CN106554422A - The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application - Google Patents

The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application Download PDF

Info

Publication number
CN106554422A
CN106554422A CN201610942302.XA CN201610942302A CN106554422A CN 106554422 A CN106554422 A CN 106554422A CN 201610942302 A CN201610942302 A CN 201610942302A CN 106554422 A CN106554422 A CN 106554422A
Authority
CN
China
Prior art keywords
subcutaneous
cell
transdermal absorption
targeting delivery
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610942302.XA
Other languages
Chinese (zh)
Inventor
罗学刚
王玥
闫莉华
张同存
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN201610942302.XA priority Critical patent/CN106554422A/en
Publication of CN106554422A publication Critical patent/CN106554422A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/485—Epidermal growth factor [EGF], i.e. urogastrone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Dermatology (AREA)
  • Microbiology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention is to be related to a kind of subcutaneous Targeting delivery type hEGF of high Transdermal absorption and construction method and application, according to the codon-bias of expressive host, hEGF, cell-penetrating peptide, subcutaneous three partial gene fragments of endogenous protease restriction enzyme site are simultaneously stitched together by optimization, it is connected to build in expression plasmid and obtains high Transdermal absorption, the expression vector of subcutaneous Targeting delivery type hEGF, is transformed in the hosts such as escherichia coli to realize that high efficient expression is produced.The present invention overcomes hEGF is used as the low defect of the transdermal characteristic that biomacromolecule material has, hEGF is allow efficiently to cross over keratodermatitis, and the effects such as promotion fibroblast proliferation are played in subcutaneous Targeting delivery, so as to significantly improve which in skin protection, except the actual efficacy of the aspects such as pox, wrinkle removal, whitening, the Development and Production for related cosmetics and bio-pharmaceutical provides a kind of New Century Planned Textbook and new method.

Description

The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application
Technical field
The invention belongs to biological medicine and cosmetic field, the especially a kind of subcutaneous Targeting delivery of efficient Transdermal absorption The design of hEGF and cosmetic applications.
Background technology
Epidermal growth factor（Epidermal growth factor, EGF）It is a kind of containing the single-stranded many of 53 aminoacid Peptide, acts not only on epidermis cell, also acts on hide fiber cell, keratinocyte etc., automatically with EGF receptor on its cell membrane （EGF-R）With reference to, the ability with strongly promotion cell propagation, therefore skin can be played as cosmetics additive and medicine and be repaiied Again, take good care of and acne removing（Remove acne, skin ulcer of fullying recover from an illness and comedo）, Bearberry Extract.However, as a kind of biomacromolecule, transdermal Absorption difference always perplexs the significant problem of its practical application.Cell-penetrating peptide（Cell-penetrating peptides, CPP）Be it is a kind of can carry various exogenous materials such as protein into cell micromolecule polypeptide, realize in Materials Cell Change, efficient transdermal characteristic.To obtain the hEGF of a kind of high transdermal characteristic, subcutaneous Targeting delivery, this problem utilizes engineered method Cell-penetrating peptide is introduced in the N-terminal of EGF, and the protease cleavage site of subcutaneous high expression is with the addition of between the two to realize its skin Lower release and the targeting for playing a role.
The content of the invention
It is an object of the invention to overcome the low diadermic defect of biomacromolecule material, a kind of high transdermal, subcutaneous is designed The construction expression of the Targeting delivery type hEGF factor and recombination engineering, the recombiant protein that the present invention is obtained make hEGF in cell-penetrating Skin keratin confluent monolayer cells are passed through under the carrying of peptide, and the increment that fibroblast promotes cell are positioned in subcutaneous targeting, Its skin permeation rate and targeting are improve, the production for biological cosmetics and bio-pharmaceutical provides a kind of New Century Planned Textbook with new side Method.
The present invention realizes that the technical scheme of purpose is as follows：
N-terminal of the present invention by molecular biology method in hEGF introduces cell-penetrating peptide-such as（But it is not limited to）Pep- 1st, TAT, MPG, many poly arginines etc., the protease cleavage site using the subcutaneous endogenous expression such as MMP-2, MMP-9 is used as the two Linking arm, three is stitched together.By three spliced gene（PME）It is inserted into many grams of gene engineering expression carrier Grand site, structure obtain PME expression plasmids.PME expression plasmids are converted to host-such as（But it is not limited to）Escherichia coli, ferment Female bacterium, lactic acid bacteria, bacillus subtilises, eucaryon mammalian cell etc., screening structure obtain high Transdermal absorption, subcutaneous targeting and release Type hEGF factor engineering expression system is put, expression, separation, purification obtain high Transdermal absorption, the subcutaneous Targeting delivery type hEGF factor.
Concrete grammar is as follows：
A kind of subcutaneous Targeting delivery type factor of high Transdermal absorption, cell-penetrating peptide are connected with linking arm with the hEGF factors, even Connect the protease cleavage site small peptide that arm is subcutaneous endogenous expression.
And, the cell-penetrating peptide is the peptide matters that portability bioactive substance enters cell.
And, the cell-penetrating peptide is Pep-1, TAT, MPG or many poly arginine.
And, the protease of the subcutaneous endogenous expression is with endogenous expression and activity, with specific subcutaneous The protease of enzyme action recognition site, including matrix metalloproteinase MMP-2, matrix metalloproteinase MMP-9, collagenase, gelatin Enzyme, stromelysin, keratinase, cathepsin.
The construction method of the subcutaneous Targeting delivery type factor of high Transdermal absorption, step are as follows
(1) the N-terminal of hEGF genes is introduced into cell-penetrating peptide gene, with the protease cleavage site of subcutaneous endogenous expression As the linking arm of the two, three is stitched together；
(2) three spliced gene is inserted into the multiple clone site of gene engineering expression carrier, structure obtains expressing matter Grain；
(3) expression plasmid is converted to host, screening builds the gene for obtaining the subcutaneous Targeting delivery type factor of high Transdermal absorption Engineering expression system.
And, the host and its expression plasmid are escherichia expression system, expression system, lactic acid bacteria expression System, bacillus subtilises expression system, the host of eucaryon mammalian cell expression system and its expression plasmid.
And, the cell-penetrating peptide is the peptide matters that portability bioactive substance enters cell.
And, the cell-penetrating peptide is Pep-1, TAT, MPG or many poly arginine.
A kind of subcutaneous Targeting delivery type factor of high Transdermal absorption is used as cosmetic formulation application.
A kind of subcutaneous Targeting delivery type factor of high Transdermal absorption is used as the application for preparing treatment skin disease organism preparation.
Advantages and advantages of the invention are：
1st, the present invention successfully devises a kind of high Transdermal absorption, subcutaneous Targeting delivery type hEGF, with good cross-film Transhipment and the ability of Transdermal absorption, while can be prescinded except cell-penetrating peptide, be realized that targeting is effective by subcutaneous proteolytic cleavage subcutaneous Release, promotes subcutaneous fibroblastic propagation, migration, so as to play the beauty functions such as wrinkle removal.
2nd, the present invention establishes this high Transdermal absorption, the gene engineering expression method of subcutaneous Targeting delivery type hEGF, is Its industrialization is laid a good foundation.
3rd, the recombiant protein PME obtained by the present invention not only makes the hEGF factors overcome the low transdermal characteristic of biomacromolecule material Defect, also make its targeting in subcutaneous fibroblast, promote cell to breed to play its skin protection, except pox, wrinkle removal, whitening The effects such as, the production for biological cosmetics and bio-pharmaceutical provides a kind of New Century Planned Textbook and new method.
Description of the drawings
Fig. 1 is recombiant plasmid of the present invention（By taking colibacillus expression plasmid pET22b-PME as an example）Double digestion proof diagram, swimming Road 1 be pET22b empty plasmids by Nco I and Xho I double digestion results, it is by Nco that swimming lane 2 is recombiant plasmid pET22b-PME I and Xho I double digestion results, swimming lane 3 is PME gene PCR products.
Ni affinitive layer purifications of the Fig. 2 for inclusion body protein,（Fig. 2 a）Swimming lane 1,2,3 is washed using 1,2,3M carbamide respectively Wash albumen,（Fig. 2 b）Swimming lane 1 is unpurified albumen, swimming lane 2 to flow through liquid, swimming lane 3,4,5,6 respectively using 10mM, The albumen of 50mM, 100mM, 300mM imidazoles eluting.
Fig. 3 detects that for the western blot of purpose albumen swimming lane 1 is PME Protein Detection results.
Fig. 4 is detected for the biologic activity of recombiant protein.
Fig. 5 is that albumen is analyzed across horn cell film turn-over capacity.
Fig. 6 is MMP-2 metallo-matrix proteases enzyme action fusion protein.
Specific embodiment
Below by specific embodiment, the invention will be further described, and following examples are descriptive, is not limit Qualitatively, it is impossible to which protection scope of the present invention is limited with this.
The present invention designs a kind of recombiant protein of the subcutaneous Targeting delivery type of high Transdermal absorption, and sets up its gene engineering expression Method, particular content include：
(1) the N-terminal by molecular biology method in hEGF genes introduces cell-penetrating peptide, with subcutaneous endogenous expression Linking arm of the protease cleavage site as the two, three is stitched together.
The cell-penetrating peptide is the bioactive substance that a class can carry various different sizes and property（Protein, Nucleic acid, polysaccharide etc.）Into the peptide matters of cell, including（But it is not limited to）Pep-1, TAT, MPG, many poly arginines etc..
The protease of the subcutaneous endogenous expression is to know with endogenous expression and activity, with specific enzyme action subcutaneous The protease in other site, including（But it is not limited to）Matrix metalloproteinase（MMP-2, MMP-9 etc.）, collagenase, gelatinase, molten base Quality, keratinase, cathepsin etc..
(2) by three spliced gene（PME）The multiple clone site of gene engineering expression carrier is inserted into, structure is obtained PME expression plasmids.
(3) PME expression plasmids are converted into host cell, screening structure obtains high Transdermal absorption, subcutaneous Targeting delivery type The engineering expression system of the hEGF factors, expression, separation, purification obtain high Transdermal absorption, the subcutaneous Targeting delivery type hEGF factor（Egg In vain）.
The gene engineering expression host and its expression plasmid are proceeded to, replicate, transcribe, are turned over for various achievable exogenous genes Host and its corresponding expression pUC pUC that expression produces protein are translated, including（But it is not limited to）Escherichia coli expression system System, expression system, lactic acid bacteria expression system, bacillus subtilises expression system, eucaryon mammalian cell expression system System etc..
First, the construction method of PME genes, step are as follows：
In following table, primer carries out over-lap PCR amplification
Introduce NcoI and XhoI restriction enzyme sites, underscore part in primer P1, P4 respectively.Over-lap PCR is divided into three steps：The First, two step, as template, using primer P1 and P2, primer P3 and P4 expand the cell-penetrating peptide gene with people cDNA and synthesis respectively Increase and cell-penetrating peptide（As a example by this sentences pep-1）, two sections of genes of EGF；3rd step, the PCR primer with first two steps acquisition is as mould Plate, enters performing PCR amplification as primer with P1 and P4 and obtains genes of interest PME.Concrete system and amplification condition are as follows：
The PCR reaction systems of amplification PME
Loop parameter：94 DEG C of denaturations 5min,
72 DEG C of ends extend 10min
2nd, the genetic engineering abduction delivering of PME（By taking escherichia expression system as an example）
1st, PME genes are inserted into into expression vector（By taking pET22b as an example）Multiple clone site, structure obtain PME restructuring matter Grain.
By PME genes and pET22b plasmids with after NcoI and XhoI double digestions, the 16 DEG C of water-baths of Jing T4DNA ligases overnight connect Connect, convert bacillus coli DH 5 alpha, on the LB culture medium flat plates containing 100 μ g/mL erythromycin, picking monoclonal after culture 12h, Extract plasmid NcoI and XhoI double digestions to verify, agarose gel electrophoresiies detection has the restructuring matter of the PME purpose fragments of 287bp Grain is named as pET22b-PME Jing after sequencing identification is correct（See Fig. 1）.
Build linked system needed for plasmid
2nd, by pET22b-PME recombinant plasmid transformed escherichia coli, PME recombination bacillus colis are obtained
Using robin is changed, by pET22b-PME Transformed E .coli DH5 α competent escherichia coli cells, PME restructuring is obtained Escherichia coli, change robin and comprise the following steps that：
E.coli DH5 α competent cells are dissolved on ice, 10 μ l connection products are added in competent cell, ice bath 30min, notices that competence must be placed on ice, is not touched with handss.42 DEG C of water-bath thermal shock 90s, should not vibrate.Mixture is turned rapidly Ice bath 2min is put, allows cell to close completely, add 900 μ l LB fluid mediums after 37 DEG C to each EP pipe, 220r/min shakes Swing culture 1h.1000r/min centrifugation 1min remove 850 μ l supernatants, and remaining 150 μ l blow outstanding mixing converted product, coat containing anti- On the LB solid plates of raw element, flat board is just being put inversion 37 DEG C of overnight incubations of plate after 20min.At the same time, competent cell Strain will carry out controlled trial, it is ensured which is unable to normal growth in the flat board containing antibiotic.Picking positive monoclonal is passed through Plasmid enzyme restriction is verified and is sequenced and determines correctness（Fig. 1）.
3rd, abduction delivering
Recombiant plasmid pET22b-PME is proceeded to into E. coli expression strains BL21-TrixB（DE3）In, bacterium amount is connect with 1% It is inoculated in the M9 culture medium of 50ml（Containing 2% glycerol）In when cultivating to OD600 ≈ 1.0, add 0.1mM IPTG to induce its albumen Expression.Inductive condition is：37 DEG C, 220r/min incubated overnight.SDS-PAGE detections are carried out after expression（Fig. 2）.
3rd, recombiant protein is isolated and purified and identification
1st, the washing of inclusion body protein
(1) after inducing destination protein expression, the 10000r/min centrifugations 15min collects thallines in 4 DEG C of centrifuges, by every 1.5g wet thallus 50ml PBS（pH 7.4）Resuspended thalline, and ultrasonic degradation thalline, collect inclusion body precipitation.
(2) inclusion body one time is first washed with PBS, and 4 DEG C of 12000r/min are centrifuged 5min, abandon supernatant.
(3) successively using urea washes liquid (1～3M carbamide) the washing inclusion body of different gradients, 4 DEG C of 12000rpm centrifugations 5min, abandons supernatant, obtains the higher inclusion body protein of purity.
2nd, the purification of inclusion body protein
By washed solubilization of inclusion bodies in the denaturing liquid containing 1%PMSF, room temperature places 1h, makes inclusion body fully molten Solution, 4 DEG C of 12000rpm are centrifuged 15min, collect supernatant；Isopyknic BindingBuffer diluted proteins concentration is added, while being The solvent and elution buffer for ensureing loading sample is close to.With 0.45 μm of membrane filtration sample, it is to avoid blocking pillar；
(1) column equilibration：Pillar is balanced with the Binding Buffer of 8 times of volumes, can loading after balance.
(2) loading：Sample loads upper prop, and flow velocity is 10 times of column volume/hours, collects and flows through liquid.
(3) pillar is rinsed using the Binding Buffer of 15 times of column volumes, wash away foreign protein.
(3) appropriate Elution Buffer are used（Gradient concentration）Eluting, collects eluting peak.
(4) after eluting terminates, successively using the Binding Buffer of 5 times of column volumes, the deionization washing of 10 times of column volumes Pillar is washed, finally with the ethanol balance pillar of 3 times of column volumes 20%, 4 DEG C of preservations.
(5) the albumen that each eluting peak is collected is detected with SDS-PAGE（Fig. 2）.
3rd, the renaturation of inclusion body protein
This experiment progressively promotes the folding of inclusion body protein using the method that Urea Gradient dilutes dialysis, recovers its natural knot Structure, should have biologic activity so as to reach.Renaturation process is as follows：
(1) detect that liquid determines the concentration of albumen after purification with Coomassie brilliant blue, protein concentration is diluted to into 50 μ g/ with PBS ml。
(2) the bag filter that will be equipped with inclusion body protein is put in the renaturation solution containing 6M carbamide, 4 DEG C, under slow magnetic agitation Renaturation 12h；Renaturation solution is changed every 12h, the concentration of carbamide presses 5M, 4M, 3M, 2M in renaturation solution.
(3) bag filter is put into into Polyethylene Glycol（PEG）In, protein concentrate, with Coomassie brilliant blue detection liquid detection protein concentrate Concentration.
4th, Western Blot verifying purposes albumen
(1) the preparation of polyacrylamide gel
12wt% resolving polyacrylamide gels, 4wt% polyacrylamides concentration glue formula see the table below.
Concentration glue and separation gel formula
(2) by the loading of sample after process.
(3) the electrophoretic separation of albumen：80V constant pressures electrophoresis about 30min is first used after sample-adding, treats sample to concentration glue and separation gel When intersection is into wire, constant pressure 120V electrophoresis Sample is used instead.
(3) PAGE gel is cut to appropriately sized bubble to turn in buffer dry, the NC of cutting 2mm more slightly larger than adhesive tape Film and than adhesive tape with 6 metafiltration paper of size, be also immersed in and dry turn 20～30min in liquid；After be transferred to NC（Celluloid）Film （Millipore）, 3 metafiltration paper, NC films, gel strips, 3 metafiltration paper during transferring film, are followed successively by from top to bottom（Remove bubble removing）, blot week The unnecessary liquid in side, in case dry be short-circuited when turning.Glove must be worn during operation, because the lipid of skin secretion can affect transfer effect Really.Size of current is determined according to membrane area, about 1～1.5mA/cm2 determines transfer time according to albumen size, and about 1～2h is left It is right.
(5) the exposure of antibody response and blotting membrane
1. with the defatted milk powder closing NC films for preparing, shaking closing 1-2h under room temperature.Western blot PBS washings three It is secondary, till no milk powder.NC films are taken out, incubation bags are put into, the EGF antibody of an anti-diluted is added（Say by antibody Thinner ratio row on bright book are diluted）, 4 DEG C overnight.
2. NC films are taken out, is washed 3 times with Western blot PBS, each 10min.The goat of anti-diluted of plus two Anti-mouse/rabbit fluorescence two resists（1:1000）, room temperature is lower 2 hours, notes using masking foil lucifuge.
3. washed 3 times with Western blot PBS, each 10min.
4. Odyssey infrared laser imagings system sweeps film exposure（Fig. 3）.
4th, MTT determines PME to fibroblastic Effect of promoting growth
(1) progenitor cells culture：Complete culture solution of the Balb/c 3T3 l cells containing 10% peptide Ox blood serum DMEM is in 37 DEG C, 5%CO2Under the conditions of cultivate for follow-up albumen biologic activity detect.
(2) inoculating cell：Culture fluid digestion is discarded after peptic cell, cell is collected.Every 1ml is made into complete culture solution to contain 2.0×105The cell suspending liquid of individual cell, is uniformly inoculated in 96 orifice plates, per 100 μ l of hole in 37 DEG C, 5%CO2Under the conditions of cultivate. Change the hungry culture 12h of the maintenance culture fluid containing 0.4% hyclone after 12h into.
(4) dosing：Maintain culture medium gradient dilute the PME protein samples prepared in EGF protein standard substances and this research Release, discard old culture fluid, the sample of 100 μ l gradient dilutions is added per hole, each gradient arranges 6 multiple holes, continue culture 60h.
(5) develop the color：The MTT of 20 μ l is added per hole（5mg/ml）Continue culture 4h under the conditions of lucifuge.
(6) colorimetric：The liquid in culture plate is discarded, the dimethyl sulfoxide DMSO of 100 μ l is added per hole, enzyme mark after mixing, is used Instrument determines the absorbing wavelength at 570nm and 630nm.
(7) the Counting Formula of suppression ratio is as shown in formula 2-1（A represents absorbance）（Fig. 4）：
5th, abilities of the Immunofluorescence test PME across horn cell transhipment
(1) progenitor cells culture：Hacat people's immortalization epidermis cell with containing 15% peptide Ox blood serum complete culture solution MEM in 37℃、5%CO2Under the conditions of cultivate.Cultivate to the digestion of certain density and take 500 μ l and be inoculated in 24 orifice plates, cultivate 24h.
(2) dosing：Will be the PME protein sample serum-free medium gradients prepared in EGF protein standard substances and this research dilute Release, discard old culture fluid, the sample of 500 μ l gradient dilutions is added per hole, continue culture 24h.
(2) wash：Cell culture fluid is discarded, with cell PBSs 3 times, each 5min.
(3) fix：4% paraformaldehyde is fixed room temperature 30min to cell, then with cell PBSs 3 times, every time 5min。
(3) it is permeabilized：The permeable membrane agent of 0.3%Triton covers cell, and permeable membrane processes 30min, then with cell PBSs 3 It is secondary, each 5min.
(5) close：Lowlenthal serum confining liquid（1:20 dilutions）37 DEG C of closing 1h.
(6) an anti-incubation antibody of EGF（1:200 dilutions）4 DEG C of night incubation.Next day places 1h at room temperature, then uses PBS 3 times, each 5min.
Two it is anti-incubation with dye core：With FITC labelling goat antirabbit lgG antibody（1:50 dilutions）+DAPI（1:1000 dilutions） Mixed solution, adds 37 DEG C of lucifuges in 24 orifice plates to be incubated 1h, then with cell PBSs 3 times, each 5min.
(9) taken a picture with Laser Scanning Confocal Microscope, observe albumen distribution situation in the cell（Fig. 5）.
7th, subcutaneous protease（By taking MMP-2 as an example）The subcutaneous targeted-release characteristics of digestion verification
1st, the activation of MMP-2 proenzymes and activity identification
(1) MMP-2 is activated：Buffer is reacted by MMP-2 with TCNB（0.25mg/ml）It is diluted to 100 μ g/ml, APMA (20M) it is diluted to 1mM.
(2) 37 DEG C are incubated 1h.
(3) MMP-2 is diluted again to 0.2 μ g/ml of final concentration, substrate Mca-PLGL-Dpa-AR- with TCNB reaction buffer NH2 to 20 μM.
(3) on 96 orifice plates, a hole adds 20 μM of substrates of 50 μ lTCNB and 50 μ l as blank, and another hole adds 20 μM of substrates of 50 μ l MMP-2 and 50 μ l, 37 DEG C of reaction 5min.
(5) the value at excitation wavelength 320nm and launch wavelength 405nm is read with multi-function microplate reader.
2nd, MMP-2 enzyme action recombiant protein
(1) the 2 μ g/ml MMP-220 μ l for taking 0.16 μ g/ml fusion protein, 20 μ l and having activated are anti-respectively under the conditions of 37 DEG C Answer 1h, 2h, 3h.
(2) SDS-PAGE detects proteolytic cleavage effect（Fig. 6）.
Sequence table
（1）Cell-penetrating peptide（As a example by this sentences Pep-1）Sequence：
aaagaaacct ggtgggaaac ctggtggacc gaatggtctc agccgaaaaa aaaacgtaaa
gtg
（2）HEGF sequences：aatagtgact ctgaatgtcc cctgtcccac gatgggtact gcctccatga tggtgtgtgc
atgtatattg aagcattgga caagtatgca tgcaactgtgttgttggcta catcggggag
cgatgtcagt accgagacct gaagtggtgg gaactgcgc
（3）Subcutaneous endogenous protease restriction enzyme site（As a example by this sentences MMP2/9 restriction enzyme sites）Sequence：
1ccgcttggtcttgctggt
（4）The subcutaneous Targeting delivery type hEGF of high Transdermal absorption（PEM）Sequence（Wherein cell-penetrating peptide with As a example by Pep-1）：
aaagaaacct ggtgggaaac ctggtggacc gaatggtctc agccgaaaaa aaaacgtaaa
gtgggcggtg gtggctcacc gcttggtctt gctggtaata gtgactctga atgtcccctg
tcccacgatg ggtactgcct ccatgatggt gtgtgcatgt atattgaagc attggacaag
tatgcatgca actgtgttgt tggctacatc ggggagcgat gtcagtaccg agacctgaag
tggtgggaac tgcgc
SEQUENCE LISTING
<110>University Of Science and Technology Of Tianjin
<120>The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application
<130> 2016-10-25
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 41
<212> DNA
<213>Primer P1
<400> 1
cgaccatgga taaagaaacc tggtgggaaa cctggtggac c 41
<210> 2
<211> 38
<212> DNA
<213>Primer P2
<400> 2
acctgcaaga ccaagaggac taccgccgcc acctgagc 38
<210> 3
<211> 37
<212> DNA
<213>Primer P3
<400> 3
cctcttggtc ttgcaggtaa tagtgactct gaatgtc 37
<210> 4
<211> 40
<212> DNA
<213>Primer P4
<400> 4
gagctcgagg cgcagttccc accacttcag gtcacggtac 40
<210> 5
<211> 63
<212> DNA
<213>Cell-penetrating peptide（As a example by this sentences Pep-1）Sequence
<400> 5
aaagaaacct ggtgggaaac ctggtggacc gaatggtctc agccgaaaaa aaaacgtaaa 60
gtg 63
<210> 6
<211> 159
<212> DNA
<213>HEGF sequences
<400> 6
aatagtgact ctgaatgtcc cctgtcccac gatgggtact gcctccatga tggtgtgtgc 60
atgtatattg aagcattgga caagtatgca tgcaactgtg ttgttggcta catcggggag 120
cgatgtcagt accgagacct gaagtggtgg gaactgcgc 159
<210> 7
<211> 18
<212> DNA
<213>Subcutaneous endogenous protease restriction enzyme site（As a example by this sentences MMP2/9 restriction enzyme sites）Sequence
<400> 7
ccgcttggtc ttgctggt 18
<210> 8
<211> 255
<212> DNA
<213>The subcutaneous Targeting delivery type hEGF of high Transdermal absorption（PEM）Sequence（Wherein cell-penetrating peptide with As a example by Pep-1）
<400> 8
aaagaaacct ggtgggaaac ctggtggacc gaatggtctc agccgaaaaa aaaacgtaaa 60
gtgggcggtg gtggctcacc gcttggtctt gctggtaata gtgactctga atgtcccctg 120
tcccacgatg ggtactgcct ccatgatggt gtgtgcatgt atattgaagc attggacaag 180
tatgcatgca actgtgttgt tggctacatc ggggagcgat gtcagtaccg agacctgaag 240
tggtgggaac tgcgc 255

Claims (10)

1. the subcutaneous Targeting delivery type factor of a kind of high Transdermal absorption, it is characterised in that：Cell-penetrating peptide and the hEGF factors are with being connected Arm connects, and linking arm is the protease cleavage site small peptide of subcutaneous endogenous expression.
2. the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 1, it is characterised in that：The cell-penetrating Peptide is the peptide matters that portability bioactive substance enters cell.
3. the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 1 and 2, it is characterised in that：The cell Cell-penetrating peptide is Pep-1, TAT, MPG or many poly arginine.
4. the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 1, it is characterised in that：It is described subcutaneous endogenous Property expression protease be subcutaneous with endogenous expression and activity, the protease with specific enzyme action recognition site, including Matrix metalloproteinase MMP-2, matrix metalloproteinase MMP-9, collagenase, gelatinase, stromelysin, keratinase, tissue Protease.
5. the construction method of the subcutaneous Targeting delivery type factor of high Transdermal absorption, it is characterised in that：Step is as follows
(1) the N-terminal of hEGF genes is introduced into cell-penetrating peptide gene, using the protease cleavage site of subcutaneous endogenous expression as The linking arm of the two, three is stitched together；
(2) three spliced gene is inserted into the multiple clone site of gene engineering expression carrier, structure obtains expression plasmid；
(3) expression plasmid is converted to host, screening builds the genetic engineering for obtaining the subcutaneous Targeting delivery type factor of high Transdermal absorption Expression system.
6. the construction method of the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 5, it is characterised in that：Institute It is escherichia expression system, expression system, lactic acid bacteria expression system, bacillus subtilis to state host and its expression plasmid Bacterium expression system, the host of eucaryon mammalian cell expression system and its expression plasmid.
7. the construction method of the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 5, it is characterised in that：Institute State the peptide matters that cell-penetrating peptide is that portability bioactive substance enters cell.
8. the construction method of the subcutaneous Targeting delivery type factor of high Transdermal absorption according to claim 5, it is characterised in that：Institute Cell-penetrating peptide is stated for Pep-1, TAT, MPG or many poly arginine.
9. a kind of subcutaneous Targeting delivery type factor of Transdermal absorption high as claimed in claim 1 is used as cosmetic formulation application.
10. a kind of subcutaneous Targeting delivery type factor of Transdermal absorption high as claimed in claim 1 treats skin disease as preparing The application of sick biological preparation.
CN201610942302.XA 2016-10-26 2016-10-26 The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application Pending CN106554422A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610942302.XA CN106554422A (en) 2016-10-26 2016-10-26 The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610942302.XA CN106554422A (en) 2016-10-26 2016-10-26 The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application

Publications (1)

Publication Number Publication Date
CN106554422A true CN106554422A (en) 2017-04-05

Family

ID=58443438

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610942302.XA Pending CN106554422A (en) 2016-10-26 2016-10-26 The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application

Country Status (1)

Country Link
CN (1) CN106554422A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108864308A (en) * 2018-07-25 2018-11-23 西安医学院 A kind of mTAT-hEGF-kCD47 fusion protein and construction method and application
CN109316377A (en) * 2018-10-11 2019-02-12 西安医学院 A kind of compound Essence and preparation method containing fusion protein
CN112274475A (en) * 2020-11-25 2021-01-29 熊宇山 Ginseng water replenishing liquid capable of effectively reducing melanin and preparation method thereof
CN112451457A (en) * 2020-12-17 2021-03-09 王森阳 Non-irritant acne-removing makeup base and preparation method thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014055836A2 (en) * 2012-10-04 2014-04-10 Research Development Foundation Serine protease molecules and therapies
CN103784406A (en) * 2014-01-20 2014-05-14 同济大学 Nanoparticle coupled with coupling cell-penetrating peptide and metal matrix proteinase (MMP) restriction enzyme digestion site

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014055836A2 (en) * 2012-10-04 2014-04-10 Research Development Foundation Serine protease molecules and therapies
CN103784406A (en) * 2014-01-20 2014-05-14 同济大学 Nanoparticle coupled with coupling cell-penetrating peptide and metal matrix proteinase (MMP) restriction enzyme digestion site

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
XUE-GANG LUO: "Fusion with pep-1, a cell-penetrating peptide,enhances the transmembrane ability of human epidermal growth factor", 《BIOSCIENCE, BIOTECHNOLOGY, AND BIOCHEMISTRY》 *
马德云: "细胞穿膜肽Pep-1和人表皮生长因子在大肠杆菌中的重组表达", 《中国优秀硕士学位论文全文数据库 (基础科学辑)》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108864308A (en) * 2018-07-25 2018-11-23 西安医学院 A kind of mTAT-hEGF-kCD47 fusion protein and construction method and application
CN108864308B (en) * 2018-07-25 2021-08-03 西安医学院 mTAT-hEGF-kCD47 fusion protein, and construction method and application thereof
CN109316377A (en) * 2018-10-11 2019-02-12 西安医学院 A kind of compound Essence and preparation method containing fusion protein
CN112274475A (en) * 2020-11-25 2021-01-29 熊宇山 Ginseng water replenishing liquid capable of effectively reducing melanin and preparation method thereof
CN112451457A (en) * 2020-12-17 2021-03-09 王森阳 Non-irritant acne-removing makeup base and preparation method thereof

Similar Documents

Publication Publication Date Title
CN106554422A (en) The subcutaneous Targeting delivery type factor of high Transdermal absorption and construction method and application
CN108794639A (en) A kind of recombination fibronectin and its application
US6140072A (en) Functional recombinantly prepared synthetic protein polymer
US20200055900A1 (en) Split inteins with exceptional splicing activity
Katwa et al. Endothelin receptors in cultured adult rat cardiac fibroblasts
CN105061589B (en) A kind of method of recombined human NTx albumen and its immobilization fermentation production
US6184348B1 (en) Functional recombinantly prepared synthetic protein polymer
Zamuner et al. Design of decorated self-assembling peptide hydrogels as architecture for mesenchymal stem cells
CN102757974B (en) Novel preparation method for recombinant human epidermal growth factor
BR0110764A (en) purified or isolated nucleic acid, polypeptide, cloning and / or expression vector, cell, animal, except man, use of a nucleic acid and nucleic acid sequence, antibody, reactive kit, chip, medium or substance , compound and processes for obtaining and detecting a polypeptide, for determining the pluripotent character of a cell and the presence of a sample from a bird, for the classification of a bird, for the detection and / or dosage of a nucleic acid and for the screening of a substance or medium
CN110511280A (en) The transdermal recombination fibronectin of one kind and its application
CN101556287B (en) Novel protein molecular weight standard and preparation method thereof
CN108503712A (en) With the difunctional mussel attachment proteins/amphoteric ion polypeptide amalgamation protein of adherency-anti-pollution and synthetic method
CN111217903B (en) Recombinant human fibronectin III 1-C and preparation method and application thereof
CN102747097B (en) I type human collagen and epidermal growth factor dual expression vector, and expression purification method thereof
CN102675473B (en) Gene recombinant human active basic fibroblast growth factor fusion protein, preparation method thereof and application thereof
WO2017082491A1 (en) Three-dimensional fibroblast aggregate and in vitro 3d skin dermis model comprising same
CN114133435B (en) Elastin-like polypeptide and application thereof
CN112500495A (en) Purification method and application of ELP-III type collagen
CN104017089A (en) Ferritin heavy-chain subunit nanoparticles, and preparation method and application thereof
CN107090015A (en) A kind of target molecule polypeptide for specifically binding signal transduction factor and preparation method thereof
Szulcek et al. The covalently immobilized antimicrobial peptide LL37 acts as a VEGF mimic and stimulates endothelial cell proliferation
Smyth et al. Eukaryotic expression and purification of recombinant extracellular matrix proteins carrying the Strep II tag
DE69431068D1 (en) THE POLYPEPTIDE OF A MEMBRANE PROTEIN WITH THE FUNCTION TO SUPPORT THE GROWTH OF PRE-B CELLS AND ITS GENES
CN109055416A (en) A kind of preparation method of soluble recombinant protein

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170405

WD01 Invention patent application deemed withdrawn after publication