey method, for during Single Molecule Detection with higher sensitivity, but while when detecting various target molecules, it is impossible to realize well
The specific detection of various target molecules.
【The content of the invention】
The technical problem to be solved is：Above-mentioned the deficiencies in the prior art are made up, proposes that a kind of many target molecules are dense
Degree detection method, is capable of achieving the concentration of the various target molecules of high throughput testing, and sensitivity is also higher.
The technical problem of the present invention is solved by following technical scheme：
A kind of many concentration of target molecules detection methods, comprise the following steps：
S1, each self-corresponding first probe molecule of various target molecules is coupled on magnetic bead, forms magnetic bead probe；Will be various
Each self-corresponding second probe molecule of target molecule is coupled to respectively various different label particles surfaces, forms various labellings and visits
Pin；Various different label particles can be distinguished from each other out when being observed；
S2, in reaction vessel, the solution of the magnetic bead probe and various target molecules is mixed, various target molecules with
Corresponding first probe molecule reaction, various target molecules are caught into the surface of the magnetic bead probe and form target molecule-magnetic
Pearl probe complex；
S3, the various label probes are added in the reaction vessel after step S2, various target molecules and phase
The second probe molecule answered is combined, and forms magnetic bead probe-target molecule-label probe complex；
Or respectively by step S2, S3 replaces with following steps S2 ', S3 ',
S2 ', in reaction vessel, the solution of the mixed liquor of various label probes and various target molecules is mixed, various targets
Molecule reacts with corresponding second probe molecule, and various target molecules are captured separately to the surface of various label probes；
S3 ', by the magnetic bead probe add through step S2 ' after reaction vessel in, various target molecules respectively with accordingly
The first probe molecule combine, formed magnetic bead probe-target molecule-label probe complex；
S4, the label probe for having neither part nor lot in reaction is removed；
S5, in the reaction vessel after step S4 eluent is added so that the magnetic bead probe-target molecule-labelling
Probe complex recurring structure dissociates, and is dissociated into the magnetic bead probe, the target molecule and various label probes；
S6, by carrying out to microscope slide comprising one or more the solution of silane in amino, carboxyl, sulfydryl, hydroxyl
Surface modification, the surface for making the microscope slide forms one layer of self-assembled film；
S7, draws the solution after step S5 and makes sample on the microscope slide processed through step S6, micro-
Various label probes are counted under mirror and is calculated the quantity of various label probes in the solution, visited by each labelling
The quantity of pin calculates the concentration of corresponding target molecule.
The beneficial effect that the present invention is compared with the prior art is：
Many concentration of target molecules detection methods of the present invention, when the concentration to various target molecules is detected, will be different
Label particles are combined correspondingly with corresponding target molecule, follow-up dissociation.Coordinate the solution of silane comprising special groups to carrying
Slide is modified, and on the surface of microscope slide one layer of self-assembled film is formed, and the surface exposure of slide goes out above-mentioned specific chemical base
Group so that microscope slide show in aqueous it is certain electrical or can with label probe by group association reaction, so,
When the solution comprising label probe makes sample on microscope slide, label probe middle probe is tied by electrical attraction or group
Close reaction and be fixed on microscope slide.So, the corresponding label particles of each target molecule are fixed respectively, mutual to affect less, very
The specific detection of target molecule is ensure that well, so as to guarantee the oversoul of each single target molecule while high throughput testing is realized
Quick detection.Used in the present invention various label particles can with the overdelicate biological detection of high flux, when detecting to various target molecules,
Detectable concentration lower limit can as little as 3 × 10-18mol/L。
【Description of the drawings】
Fig. 1 is the Cleaning Principle flow chart of the detection method of the specific embodiment of the invention；
Fig. 2 a be the specific embodiment of the invention detection method in gold nanosphere transmission electron microscope figure；
Fig. 2 b be the specific embodiment of the invention detection method in gold/silver composite nano particles transmission electron microscope
Figure；
Fig. 2 c be the specific embodiment of the invention detection method in gold nanorods transmission electron microscope figure；
Fig. 3 be the specific embodiment of the invention detection method in magnetic bead probe-target molecule-label probe for obtaining answer
The SEM figures of compound；
Fig. 4 a are image of the gold nanorods in dark field microscope in the specific embodiment of the invention；
Fig. 4 b are image of the gold nanosphere in dark field microscope in the specific embodiment of the invention；
Fig. 4 c are image of the gold/silver composite nano particles in dark field microscope in the specific embodiment of the invention；
Fig. 4 d are gold nanorods in the specific embodiment of the invention, gold nanosphere and gold/silver composite nano particles while depositing
When image in dark field microscope；
Fig. 5 a are the graphs of a relation of the concentration of HIV and actual detection number in the specific embodiment of the invention；
Fig. 5 b are the graphs of a relation of the concentration of HBV and actual detection number in the specific embodiment of the invention；
Fig. 5 c are the graphs of a relation of the concentration of HPV and actual detection number in the specific embodiment of the invention；
Fig. 6 is that the detection method of the specific embodiment of the invention is detected to 7 samples comprising different target molecules
Result schematic diagram.
【Specific embodiment】
With reference to specific embodiment and compare accompanying drawing the present invention is described in further details.
The method that this specific embodiment provides a kind of various concentration of target molecules of detection, to detect three kinds of target molecules as a example by enter
Row explanation, comprises the steps：
(1) the first probe molecule of three kinds of target molecules is coupled to into same magnetic bead surfaces simultaneously and forms magnetic bead probe (i.e.
Probe I, II, III is coupled on same magnetic bead A simultaneously), the second probe molecule of the first target molecule is coupled to into first
Plant label particles surface and form the first label probe, the second probe molecule of second target molecule is coupled to into second labelling grain
Sublist face forms the second label probe, and the second probe molecule of the third target molecule is coupled to into the third label particles surface shape
Into the 3rd label probe.
Or the step (1) is replaced with into following steps (1 '),
(1 ') is coupled with the first probe molecule of three kinds of target molecules on three groups of different magnetic beads, correspondence on every group of magnetic bead
A kind of first probe of target molecule, forms magnetic bead probe, will probe I be coupled on magnetic bead A, probe II is coupled on magnetic bead B,
Probe III is coupled on magnetic bead C.Second probe molecule of the first target molecule is coupled to into the first label particles surface to be formed
First label probe, is coupled to the second probe molecule of second target molecule second label particles surface and forms the second labelling
Probe, is coupled to the second probe molecule of the third target molecule the third label particles surface and forms the 3rd label probe.
Above-mentioned target molecule can be DNA molecular or protein molecule.Label particles are under the microscope can be with single counting
Particle.Various different label particles are：In noble metal nano particles, fluorescent microsphere, quantum dot, upper conversion nano crystalline substance not
Combination of the same race.Preferably, various different label particles are various noble metal nano particles (such as gold nanosphere, gold nano
Rod, silver nanoparticle ball, gold/silver composite nano particles etc.), and the local surface plasma resonance peak of various noble metal nano particles
Position difference more than 50nm.The absorption cross-section and scattering section of noble metal nano particles is higher by 3-5 than common organic fluorescence molecule
Individual magnitude, with high signal to noise ratio, each other peak position difference 50nm, can so better discriminate between different label probes,
And then distinguish different target molecules to be detected.
(2) in reaction vessel, by the solution mixing of the magnetic bead probe and three kinds of target molecules, three kinds of target molecules with
The corresponding first probe molecule reaction, three kinds of target molecules are caught into the surface of the magnetic bead probe and form target point
Son-magnetic bead probe complexes.
Preferably, it is joint efficiency of the mitigation two of which target molecule to another kind of target molecule magnetic bead probe corresponding to its
Affect, the step is arranged on quickly to be rocked or softly carry out under the environment of ultrasound, and it is 30r/min-60r/min to rock speed,
Supersonic frequency is 10KHz-30KHz.So both increased target molecule and corresponding magnetic bead probe to meet the chance of collision, it is also possible to drop
The mispairing probability of low only Individual base pairing.
(3) first, second and third label probe is added into the reaction vessel, three kinds of target molecules with it is corresponding
Second probe molecule combine, formed magnetic bead probe-target molecule-label probe complex.
Similarly, it is to mitigate two of which label probe to another kind of label probe target molecule-magnetic bead probe corresponding to its
Joint efficiency impact, the step be also disposed at quickly rocking or the environment of soft ultrasound under carry out, rocking speed is
30r/min-60r/min, supersonic frequency is 10KHz-30KHz.Target molecule was so both increased and had met with corresponding magnetic bead probe and touched
The chance hit, it is also possible to reduce the mispairing probability for there was only Individual base pairing.
Or respectively the step (2) and (3) replaced with into following steps (2 ') and (3 '),
(2 ') in reaction vessel, by the mixed liquor of first, second and third label probe and three kinds of target molecules
Solution mixes, and three kinds of target molecules react with corresponding second probe molecule, and three kinds of target molecules are captured respectively
To the surface of first, second and third label probe.
Similarly, it is to mitigate the impact for causing joint efficiency to decline each other, the step is also quickly rocked in same
Or carry out under the environment of soft ultrasound.
The magnetic bead probe is added the reaction vessel by (3 '), and three kinds of target molecules are respectively with corresponding described first
Probe molecule is combined, and forms magnetic bead probe-target molecule-label probe complex.
Similarly, it is to mitigate the impact for causing joint efficiency to decline each other, the step is also quickly rocked in same
Or carry out under the environment of soft ultrasound.
The addition number of the magnetic bead probe in above-mentioned steps (2) or step (3 '), is such as through step (1), then
For 105-107It is individual, such as it is that then the number of every group of magnetic bead is 10 through step (1 ')5-107It is individual.
The addition number of the three kinds of label probes in step (3) or step (2 ') is respectively 1010-1012It is individual.
Preferably, when carrying out according to the order of step (2) and step (3), after the reaction of the step (2) terminates,
Also comprise the steps, the step (3) is then carried out again：A () introduces Magnet on the outside of the reaction vessel, make the target point
Son-magnetic bead probe complexes are assembled in the Magnet side, draw the liquid in the reaction vessel and do not take away the target point
Son-magnetic bead probe complexes.The cumulative volume of reaction system can be reduced after step (a), step (3) is then carried out again,
The efficiency of subsequent reactions can further be lifted.
(4) label probe for having neither part nor lot in reaction is removed.
The step, concretely：Adding PBS in step (3) or (3 ') reacted reaction vessel,
Then, Magnet is introduced outside the reaction vessel, makes the magnetic bead probe-target molecule-label probe complex in the Magnet
Side is assembled, and the liquid drawn in the reaction vessel removes the unreacted label probe, and repetitive operation is until described
Unreacted label probe is completely removed.
(5) eluent is added in the reaction vessel after step (4) so that the magnetic bead probe-target molecule-labelling
Probe complex recurring structure dissociates, and is dissociated into the magnetic bead probe, the target molecule and first, second, third labelling
Probe.In the step, the addition of eluent is 10-100 μ L.
(6) Magnet is introduced outside the reaction vessel after step (5), the magnetic bead probe is gathered in the Magnet side
Collection.So, after is first assembled magnetic bead probe, after the amount of magnetic bead probe is reduced in solution, then draw solution so that follow-up absorption
Only include target molecule and label probe in solution, and do not introduce magnetic bead probe, subsequently carry out counted under microscope, can be easily right
Label probe is counted, and can improve work efficiency.
(7) by carrying out to microscope slide comprising one or more the solution of silane in amino, carboxyl, sulfydryl, hydroxyl
Surface modification, the surface for making microscope slide forms one layer of self-assembled film, and the surface exposure of microscope slide goes out above-mentioned specific chemical group,
Slide surface is set to show in aqueous certain electrical or can be with label probe association reaction.
In the step, surface modification process is carried out to slide so that slide surface exposes amino, carboxyl, sulfydryl, hydroxyl
One or more in base.For example, by taking amino as an example, can be by solution of silane and ethanol comprising amino by volume 3:7～
1:9 ratio is hybridly prepared into mixed solution, and microscope slide is soaked in the mixed solution, makes the surface shape of the microscope slide
Into one layer of amino self-assembled film.Similarly, such as it is the solution of silane comprising other groups, by solution of silane and ethanol by volume
3:7～1:9 ratio is hybridly prepared into mixed solution, and microscope slide is soaked in the mixed solution, makes the microscope slide
Surface forms the self-assembled film of one layer of corresponding group.
When contained probe molecule is DNA sequence in label probe, it shows in aqueous negative electricity.By above-mentioned formation ammonia
The self-assembled film of base group so that slide surface becomes positively charged in aqueous.So, when label probe is placed on microscope slide
When, label probe is attracting by physical charge with slide surface so that the label particles on label probe are fixed on slide.
Additionally, for probe molecule contained in label probe shows in aqueous the situation of positive electricity, then by modifying slide surface
The group of carboxyl is formed, makes slide surface negatively charged in aqueous, so as to adsorb fixation mark particle by physical charge
On slide.And for probe molecule contained in label probe uncharged situation in aqueous, then slide is carried out
After the modification of above-mentioned group (amino, carboxyl, sulfydryl, hydroxyl), its surface can be made to carry above-mentioned group (amino, carboxylic, sulfydryl, hydroxyl
Base etc.), and then can react with the group in label probe (group that the group or follow-up modification of itself increases), by changing
Learn the fixation that reaction bonded ensures label particles.For example, when target molecule is protein, contained probe molecule is in label probe
Antibody, its neutral.Now surface exposure amino is made using amino silane modification slide, by modifying label probe its table is made
The exposed carboxyl in face, Ammonia In Aqueous Solution base and carboxyl chemical bond, so as to realize that label particles are fixed.
By above-mentioned moditied processing, combined by physical charge absorption or chemical reaction and ensure that succeeding marker particle is being carried
Fix on wave plate, so as to the corresponding label particles of each target molecule are fixed respectively, prevent different label particles from mutually assembling, affect
The accuracy of detection.
(8) draw the solution after step (6) and make sample on the microscope slide after step (7), in microscope
Under three kinds of label probes are counted and are calculated the total quantity of each label probe in the solution, by label probe
Quantity calculates the concentration of corresponding target molecule.
Above-mentioned Cleaning Principle flow chart is as shown in Figure 1.Wherein, 1 magnetic bead is represented, 2 represent the first of the first target molecule
Probe molecule, 3 represent the first probe molecule of second target molecule, and 4 represent the first probe molecule of the third target molecule, 5 tables
Show the first target molecule, 6 represent second target molecule, and 7 represent the third target molecule, and 8 represent the first label particle, 9 tables
Show second label particle, 10 represent the third label particle, 11 represent the second probe molecule of the first target molecule, 12
The second probe molecule of second target molecule is represented, 13 represent the second probe molecule of the third target molecule.
In following preferred example, by taking known three kinds of related genes (i.e. target molecule) as an example, respectively：
The related gene sequence of HIV (human immunodeficiency virus) (HIV)：
5 '-AGAAGATATTTGGAATAACATGACCTGGATGCA-3 ',
The related gene sequence of human papillomaviruss (HPV)：
5 '-CCATAGATATACATTCTCTATTATCCACCTGCATTTGCTGCATAAGCACTAGCATT TT-3 ',
The correlated serieses of hepatitis B viruss (HBV)：
5’-TTGGCGGGCAGTTATATGGATGATGTGGTA-3’。
Label particles are respectively with gold nanorods, gold nanosphere, gold/silver composite nano particles.
During detection, comprise the steps：
(1) according to the sequence of above target molecule, by a conventional method two probes point are separately designed for every kind of target molecule
Sub (DNA sequence).
For HIV sequences：First probe molecule at 3 ' ends with amido modified, particular sequence is 5 '-
TTATTCCAAATATCTTCT-NH2-3 ', at 5 ' ends with sulfydryl modification, particular sequence is 5 '-HS- to the second probe molecule
TGCATCCAGGTCATG-3’。
For HPV sequences：First probe molecule at 3 ' ends with amido modified, particular sequence is 5 '-
GTGTGGATAATAGAGAATGTATATCTATGGAAAAAAAAAA-NH2-3 ', the second probe molecule is held with sulfydryl modification 5 ',
Particular sequence is 5 '-HS-AAAAAAAAAAACAGAAAATGCTAGTGCTTATGCAGCAAAT-3 '.
For HBV sequences：First probe molecule at 3 ' ends with amido modified, particular sequence is 5 '-
ATAACTFAAAGCCAAAAAAAAAAAA-NH2-3 ', the second probe molecule at 5 ' ends with sulfydryl modification, particular sequence is 5 '-
HS-AAAAAAAAAATACCACATCATCCAT-3’。
The first probe molecule of three kinds of target molecules is coupled on magnetic bead respectively forms magnetic bead probe, respectively by HIV, HPV,
Second probe molecule of HBV target molecules is coupled on gold nanorods, gold nanosphere and gold/silver composite nano particles and forms labelling spy
Pin, wherein the picture of gold nanosphere used, gold/silver composite nano particles, the transmission electron microscope of gold nanorods is respectively such as
Shown in Fig. 2 a, 2b, 2c.Three kinds of target molecules can freely be matched with label particles, and for example HIV, HPV, HBV target molecule can be corresponded
Gold nanosphere, gold/silver composite nano particles, gold nanorods, can also correspond that gold nanosphere, gold nanorods, gold/silver are compound to be received
Rice corpuscles, can also correspond gold nanorods, gold nanosphere, gold/silver composite nano particles, and various combinations are feasible, as long as really
Protect three kinds of label particles different from each other.
(2) by 106Individual magnetic bead probe is added to 60 microlitres of the solution containing three kinds of target molecules, and (concentration of target molecules is respectively
In test tube 100nM), test tube is placed on shaking table, shaking speed is set to 50r/min (also can be in the ultrasound environments of ultrasonic 20KHZ
Under carry out), react 1 hour, three kinds of target molecules react with corresponding first probe molecule, are caught into the table of magnetic bead probe
Face, after question response terminates, introduces one block of Magnet outside test tube wall, the careful liquid drawn in test tube and will not take away target molecule-
Magnetic bead probe complexes.
(3) respectively by 1012Three kinds of individual label probes are added in the test tube of step (2), test tube are placed on shaking table, shaking table
Rotating speed is set to 50r/min (also can carry out under the ultrasound environments of ultrasonic 20KHz), reacts 2 hours, three kinds of target molecules with it is corresponding
The second probe molecule combine, formed magnetic bead probe-target molecule-label probe complex.
(4) phosphate (PBS) buffer of 100 μ L is added in test tube, jiggle it is several under, then draw outside test tube wall
Enter Magnet, magnetic bead probe-target molecule-label probe complex is assembled in Magnet side, the liquid drawn in test tube will be not anti-
The label probe answered is removed, and repeats the step six times to completely remove the label probe not reacted completely.
The complex of magnetic bead probe-target molecule-label probe that the step is obtained makes SEM samples (as shown in Figure 3)
Observed.A illustrates to detect the magnetic ball in the complex of HIV target molecules that b illustrates to detect the compound of HPV target molecules in Fig. 3
Magnetic ball in thing, c illustrates to detect the magnetic ball in the complex of HBV target molecules that d-f is that the local to magnetic ball shown in a-c is carried out
The picture of amplification.It is obtained from figure, there is huge number (10 on each magnetic bead3) gold nanorods, gold nanosphere and gold/silver
Composite nanoparticle is coated in its surface, and demonstrating the strong interaction between double-stranded DNA can make magnetic bead and labelling grain really
Rock-steady structure is formed between son, illustrates that labelling is very reliable.This point is gold nanorods, gold nanosphere and gold/silver composite nano-granule
Son can be used for the experiment basis of marker detection as probe.
(5) 20 microlitres of eluent (being ultra-pure water in this example) is added in test tube and 10 is heated in 70 DEG C of water-bath
Minute, magnetic bead probe-target molecule-label probe complex recurring structure dissociation is made, it is dissociated into magnetic bead probe, target molecule and labelling
Probe.
(6) Magnet is introduced outside test tube wall, makes magnetic bead probe have the side aggregation of Magnet in test tube.
(7) APTES and ethanol are pressed into 1:9 ratio is mixedly configured into slide decorating liquid, will carry
Slide is soaked in more than 6h in mixed solution, and the surface for making slide forms one layer of amino self-assembled film, in aqueous slide
Surface carries positive electricity.Microscope slide is cleaned by ultrasonic afterwards, and is dried in vacuum drying oven.
(8) supernatant for carefully pipetting 3 microlitres with liquid-transfering gun is dropped on the hydride modified and clean microscope slides of Jing, with lid
Slide gland is formed on microscope sample, due to DNA molecular in aqueous show negative electricity, and after the surface modification of slide
Show positive electricity in aqueous solution, both attract each other, it is ensured that noble metal nanoparticle is fixed on slide, using dark field microscope point
Other redness (gold nanorods) in sample, green (gold nanosphere) and blue (gold/silver composite nano particles) bright spot are counted
Number, details in a play not acted out on stage, but told through dialogues microgram is as shown in Figure 4.Fig. 4 a are image of the gold nanorods in dark field microscope, show red.Fig. 4 b are Jenner
Image of the rice ball in dark field microscope, shows green.Fig. 4 c are figure of the gold/silver composite nano particles in dark field microscope
Picture, shows blue.Fig. 4 d be gold nanorods, gold nanosphere and gold/silver composite nano particles simultaneously in the presence of in dark field microscope
In image, including red, green and blue.
The 50 width pictures to randomly selecting are counted, you can for the concentration mensuration to target molecule.In an experiment, to one
The target molecule DNA of series concentration is detected that testing result is as shown in Fig. 5 a～5c.Fig. 5 a are the concentration and actual detection of HIV
The graph of a relation of number, Fig. 5 b are the concentration of HBV and the graph of a relation of actual detection number, and Fig. 5 c are the concentration and actual detection of HPV
The graph of a relation of number.It can be seen that actual detection data have preferably corresponding relation with concentration, the linearity of detection is preferable.
Concentration calibration curve can be made according to Concentration Testing result, defined according to 3 times of standard deviations of detectable limit, can be entered
It is about 3 × 10 that one step is calculated Monitoring lower-cut of the method for this specific embodiment in three kinds of target molecule DNA detections- 18Mol/L, the Detection Techniques than being generally basede on fluorescence intensity are higher by 4-5 magnitude, and the detection error of three kinds of target molecules exists
It is reliable within 15%, it can be seen that the invention has high using value.
To verify the specificity of the detection method of this specific embodiment, also 7 samples comprising different target molecules are entered
Row detection, testing result is as shown in Figure 6.Sample 1-3 is respectively the sample of the target molecule sequence for comprising only HIV, HBV and HPV.Sample
Product 4-6 contains two kinds of components：HIV and HBV of the sample 4 containing 10fM, HIV and HPV of the sample 5 containing 10fM, HBV of the sample 6 containing 10fM
And HPV.Three kinds of components contain 10fM in sample 7.As can be seen from Figure 6, the method for this specific embodiment is for addition three simultaneously
When kind label particles are detected, specificity is preferable.The method of this specific embodiment while high throughput testing is realized, energy
Enough ensure specificity.
In the embodiment above, with superparamagnetic characteristic and to be coupled and have the magnetic bead of the first probe molecule to capture substrate,
Target molecule to be measured in molecule solution is captured into magnetic bead surfaces, the label particles for being readily able to single particle counts are coupled upper second
Probe molecule, the target molecule to being trapped in magnetic bead surfaces is marked, and forms magnetic bead probe-target molecule-label probe and is combined
Thing.Using the superparamagnetism of magnetic bead, the unnecessary separate particles for having neither part nor lot in labelling are gone out into reaction system.And pass through eluting, participate in mark
The particle of note is then discharged in solution from magnetic bead surfaces.Simultaneously by the solution of silane comprising special groups to carrying glass
Piece is modified, and on the surface of microscope slide one layer of self-assembled film is formed, and the surface exposure of slide goes out above-mentioned specific chemical group,
So that microscope slide shows in aqueous certain electrical or can pass through group association reaction with label probe.So, when
When solution comprising label probe makes sample on microscope slide, label probe middle probe is combined by electrical attraction or group
React and be fixed on microscope slide, so as to respectively various label particles can be carried out with count the concentration for realizing various target molecules survey
It is fixed.In some other embodiment, it is also possible to first have target molecule capture in the label particles of the second probe molecule, so in coupling
The magnetic bead for having the first probe molecule with coupling again afterwards is reacted, and forms magnetic bead probe-target molecule-label probe complex.
In other embodiments, target molecule can also be multiple proteins, and correspondingly, probe molecule is antibody, eluent
For urea liquid.
Above content is to combine specific preferred implementation further description made for the present invention, it is impossible to assert
The present invention be embodied as be confined to these explanations.For general technical staff of the technical field of the invention,
Some replacements or substantially modification are made on the premise of without departing from present inventive concept, and performance or purposes are identical, all should be considered as
Belong to protection scope of the present invention.
Sequence table
<110>Shenzhen Graduate School of Tsinghua University
<120>A kind of many concentration of target molecules detection methods
<130> 16A100409JYC
<160> 9
<210> 1
<211> 33
<212> DNA
<213>HIV (human immunodeficiency virus)
<400> 1
agaagatatt tggaataaca tgacctggat gca 33
<210> 2
<211> 58
<212> DNA
<213>Human papillomaviruss
<400> 2
ccatagatat acattctcta ttatccacct gcatttgctg cataagcact agcatttt 58
<210> 3
<211> 30
<212> DNA
<213>Hepatitis B viruss
<400> 3
ttggcgggca gttatatgga tgatgtggta 30
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<400> 4
ttattccaaa tatcttct 18
<210> 5
<211> 15
<212> DNA
<213>Artificial sequence
<400> 5
tgcatccagg tcatg 15
<210> 6
<211> 40
<212> DNA
<213>Artificial sequence
<400> 6
gtgtggataa tagagaatgt atatctatgg aaaaaaaaaa 40
<210> 7
<211> 40
<212> DNA
<213>Artificial sequence
<400> 7
aaaaaaaaaa acagaaaatg ctagtgctta tgcagcaaat 40
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence
<400> 8
ataactfaaa gccaaaaaaa aaaaa 25
<210> 9
<211> 25
<212> DNA
<213>Artificial sequence
<400> 9
aaaaaaaaaa taccacatca tccat 25
Claims (9)
1. a kind of many concentration of target molecules detection methods, it is characterised in that：Comprise the following steps：
S1, each self-corresponding first probe molecule of various target molecules is coupled on magnetic bead, forms magnetic bead probe；By various targets point
Each self-corresponding second probe molecule of son is coupled to respectively various different label particles surfaces, forms various label probes；Institute
Stating when various different label particles are observed to be distinguished from each other out；
S2, in reaction vessel, the solution of the magnetic bead probe and various target molecules is mixed, various target molecules with it is corresponding
The reaction of the first probe molecule, various target molecules are caught into the surface of the magnetic bead probe and form target molecule-magnetic bead to be visited
Pin complex；
S3, the various label probes are added in the reaction vessel after step S2, various target molecules with it is corresponding
Second probe molecule is combined, and forms magnetic bead probe-target molecule-label probe complex；
Or respectively by step S2, S3 replaces with following steps S2 ', S3 ',
S2 ', in reaction vessel, the solution of the mixed liquor of various label probes and various target molecules is mixed, various target molecules
React with corresponding second probe molecule, various target molecules are captured separately to the surface of various label probes；
S3 ', the magnetic bead probe is added through step S2 ' after reaction vessel in, various target molecules are respectively with corresponding the
One probe molecule is combined, and forms magnetic bead probe-target molecule-label probe complex；
S4, the label probe for having neither part nor lot in reaction is removed；
S5, in the reaction vessel after step S4 eluent is added so that the magnetic bead probe-target molecule-label probe
Complex recurring structure dissociates, and is dissociated into the magnetic bead probe, the target molecule and various label probes；
S6, by carrying out surface to microscope slide comprising one or more the solution of silane in amino, carboxyl, sulfydryl, hydroxyl
Modification, the surface for making the microscope slide forms one layer of self-assembled film；
S7, draws the solution after step S5 and sample is made on the microscope slide processed through step S6, under the microscope
Various label probes are counted and are calculated with the quantity of various label probes in the solution, by each label probe
Quantity calculates the concentration of corresponding target molecule.
2. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S6, by the silane
Solution and ethanol by volume 3:7～1:9 ratio is hybridly prepared into mixed solution, and microscope slide is soaked in into the mixed solution
In, the surface for making the microscope slide forms one layer comprising one or more the self assembly in amino, carboxyl, sulfydryl, hydroxyl
Film.
3. many concentration of target molecules detection methods according to claim 1, it is characterised in that：Step S2 or step S2 ' or
Person's step S3 or step S3 ' in, the reaction vessel is placed under the state of rocking or supersonic vibration state, is rocked speed and is
30r/min-60r/min, supersonic frequency is 10KHz-30KHz.
4. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S7, solution is being drawn
Also include before：Magnet is introduced outside the reaction vessel after step S5, the magnetic bead probe is gathered in the Magnet side
Collection.
5. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S1, it is described it is various not
With label particles be：Combination not of the same race in noble metal nano particles, fluorescent microsphere, quantum dot, upper conversion nano crystalline substance.
6. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S1, it is described it is various not
Same label particles are various noble metal nano particles, and the local surface plasma resonance of various noble metal nano particles
Peak position differs more than 50nm.
7. many concentration of target molecules detection methods according to claim 6, it is characterised in that：It is three kinds of targets point in step S1
The gene order of son, respectively HIV, the gene order of HPV, the gene order of HBV；Corresponding three kinds of label particles are selected from：Gold
Nanosphere, gold nanorods, gold/silver composite nano particles.
8. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S1, the first probe point
Son is coupled on magnetic bead to be included while being coupled to same magnetic bead or being coupled to respectively on magnetic bead not of the same race.
9. many concentration of target molecules detection methods according to claim 1, it is characterised in that：In step S1, target molecule is DNA
Molecule or protein molecule.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610956612.7A CN106568975A (en) | 2016-11-03 | 2016-11-03 | Concentration detection method of plurality of target molecules |
| PCT/CN2017/102220 WO2018082405A1 (en) | 2016-11-03 | 2017-09-19 | Concentration detection method for multiple target molecules |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610956612.7A CN106568975A (en) | 2016-11-03 | 2016-11-03 | Concentration detection method of plurality of target molecules |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106568975A true CN106568975A (en) | 2017-04-19 |
Family
ID=58535531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610956612.7A Pending CN106568975A (en) | 2016-11-03 | 2016-11-03 | Concentration detection method of plurality of target molecules |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106568975A (en) |
| WO (1) | WO2018082405A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107462704A (en) * | 2017-09-21 | 2017-12-12 | 清华大学深圳研究生院 | A kind of biology sensor and preparation method thereof, concentration of target molecules detection method |
| WO2018082405A1 (en) * | 2016-11-03 | 2018-05-11 | 清华大学深圳研究生院 | Concentration detection method for multiple target molecules |
| CN110133246A (en) * | 2019-05-14 | 2019-08-16 | 江苏师范大学 | A kind of homogeneous immunoassay method on individual particle is horizontal |
| CN111157719A (en) * | 2020-01-16 | 2020-05-15 | 清华珠三角研究院 | Multi-channel detection method for detecting content of DNA fragments |
| CN112852925A (en) * | 2021-02-05 | 2021-05-28 | 华中农业大学 | Biochemical analysis method for simultaneously detecting multiple target objects |
| CN112964868A (en) * | 2021-02-05 | 2021-06-15 | 华中农业大学 | Biochemical analysis method for simultaneously detecting multiple target objects based on magnetic separation |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114018892B (en) * | 2021-11-19 | 2024-01-30 | 江苏科技大学 | Method for detecting GST by combining magnetic single-drop microextraction fluorescent switch with PDA coating vesicle |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104007087A (en) * | 2014-05-13 | 2014-08-27 | 北京大学 | Counting method for gold nanomaterial on transparent levelled sheet-shaped substrate surface |
| CN104198710A (en) * | 2014-08-18 | 2014-12-10 | 湖北工业大学 | Magnetic separation and multicolor quantum dot marking-based method and kit for quickly detecting anti-human chlamydia pneumoniae IgM and IgG antibodies simultaneously |
| CN104894219A (en) * | 2015-06-29 | 2015-09-09 | 河南省商业科学研究所有限责任公司 | Method for detecting salmonella and staphylococcus aureus in food simultaneously |
| CN105132533A (en) * | 2015-07-24 | 2015-12-09 | 清华大学深圳研究生院 | Target molecule concentration detection method |
| CN105277714A (en) * | 2014-08-18 | 2016-01-27 | 董俊 | Rapid detection method and kit for human parainfluenza virus based on magnetic separation and quantum dot labeling |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080188374A1 (en) * | 2007-01-30 | 2008-08-07 | Academia Sinica | In-Solution Microarray Assay |
| CN101182580B (en) * | 2007-11-19 | 2012-08-29 | 中国科学院上海微系统与信息技术研究所 | Gene or gene mutation measuring method based on magnetic beads and nanometer gold detecting probe |
| CN101441212A (en) * | 2008-12-04 | 2009-05-27 | 上海交通大学 | Multiple-antigen synchronous detection method of quantum dot mark fluorescent immune |
| CN104568905B (en) * | 2015-01-19 | 2017-02-22 | 东南大学 | Three-dimensional code biological detection chip based on surface-enhanced Raman scattering (SERS) microflow platform as well as preparation method and detection method of biological detection chip |
| CN106568975A (en) * | 2016-11-03 | 2017-04-19 | 清华大学深圳研究生院 | Concentration detection method of plurality of target molecules |
-
2016
- 2016-11-03 CN CN201610956612.7A patent/CN106568975A/en active Pending
-
2017
- 2017-09-19 WO PCT/CN2017/102220 patent/WO2018082405A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104007087A (en) * | 2014-05-13 | 2014-08-27 | 北京大学 | Counting method for gold nanomaterial on transparent levelled sheet-shaped substrate surface |
| CN104198710A (en) * | 2014-08-18 | 2014-12-10 | 湖北工业大学 | Magnetic separation and multicolor quantum dot marking-based method and kit for quickly detecting anti-human chlamydia pneumoniae IgM and IgG antibodies simultaneously |
| CN105277714A (en) * | 2014-08-18 | 2016-01-27 | 董俊 | Rapid detection method and kit for human parainfluenza virus based on magnetic separation and quantum dot labeling |
| CN104894219A (en) * | 2015-06-29 | 2015-09-09 | 河南省商业科学研究所有限责任公司 | Method for detecting salmonella and staphylococcus aureus in food simultaneously |
| CN105132533A (en) * | 2015-07-24 | 2015-12-09 | 清华大学深圳研究生院 | Target molecule concentration detection method |
Non-Patent Citations (1)
| Title |
|---|
| 宋园园: "单个金纳米颗粒和金纳米棒的暗场光谱成像研究", 《湖南大学 硕士学位论文》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018082405A1 (en) * | 2016-11-03 | 2018-05-11 | 清华大学深圳研究生院 | Concentration detection method for multiple target molecules |
| CN107462704A (en) * | 2017-09-21 | 2017-12-12 | 清华大学深圳研究生院 | A kind of biology sensor and preparation method thereof, concentration of target molecules detection method |
| CN110133246A (en) * | 2019-05-14 | 2019-08-16 | 江苏师范大学 | A kind of homogeneous immunoassay method on individual particle is horizontal |
| CN111157719A (en) * | 2020-01-16 | 2020-05-15 | 清华珠三角研究院 | Multi-channel detection method for detecting content of DNA fragments |
| CN112852925A (en) * | 2021-02-05 | 2021-05-28 | 华中农业大学 | Biochemical analysis method for simultaneously detecting multiple target objects |
| CN112964868A (en) * | 2021-02-05 | 2021-06-15 | 华中农业大学 | Biochemical analysis method for simultaneously detecting multiple target objects based on magnetic separation |
| CN112964868B (en) * | 2021-02-05 | 2022-06-28 | 华中农业大学 | Biochemical analysis method for simultaneously detecting multiple target objects based on magnetic separation |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2018082405A1 (en) | 2018-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106568975A (en) | Concentration detection method of plurality of target molecules | |
| Zhang et al. | Magnetic surface-enhanced Raman scattering (MagSERS) biosensors for microbial food safety: Fundamentals and applications | |
| WO2017016281A1 (en) | Method of detecting target molecule concentration | |
| CN105393118B (en) | Improved measuring method | |
| Rao et al. | Comparison of multiplexed techniques for detection of bacterial and viral proteins | |
| JP6941443B2 (en) | Image differentiation multiplex assay | |
| JP2020514709A (en) | Method and apparatus for magnetic multi-bead assay | |
| JP2012523576A (en) | Method and apparatus for detecting the presence of an analyte in a sample | |
| Wu et al. | A portable magnetic particle spectrometer for future rapid and wash-free bioassays | |
| US9389162B2 (en) | Detection of analyte using coffee-ring effect | |
| CA2602114A1 (en) | Method for determining blood groups in blood samples | |
| CN107298426B (en) | Magnetic microchip, preparation method and application with encoding of graphs | |
| CN116018354A (en) | Coronavirus immediate test agglutination assay | |
| Lei | Quantitative electrical detection of immobilized protein using gold nanoparticles and gold enhancement on a biochip | |
| CN113390837B (en) | Method for detecting coupling efficiency of magnetic bead protein | |
| CN101672848A (en) | Microsphere surface fluorescence color coding liquid biochip diagnostic kit, method and device for detecting material to be detected by using diagnostic kit and application of diagnostic kit | |
| US20230273198A1 (en) | Methods and apparatus for detecting molecules | |
| CN114923886A (en) | Single-molecule fluorescence detection method based on grating and magnetic array | |
| CN106124756A (en) | Sensing chip and sensing method | |
| CN107636461B (en) | Using multiple metal nano labels multiple targets while analysis method | |
| CN108254354A (en) | The detection kit of label-free SERS micro-array chips and its application | |
| Devadhasan et al. | Label free quantitative immunoassay for Hepatitis B | |
| WO2023064633A1 (en) | Diamond magnetometry detection of biological targets | |
| Kim et al. | A magneto-nanosensor immunoassay for sensitive detection of Aspergillus fumigatus allergen Asp f 1 | |
| Hosseini et al. | Novel Polymeric Biochips for Enhanced Detection of Infectious Diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170419 |