CN106546730A - A kind of lead ion visible detection method - Google Patents
A kind of lead ion visible detection method Download PDFInfo
- Publication number
- CN106546730A CN106546730A CN201610960837.XA CN201610960837A CN106546730A CN 106546730 A CN106546730 A CN 106546730A CN 201610960837 A CN201610960837 A CN 201610960837A CN 106546730 A CN106546730 A CN 106546730A
- Authority
- CN
- China
- Prior art keywords
- gold
- detection
- solution
- lead ion
- mark probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of lead ion quick visualization detection method.The method will form 5 DNA enzymatics of GR after base chain and enzyme chain bulk crossing, add graphene oxide to process and remove unreacted free single-chain nucleic acid, exclude False Positive Effect, two kinds of gold mark probes are sprayed with gold standard pad, two chains that addition is obtained after being cut open at rA by 5 DNA enzymatics of testing sample GR of pretreatment, sandwich structure is formed with the nucleotide sequence on gold mark probe and detection line by chromatography effect, develop the color so as to be fixed in detection line, unnecessary free nucleic acid is fixed on nature controlling line and develops the color.Plumbum ion concentration is obtained according to detection line colored intensity.The present invention can complete the detection of lead ion in room temperature 15min, can reach 0.05nM to the lowest detectable limit of lead ion, high with sensitivity, high specificity, do not disturbed by other bivalent metal ions, operation is simple, may be directly applied to the detection of lead ion in environment.
Description
Technical field
The invention belongs to metal ion detection field, more particularly, to a kind of lead ion quick visualization detection method.
Background technology
Lead can result in the pollution of environment and endanger the healthy of the mankind as a Heavy Metallic Elements.Lead is to man-machine
The infringement of body is in multisystem, multiple organ, to medulla hematopoietic system, cardiovascular system, immune system, nervous system and can be disappeared
Change system etc. causes toxic action；Which is as a kind of central nervous system's poisonous substance, even more serious to the nervous system damage of child.
During lead is discharged into environment, rear major part can be entered in soil, then is entered in human body by grain and vegetable etc..Many countries are right
Environment and Lead Content in Foodstuff are made that regulation.Such as China《Standard of soil environment quality》To the lead ion in the II class soil of farmland
Maximum concentration is limited as 50nM, EPA is defined to 72nM to the lead ion in drinking water.Therefore, set up highly sensitive
Lead detection method is particularly significant.
At present conventional lead detection method have GFAAS, fluorescent spectrometry, ultraviolet spectrophotometry,
Electrochemical methods, inductively coupled plasma mass spectrometry and dithizone colorimetric method etc..These methods often have preferable spirit
Sensitivity, can meet the detection of above-mentioned standard；But these methods are almost required for the instrument of costliness and quite professional operation, only
Be adapted to detection be completed in experiment interior, therefore it is particularly significant to study easy high sensitivity lead ion method for quick.
Gold mark chromatographic test paper is high due to having the advantages that convenient and swift, low cost and sensitivity, has been widely used for various
The detection of object, has the Test paper that researcher have studied lead based on DNA enzymatic at present.DNA enzymatic is that a class can be by external
The DNA fragmentation with catalysis activity that synthesis is obtained, some DNA enzymatics are found specifically produce sound to some metal ions
Should, wherein especially most noticeable with the 8-17DNA enzymes responded to lead ion.In the presence of lead ion, its base chain can be
It is cut open at rA, forefathers have developed lead ion detection technique in various solution accordingly.But further investigation revealed that, should
DNA enzymatic in addition to having more special response to lead ion, Zn2+, Mn2+,Cr2+And Co2+There is certain interference to the enzyme.In addition,
Based on DNA enzymatic lead ion chromatographic test paper research in, due to often exist in solution it is single-stranded retain, they can be with reference on reagent paper
Complementary probe so as to cause false-positive result, disturb the detection of lead ion, affect the accuracy of testing result.Furthermore, it is existing
A kind of gold mark probe is coated with the gold standard pad of some chromatographic test papers only, the service efficiency that fragment is produced after enzyme action is low, while inspection
Survey sensitivity not high.
The content of the invention
For the disadvantages described above or Improvement requirement of prior art, the invention provides a kind of detection of lead ion quick visualization
Method, its object is to, by processing DNA enzymatic using graphene oxide, adsorb unreacted free single-chain nucleic acid, in combination with
Double gold mark probe techniques, produce the service efficiency of fragment, and then improve detection sensitivity after improving enzyme action, thus solve existing
The detection of the false positive results interference lead ion occurred in having lead ion chromatographic test paper detection of the technology based on DNA enzymatic, detection spirit
Sensitivity is low and the technical problem of other impurities ion interference testing result.
For achieving the above object, according to one aspect of the present invention, there is provided a kind of lead ion quick visualization detection side
Method, the detection method include the preparation process of loading working solution, and the preparation of the loading working solution adopts single stranded DNA adsorbent
It is free single-stranded after the base chain GR-5S and enzyme chain GR-5E reaction completely of absorption GR-5 DNA enzymatics, for eliminate it is free it is single-stranded
The false positive interference produced during lead ion analysis.
Preferably, the single stranded DNA adsorbent is graphene oxide or nanometer gold, preferably graphene oxide.
Preferably, the mass concentration ratio of base chain GR-5S, the enzyme chain GR-5E and graphene oxide of the GR-5 DNA enzymatics is
1:0.3～2:16.6～83.2, preferably 1:1.5:52.
Preferably, the detection method also includes the preparation process of gold mark probe, and the preparation of the gold mark probe is according to such as
Lower step is carried out：First single stranded DNA of sulfydryl modification is added in nano-Au solution and prepares the first gold medal mark probe, by mercapto
Second single stranded DNA of base modification prepares the second gold medal mark probe in being added to nano-Au solution.
Preferably, the detection method specifically includes following steps：
1) preparation of gold mark probe：
The preparation of the first gold medal mark probe：First single stranded DNA of sulfydryl modification is added in nano-Au solution, 24h is reacted,
Add phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C from
Heart 25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the first gold medal mark probe for preparing；
The preparation of the second gold medal mark probe：Second single stranded DNA of sulfydryl modification is added in nano-Au solution, 24h is reacted,
Add phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C from
Heart 25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the second gold medal mark probe for preparing；
2) preparation of gold standard pad：Glass fibre membrane is processed into buffer immersion treatment 0.5h with gold standard pad, then at 37 DEG C
1h being dried, then with gold mark gold spraying instrument by step 1) the first gold medal mark probe for preparing and the second gold medal mark probe be according to mol ratio
0.25～4:1, preferably 2:3, it is fixed on the glass fibre membrane, 37 DEG C are dried 1h, obtain the gold standard pad for preparing；It is described
The metal spraying concentration of gold spraying instrument is 4 μ L/cm；
3) preparation of detection line and nature controlling line：Rule with the amount of 1 μ L/cm on nitrocellulose filter with film instrument is drawn, detection
The 3rd biotinylated probes and the 4th biotinylated probes are fixed on line, the 5th biotinylated probes and the 6th biotin on nature controlling line, is fixed
Probe, the distance between the detection line and nature controlling line are 3～6mm；
4) preparation of loading working solution：The base chain GR-5S and enzyme chain GR-5E of GR-5 DNA enzymatics is dissolved in buffer solution, and 95
DEG C water-bath 5min, is slowly cooled to room temperature, and adds graphene oxide solution mix homogeneously, reacts 0.5～2h, preferred 1h, centrifugation
Graphene oxide is removed, and supernatant is taken as loading working solution；Base chain GR-5S, the enzyme chain GR-5E of the GR-5 DNA enzymatics and oxygen
The mass concentration ratio of graphite alkene is 1:0.3～2:16.6～83.2, preferably 1:1.5:52；
5) analysis of testing sample：Take step 4) the loading working solution that obtains, testing sample is added, loading is obtained to be measured
Liquid, loading prepare liquid is dropped in sample pad, chromatography reaction 5min, 5 × SSC is added sample pad cleaning test strips, after 15min
The detection line and nature controlling line of test strips can see the band of redness, and band intensity analyzes gray value with test strips image analyzer,
The concentration of lead ion in testing sample is calculated by standard curve.
Preferably, in step (1) nano-Au solution, the particle size of nanometer gold is 13～35nm.
Preferably, step (4) buffer solution is PBS, HEPES, Tris-Ac or sodium citrate buffer, preferably
For sodium citrate buffer, more preferably 5 × sodium citrate buffer.
Preferably, step (4) centrifugal rotational speed is not less than 10000rpm, and centrifugation time is not less than 10min.
According to another aspect of the present invention, there is provided a kind of lead ion gold mark chromatograph test strip, the gold mark chromatography examination
Paper slip includes sample pad, gold standard pad, nitrocellulose filter and the absorbent paper being mounted on base plate successively, the loading of the sample pad
Working solution has adsorbed free single-stranded for Jing graphene oxides after the base chain GR-5S and enzyme chain GR-5E complementary pairings of GR-5 DNA enzymatics
Lead ion solution；The gold standard pad is fixed with the first gold medal mark probe and the second gold medal mark probe；On the nitrocellulose filter
There are detection line and nature controlling line, in the detection line, be fixed with the 3rd biotinylated probes and the 4th biotinylated probes, the nature controlling line
On be fixed with the 5th biotinylated probes and the 6th biotinylated probes.
Preferably, a base chain GR-5S sequences part for the GR-5 DNA enzymatics is complementary with the first gold medal mark probe sequence, one
Divide complementary with the 3rd biotin probe sequence, form sandwich structure, for the colour developing in detection line, the enzyme of the GR-5 DNA enzymatics
A chain GR-5E sequences part is complementary with the second gold medal mark probe sequence, and a part is complementary with the 4th biotinylated probes sequence, forms folder
Core structure, for the colour developing in detection line.
In general, by the contemplated above technical scheme of the present invention compared with prior art, can obtain down and show
Beneficial effect.
(1) present invention processes sample using Graphene by being formed to hybridization after DNA enzymatic, by free single-stranded basic removing
And impact is had no on DNA enzymatic activity, effectively eliminate the interference of false positive results；
(2) by two kinds of gold mark probes in spraying in the gold standard pad of chromatographic test paper, after improve enzyme action, produce fragment
Service efficiency, while obtaining higher detection sensitivity；, in its plumbum ion concentration detection range, testing sample is molten for the present invention
Liquid is added in sample pad, and after 15min, detection line can obtain macroscopic red stripes, and present invention gold mark chromatographic test paper is realized
High-sensitivity rapid detection to lead ion, test limit reach 0.05nM, can meet the detection requirement of relevant criterion；
(3) about 1.8 yuan of the single testing cost of the gold mark chromatographic test paper of the present invention, cost is very low, answers with good
With value；
(4) present invention selects the GR-5 DNA enzymatics for having more high selectivity to lead ion, the enzyme to have more special to lead ion
Response, and to Pb2+Selectivity be Zn2+4000 times, in significantly reducing sample, foreign ion is done to detection
Disturb.
Description of the drawings
Fig. 1 is the sequence of the GR-5 DNA enzymatics of present invention design；
Fig. 2 is the gold mark chromatographic test paper detection principle diagram of lead ion of the present invention；
Fig. 3 is the graph of a relation of 1 band intensity of the embodiment of the present invention and plumbum ion concentration；Wherein, A is canonical plotting, and B is
Gold mark chromatograph test strip pictorial diagram, detection signal intensity when C is low concentration lead ion；
Fig. 4 is gold mark chromatographic test paper pictorial diagram after the oxidized Graphene of 3 loading working solution of the embodiment of the present invention is processed；
Fig. 5 is specific detection of the 4 gold medal mark chromatograph test strip of the embodiment of the present invention to lead ion.
Specific embodiment
In order that the objects, technical solutions and advantages of the present invention become more apparent, it is below in conjunction with drawings and Examples, right
The present invention is further elaborated.It should be appreciated that specific embodiment described herein is only to explain the present invention, and
It is not used in the restriction present invention.As long as additionally, technical characteristic involved in invention described below each embodiment
Do not constitute conflict each other can just be mutually combined.
A kind of lead ion quick visualization detection method that the present invention is provided, belongs to a kind of gold mark based on GR-5 DNA enzymatics
Chromatographic test paper method, is lead ion gold mark chromatographic test paper quick visualization detection method in a kind of environment of graphene oxide auxiliary.
Base chain and enzyme chain according to GR-5 DNA enzymatics are formed after certain mixed in molar ratio hybridization, are added graphene oxide to process by the method
Unreacted free single-chain nucleic acid is removed, False Positive Effect is excluded, two kinds of gold mark probes are sprayed with gold standard pad, the first gold medal mark is visited
Pin (gold mark probe 1 in Fig. 2) and the second gold medal mark probe (gold mark probe 2 in Fig. 2), detection line is fixed with the 3rd biotinylated probes
(biotinylated probes 3 in Fig. 2) and the 4th biotinylated probes (biotinylated probes 4 in Fig. 2), nature controlling line are fixed with the spy of the 5th biotin
Pin (biotinylated probes 5 in Fig. 2) and the 6th biotinylated probes (biotinylated probes 6 in Fig. 2), addition treat test sample by pretreatment
Two chains (base chain GR-5S and enzyme chain GR-5E) that product GR-5 DNA enzymatics are obtained after being cut open at rA, by chromatography effect and gold
Nucleotide sequence on mark probe and detection line forms sandwich structure, develops the color so as to be fixed in detection line, unnecessary free core
Acid is fixed on nature controlling line and develops the color.Plumbum ion concentration is obtained according to detection line colored intensity.The present invention can be in room temperature 15min
The detection of lead ion is inside completed, 0.05nM can be reached to the lowest detectable limit of lead ion, high specificity high with sensitivity,
Do not disturbed by other bivalent metal ions, operation is simple, may be directly applied to the detection of lead ion in environment.
A kind of lead ion gold mark chromatograph test strip that the present invention is provided, including the sample pad, gold that are mounted on base plate successively
Mark pad, nitrocellulose filter and absorbent paper, the gold standard pad are fixed with the first gold medal mark probe and the second gold medal mark probe；The nitric acid
There are detection line and nature controlling line on cellulose membrane, in the detection line, be fixed with the 3rd biotinylated probes and the 4th biotinylated probes,
The 5th biotinylated probes and the 6th biotinylated probes are fixed with the nature controlling line, the loading working solution of the sample pad is GR-5
After the base chain GR-5S and enzyme chain GR-5E complementary pairings of DNA enzymatic, Jing graphene oxides have adsorbed the molten of free single-stranded lead ion
Liquid.
The base chain (GR-5S) of the GR-5 DNA enzymatics in following examples, we term it sequence 1：5’-
GGTCTCACTATrAGGAAGAG ATGATGTCTGTCAGATGTAG-3 ', this sequence part are complementary with gold 1 sequence of mark probe,
A part is complementary with 3 sequence of biotinylated probes, forms sandwich structure, for the colour developing in detection line.
The enzyme chain (GR-5E) of the GR5-DNA enzymes in following examples, we term it sequence 2：5’-
GACATCATCTCTGAAGTAGCG CCGCCGTATAGTGAGACC-3 ', this sequence part are complementary with gold 2 sequence of mark probe,
A part is complementary with 4 sequence of biotinylated probes, forms sandwich structure, for the colour developing in detection line.
The first single stranded DNA in following examples：(SH is repaiied with sulfydryl 5 '-GACATCATCTCT-SH-3 ' for 3 ' end of DNA sequence
Decorations), its 5 '-AGAGATGATGTC-3 ' this partial sequence complementarity with base chain (sequence 1 in Fig. 2).
The second single stranded DNA in following examples：(SH is repaiied with sulfydryl 5 '-SH-GGTCTCACTATA-3 ' for 5 ' end of DNA sequence
Decorations), its 5 '-TATAGTGAGACC-3 ' this partial sequence complementarity with enzyme chain (sequence 2 in Fig. 2).
Biotinylated probes 3 in following examples：(biotin is DNA sequences to 5 '-biotin-AAAAAACTACATCTGACA-3 '
5 ' end biotin modification of row), its this partial sequence complementarity with the 5 '-TGTCAGATGTAG-3 ' of base chain.
Biotinylated probes 4 in following examples：(biotin is DNA sequences to 5 '-CGGCGCTACTTCAAAAAA-biotin-3 '
3 ' end sulfydryl modification of row), its this partial sequence complementarity with the 5 '-GAAGTAGCGCCG-3 ' of enzyme chain.
Biotinylated probes 5 in following examples：(biotin is DNA sequences to 5 '-AGAGATGATGTCAAAAAA-biotin-3 '
3 ' end biotin modification of row), which is complementary with gold 1 sequence of mark probe.
Biotinylated probes 6 in following examples：(biotin is DNA sequences to 5 '-biotin-AAAAAATATAGTGAGACC-3 '
5 ' end biotin modification of row), which is complementary with gold 2 sequence of mark probe.
Fig. 1 is the sequence of the GR-5 DNA enzymatics of present invention design；Fig. 2 is the gold mark chromatographic test paper detection of lead ion of the present invention
Schematic diagram.
The lead ion quick visualization detection method that the present invention is provided comprises the steps：
1) preparation of gold mark probe：
The preparation of the first gold medal mark probe：First single stranded DNA of sulfydryl modification is added in nano-Au solution, 24h is reacted,
Add phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C from
Heart 25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the first gold medal mark probe for preparing；
The preparation of the second gold medal mark probe：Second single stranded DNA of sulfydryl modification is added in nano-Au solution, 24h is reacted,
Add phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C from
Heart 25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the second gold medal mark probe for preparing；
Wherein, in nano-Au solution, the particle size of nanometer gold is 13～35nm, preferably 20nm, generally nanometer
The particle size of gold is bigger, and the sensitivity of detection is higher, but non-specific adsorption can occur and cause false-positive result, instead
It, particle diameter is less, it is not easy to false positive occur, but the sensitivity of detection can be reduced, and the nanometer gold of preferred 20nm is used for preparing
Gold mark probe.
20mM Na of the resuspended buffer for pH 7.43PO4, 5%BSA, 0.25%Tween 20 and 10% sucrose
Mixed solution.
The concentration of the first gold medal mark probe for preparing be 14nmol/L, the second gold medal mark probe for preparing
Concentration be 14nmol/L.
The service efficiency of GR-5 DNA enzymatic enzyme action post-fragments can be fully improved after two kinds of gold mark probes are sprayed in gold standard pad,
And individually gold mark probe can only use the DNA fragmentation of part, the sensitivity of another aspect nucleic acid hybridization to also ensure that system
Sensitivity, therefore the method for marking probe using two kinds of gold improves the sensitivity of lead ion detection.
2) preparation of gold standard pad：Glass fibre membrane is processed into buffer immersion treatment 0.5h with gold standard pad, then at 37 DEG C
1h being dried, then with gold mark gold spraying instrument by step 1) the first gold medal mark probe for preparing and the second gold medal mark probe be according to volume ratio
0.25～4:1, preferably 2:3, it is fixed on the glass fibre membrane, 37 DEG C are dried 1h, obtain the gold standard pad for preparing；
The the first gold medal mark probe prepared due to step (1) and the concentration of the second gold medal mark probe are identical, are 14nM, because
In this gold standard pad, the mol ratio of the first gold medal mark probe and the second gold medal mark probe is 0.25～4:1, preferably 2:3, two kinds of gold marks are visited
Pin is different with the binding ability of the single stranded DNA after GR-5 DNA enzymatic enzyme action, because gold mark sequence is different, therefore binding ability differs
Sample, the joint efficiency being optimal by the ratio for optimizing two kinds of gold mark probes, so as to improve sensitivity.
The metal spraying concentration of the gold spraying instrument is preferably 4 μ L/cm, and the volume that gold mark probe is sprayed in gold standard pad can affect reagent paper
The depth of bar colour developing, too low concentration and probe concentration can reduce the sensitivity of detection system, and too high concentration can cause non-specificity
Absorption, it is likely that bring certain false positive.
The gold standard pad process buffer for the 4%Triton of pH 8.0,1%BSA, 2% glucose, 2%PEG-4000,
The mixed solution of 100mM boric acid and 0.1%SDS.
3) preparation of detection line and nature controlling line：Rule with the amount of 1 μ L/cm on nitrocellulose filter with film instrument is drawn, detection
Biotinylated probes 3 and biotinylated probes 4 are fixed on line, biotinylated probes 5 and biotinylated probes 6, two lines on nature controlling line, are fixed
The distance between be 3～6mm, preferably 5mm.
4) preparation of loading working solution：The base chain GR-5S and enzyme chain GR-5E of GR-5 DNA enzymatics is dissolved in buffer solution, and 95
DEG C water-bath 5min, is slowly cooled to room temperature, and adds graphene oxide solution mix homogeneously, reacts 0.5～2h, preferred 1h, centrifugation
Graphene oxide is removed, and supernatant is taken as loading working solution.
The base chain GR-5S and enzyme chain GR-5E of GR-5 DNA enzymatics are adsorbed in the preparation of loading working solution using single stranded DNA adsorbent
That what is dissociated after reaction completely is single-stranded, for eliminating the free single-stranded false positive interference produced during lead ion analysis.Institute
Single stranded DNA adsorbent is stated for nanometer gold or graphene oxide, preferably graphene oxide.
The mass concentration ratio of base chain GR-5S, the enzyme chain GR-5E and graphene oxide of the GR-5 DNA enzymatics is 1:0.3～
2:16.6～83.2, preferably 1:1.5:52.In base chain and enzyme chain, one of single stranded DNA excess, can make which at utmost
Formation double-strand, under optimum adsorption time, the unconjugated free single-stranded Graphene that preferentially can be oxidized is combined, GR-5
Being adsorbed for DNA enzymatic double-strand minimum degree, will not thus reduce the sensitivity for detecting.
The addition of graphene oxide solution is unsuitable excessive or too small, and the response time for adding graphene oxide later is unsuitable
Long or too short, addition is too little or graphene oxide is incomplete to single-stranded absorption during the too short response time, addition it is excessive or
If response time is long, one section of single stranded DNA that the base chain GR-5S of GR-5 DNA enzymatics has more can also be oxidized Graphene absorption,
Cause the concentration of GR-5 DNA enzymatics to reduce, affect the sensitivity of subsequent detection.Therefore, the present invention is preferred by repetition test, obtains
The mass concentration ratio for going out base chain GR-5S, enzyme chain GR-5E and the graphene oxide of GR-5 DNA enzymatics is 1:0.3～2:16.6～
83.2, preferably 1:1.5:52, and after finding to add graphene oxide, the absorption straight chain reactions time is 0.5～2h, preferably
0.5～1h, more preferably 1h.
The centrifugal rotational speed is not less than 10000rpm, and centrifugation time is not less than 10min.The removal of graphene oxide is for rear
The detection process of continuous lead ion is extremely important, so the rotating speed and time when centrifugation is ensured, enables graphene oxide
Thoroughly it is removed, it is to avoid affect the carrying out of subsequent detection work.
The buffer solution is PBS, HEPES, Tris-Ac or sodium citrate buffer, preferably buffered sodium citrate
Solution.The concentration of the sodium citrate buffer is preferably the sodium citrate buffer of 5X.Sodium citrate buffer is normal
As the buffer of molecule hybridization, DNA can be reduced containing substantial amounts of sodium ion and chloride ion in sodium citrate buffer solution single-stranded
Intermolecular repulsion, make it is single-stranded be easy to be hybridized to double-strand, although other buffer also have sodium ion and chloride ion (Sodium Chloride electricity
Separate out what is come), but experimental result shows that sodium citrate buffer solution is better than other buffer.
5) analysis of testing sample：Take step 4) the loading working solution that obtains, add testing sample, the volume of testing sample
For 1/10th of loading working solution, loading prepare liquid is obtained, loading prepare liquid is dropped in sample pad, chromatography reaction 5min,
5 × SSC is added into sample pad cleaning test strips, the detection line and nature controlling line of test strips can see the band of redness, bar after 15min
Band strength analyzes gray value with test strips image analyzer, calculates the concentration of lead ion in testing sample by standard curve.
It is below embodiment：
Embodiment 1
A kind of quick visualization detection method of lead ion, comprises the steps：
(1) preparation of nano-Au solution：
By 100mL HAuCl4Aqueous solution (0.01%) injects one and is furnished with heating in the round-bottomed flask of reflux condensate device
To seething with excitement, then addition 2mL citric acid three sodium solutions (1%) in flask.Continue to be heated to reflux, solution under strong magnetic agitation
Color gradually become after peony by colourless, black, continue heating 10min, stop heating, be cooled to room temperature, with 0.22 μm
Nylon membrane filtration removes bulky grain, is stored in standby in the refrigerator that temperature is 4 DEG C.
(2) preparation of gold mark probe：
First single stranded DNA and the second single stranded DNA (100 μM, 1OD) of the sulfydryl modification of 45 μ L are added separately to 14mL to receive
In rice gold solution, 24h is reacted, add 100mmol/L PB (phosphate buffer) and 10%SDS (sodium lauryl sulphate) to make
PB and SDS final concentrations are respectively 9mmol/L and 0.1%, shaking table room temperature track vibration 30min, add 2M Sodium Chloride to make which dense eventually
Spend for 0.2M, aged at room temperature 2 days.4 DEG C of centrifugations 25min (12000rpm), abandon supernatant and remove unmodified DNA probe, red heavy
Form sediment resuspended with the resuspended buffer of 1mL, this process is in triplicate.Resuspended buffer finally with 700 μ L is resuspended, has obtained concentration and has been
The first gold medal mark probe of 14nM and the second gold medal mark probe that concentration is 14nM, 4 DEG C save backup.
(3) preparation of gold standard pad：
The glass fibre membrane of the suitable size of cutting, then processes buffer (4%Triton, 1%BSA, 2% with gold standard pad
Glucose, 2%PEG-4000,100mM boric acid, 0.1%SDS, pH 8.0) immersion treatment, 37 DEG C are dried 1h.Concentration is taken for 14nM
Gold mark probe 1 and concentration be the gold mark probe 2 of 14nM, metal spraying is carried out with the amount of 4 μ L/cm with a stroke film gold spraying instrument and is fixed, 37 DEG C
The volume ratio for being dried 1h, 4 DEG C of preservations, the first gold medal mark probe and the second gold medal mark probe is 2:3.
(4) preparation of detection line and nature controlling line：
Take 20 μ L streptavidins (1mg/ml), 15 μ L biotinylated probes 3 (100 μM) and 15 μ L biotinylated probes, 4 (100 μ
M), three's mix homogeneously, reacts 2h, for being scoring to detection line；20 μ L streptavidins (1mg/ml), 15 μ L lifes are taken equally
Thing element probe 5 (100 μM) and 15 μ L biotinylated probes 6 (100 μM), three's mix homogeneously react 2h, for being scoring to nature controlling line
On.Then drawing film instrument with metal spraying carries out the distance between line fixation, two lines with the amount of 1 μ L/cm on nitrocellulose filter
For 5mm, drying at room temperature 12h, 4 DEG C of preservations.
(5) preparation of loading working solution：
The base chain GR-5S and enzyme chain GR-5E of GR-5 DNA enzymatics is dissolved in 5 × SSC (pH 7.4, sodium citrate buffer solution) makes which
Final concentration is respectively 100nM (1.2 μ g/mL) and 150nM (1.8 μ g/mL), 95 DEG C of water-bath 5min are slowly cooled to room temperature, and needs altogether
Want 3h.To in above-mentioned solution, add the graphene oxide solution of 2mg/mL to make its final concentration of 62.5 μ g/mL, react 1h, absorption
Unreacted free single-chain nucleic acid, removes graphene oxide in 10500rpm centrifugation 10min, takes supernatant and work as loading
Liquid.
(6) drafting of standard curve：
The standard solution of the plumbum ion concentration gradient of 13 parts of standards is prepared, concentration is followed successively by 0mol/L, 5pmol/L,
10pmol/L, 50pmol/L, 100pmol/L, 500pmol/L, 1nmol/L, 5nmol/L, 10nmol/L, 100nmol/L, 1 μ
Mol/L, 10 μm of ol/L, 100 μm of ol/L.
The lead ion standard solution of 13 parts of variable concentrations is respectively added in loading working solution, 1h after mix homogeneously, is reacted, will
100 μ L load solutions are dropped in sample pad, chromatography reaction 5min, add sample pad cleaning to remain in gold standard pad and nitre 5 × SSC
The gold mark probe dissociated on acid cellulose film and single stranded DNA, after 15min, the detection line and nature controlling line of test strips can see redness
Band, band intensity with test strips image analyzer analysis gray value (band normalized intensity).
Fig. 3 A show that band normalized intensity is with increase with plumbum ion concentration.And work as plumbum ion concentration
In 10nmol/L～100 μm during ol/L, plumbum ion concentration is in good linear relationship with band normalized intensity；Fig. 3 B show lead
Pictorial diagram of the ion concentration in 10nmol/L～100 μm ol/L；Detection signal intensity of Fig. 3 C for low concentration lead ion, reagent paper
The lowest detectable limit (LOD) of bar is the normalization of the meansigma methodss plus 3 times of blank responses of the normalized intensity according to blank response
The standard deviation of intensity is obtained, it can be deduced that the lowest detection of lead ion is limited to 0.05nM.
(7) detection of testing sample
Excessive concentrated nitric acid solution is added in pedotheque to be measured, more than 90 DEG C is heated with stirring to but is not seethed with excitement, allow
Testing sample is all aoxidized by concentrated nitric acid dissolving, obtains the solution of nitrification；Then, the solution is allowed to be cooled to less than 60 DEG C,
Again excessive hydrogen peroxide is slowly added thereto, more than 90 DEG C is heated with stirring to but boiling is occurred, until no bubble is produced；
Resulting solution is cooled to into less than 60 DEG C again, adds excessive hydrochloric acid solution, agitating heating to occur without boiling, be incubated 10min～
1h；After being cooled to room temperature, resulting solution is filtered, evaporation and concentration, then use buffer constant volume, obtain to be measured after pretreatment
Sample, testing sample measure concentration 19.1nM containing lead ion after diluting 100 times according to the method described above.
Embodiment 2
A kind of lead ion gold mark chromatograph test strip that the present invention is provided, as shown in Fig. 2 including being mounted in PVC base plates successively
On sample pad, gold standard pad, nitrocellulose filter and absorbent paper, gold standard pad is fixed with the first gold medal mark probe, and (the gold mark in Fig. 2 is visited
1) He the second gold medal mark probe of pin (the gold mark probe 2 in Fig. 2)；There are detection line and nature controlling line on nitrocellulose filter, in detection line
The 3rd biotinylated probes (biotinylated probes 3 in Fig. 2) and the 4th biotinylated probes (biotinylated probes 4 in Fig. 2) are fixed with,
The 5th biotinylated probes (biotinylated probes 5 in Fig. 2) and the 6th biotinylated probes (biology in Fig. 2 are fixed with nature controlling line
Plain probe is 6).Base chain GR-5S and enzyme chain GR-5E adsorbs unnecessary free single-stranded through graphene oxide through complementary pairing, plus
Sample pad is added as load solution after entering lead ion.
The base chain (GR-5S) of GR-5 DNA enzymatics, we term it sequence 1：5’-GGTCTCACTATrAGGAAGAG
ATGATGTCTGTCAGATGTAG-3 ', this sequence part and gold mark probe 1 sequence complementation, a part and 3 sequence of biotinylated probes
Row are complementary, form sandwich structure, for the colour developing in detection line.
The enzyme chain (GR-5E) of GR5-DNA enzymes, we term it sequence 2：5’-GACATCATCTCTGAAGTAGCG
CCGCCGTATAGTGAGACC-3 ', this sequence part and gold mark probe 2 sequence complementation, a part and 4 sequence of biotinylated probes
Complementation, forms sandwich structure, for the colour developing in detection line.
For preparing the first single stranded DNA of the first gold medal mark probe：(SH is DNA sequence 3 ' to 5 '-GACATCATCTCT-SH-3 '
End sulfydryl modification), its 5 '-AGAGATGATGTC-3 ' this partial sequence complementarity with base chain.
For preparing the second single stranded DNA of the second gold medal mark probe：(SH is DNA sequence 5 ' to 5 '-SH-GGTCTCACTATA-3 '
End sulfydryl modification), its 5 '-TATAGTGAGACC-3 ' this partial sequence complementarity with enzyme chain.
Biotinylated probes 3：(biotin is that 5 ' end of DNA sequence is biological to 5 '-biotin-AAAAAACTACATCTGACA-3 '
Element modification), its this partial sequence complementarity with the 5 '-TGTCAGATGTAG-3 ' of base chain.
Biotinylated probes 4：(biotin is 3 ' end sulfydryl of DNA sequence to 5 '-CGGCGCTACTTCAAAAAA-biotin-3 '
Modification), its this partial sequence complementarity with the 5 '-GAAGTAGCGCCG-3 ' of enzyme chain.
Biotinylated probes 5：(biotin is that 3 ' end of DNA sequence is biological to 5 '-AGAGATGATGTCAAAAAA-biotin-3 '
Element modification), which is complementary with gold 1 sequence of mark probe.
Biotinylated probes 6：(biotin is that 5 ' end of DNA sequence is biological to 5 '-biotin-AAAAAATATAGTGAGACC-3 '
Element modification), which is complementary with gold 2 sequence of mark probe.
Embodiment 3
The false-positive elimination of ELISA test strip result：
Other specific implementation steps only difference is that the preparation of embodiment 1 step (5) loading working solution with embodiment 1
Whether using graphene oxide process, Fig. 4 A are the corresponding sample detection of loading working solution processed using graphene oxide
Colour developing result；Fig. 4 B are the colour developing result of the corresponding sample detection of loading working solution that not oxidised Graphene was processed, as a result
Show, after the loading working solution sample-adding after graphene oxide process, the detection line of gold mark chromatograph test strip is not almost any
Red stripes, the detection line without the gold mark chromatograph test strip after the loading working solution sample-adding that graphene oxide is processed have bright
Aobvious red stripes；Illustrate that graphene oxide is processed with this and can eliminate false-positive generation.
Embodiment 4
The chromatograph test strip of the present invention is to lead ion and the specificity experiments of other common metal ions：
The Hg of 5 μm ol/Ls is prepared respectively first2+, Ba2+, Cd2+, Zn2+, Cu2+, Co2+, Ni2+, Mn2+、Ca2+And 500nmol/L
Pb2+Standard solution, then prepare the biased sample of lead ion and other above-mentioned metal ions compositions so as to which middle lead ion is
500nmol/L, the concentration of other metal ions is all 5 μm of ol/L.
The preparation process of loading working solution is separately added into in loading working solution afterwards with 1 step of embodiment (4)
The Pb of 500nmol/L2+Standard solution, 5 μm of ol/L Hg2+、5μmol/L Ba2+、5μmol/L Cd2+、5μmol/L Zn2+、5μ
mol/L Cu2+、5μmol/L Co2+、5μmol/L Ni2+、5μmol/L Mn2+、5μmol/L Ca2+Standard solution and lead from
The biased sample that sub (500nmol/L) and other above-mentioned metal ions (5 μm of ol/L) constitute, 11 samples, mix respectively altogether
After uniform, reaction 1h, obtains 11 kinds of load solutions, then 100 μ L load solutions is dropped in sample pad, chromatography reaction 5min, by 5
× SSC adds sample pad cleaning test strips, and after 15min, the detection line and nature controlling line of test strips can see the band of redness, band
Intensity test strips image analyzer analysis gray value (band normalized intensity).
Fig. 5 is chromatograph test strip to lead ion and the specificity experiments of other common metal ions, it is found that at other
In the case that bivalent metal ion concentration is 10 times of lead ion, response of the lead ion to ELISA test strip system is far longer than other
Bivalent metal ion；The response of the biased sample of lead ion and other all metal ions compositions, substantially close to independent lead ion
When situation, illustrate that this ELISA test strip system has preferable capacity of resisting disturbance, with good specificity.
As it will be easily appreciated by one skilled in the art that the foregoing is only presently preferred embodiments of the present invention, not to
The present invention, all any modification, equivalent and improvement made within the spirit and principles in the present invention etc. are limited, all should be included
Within protection scope of the present invention.
SEQUENCE LISTING
<110>The Central China University of Science and Technology
<120>A kind of lead ion quick visualization detection method
<130> 08
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 40
<212> DNA
<213> GR-5S
<400> 1
ggtctcacta traggaagag atgatgtctg tcagatgtag 40
<210> 2
<211> 39
<212> DNA
<213> GR-5E
<400> 2
gacatcatct ctgaagtagc gccgccgtat agtgagacc 39
<210> 3
<211> 14
<212> DNA
<213>First single stranded DNA
<400> 3
gacatcatct ctsh 14
<210> 4
<211> 14
<212> DNA
<213>Second single stranded DNA
<400> 4
shggtctcac tata 14
<210> 5
<211> 18
<212> DNA
<213>Biotinylated probes 3
<400> 5
aaaaaactac atctgaca 18
<210> 6
<211> 18
<212> DNA
<213>Biotinylated probes 4
<400> 6
cggcgctact tcaaaaaa 18
<210> 7
<211> 18
<212> DNA
<213>Biotinylated probes 5
<400> 7
agagatgatg tcaaaaaa 18
<210> 8
<211> 17
<212> DNA
<213>Biotinylated probes 6
<400> 8
aaaaaatata gtgagac 17
Claims (10)
1. a kind of lead ion quick visualization detection method, it is characterised in that the detection method includes the system of loading working solution
Standby step, the preparation of the loading working solution adsorb the base chain GR-5S and enzyme chain GR- of GR-5DNA enzymes using single stranded DNA adsorbent
That what is dissociated after 5E reactions completely is single-stranded, for eliminating the free single-stranded false positive interference produced during lead ion analysis.
2. detection method as claimed in claim 1, it is characterised in that the single stranded DNA adsorbent is graphene oxide or receives
Meter Jin, preferably graphene oxide.
3. detection method as claimed in claim 2, it is characterised in that the base chain GR-5S of the GR-5DNA enzymes, enzyme chain GR-5E
Mass concentration ratio with graphene oxide is 1:0.3～2:16.6～83.2, preferably 1:1.5:52.
4. detection method as claimed in claim 1, it is characterised in that the detection method also includes the preparation step of gold mark probe
Suddenly, the preparation of the gold mark probe is carried out in accordance with the following steps：First single stranded DNA of sulfydryl modification is added to into nano-Au solution
In prepare the first gold medal mark probe, the second single stranded DNA of sulfydryl modification is added in nano-Au solution and prepares second
Gold mark probe.
5. detection method as claimed in claim 1, it is characterised in that the detection method specifically includes following steps：
1) preparation of gold mark probe：
The preparation of the first gold medal mark probe：First single stranded DNA of sulfydryl modification is added in nano-Au solution, reaction 24h, then plus
Enter phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C of centrifugations
25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the first gold medal mark probe for preparing；
The preparation of the second gold medal mark probe：Second single stranded DNA of sulfydryl modification is added in nano-Au solution, reaction 24h, then plus
Enter phosphate buffer and dodecyl sodium sulfate, mixed at room temperature 30min adds Sodium Chloride aged at room temperature 2 days, 4 DEG C of centrifugations
25min, abandons supernatant, precipitates resuspended with resuspended buffer, obtains the second gold medal mark probe for preparing；
2) preparation of gold standard pad：Glass fibre membrane is processed into buffer immersion treatment 0.5h with gold standard pad, then in 37 DEG C of dryings
1h, then with gold mark gold spraying instrument by step 1) the first gold medal mark probe for preparing and the second gold medal mark probe be according to mol ratio 0.25
～4:1, preferably 2:3, it is fixed on the glass fibre membrane, 37 DEG C are dried 1h, obtain the gold standard pad for preparing；The metal spraying
The metal spraying concentration of instrument is 4 μ L/cm；
3) preparation of detection line and nature controlling line：Rule with the amount of 1 μ L/cm on nitrocellulose filter with film instrument is drawn, in detection line
The 3rd biotinylated probes and the 4th biotinylated probes are fixed, the 5th biotinylated probes is fixed on nature controlling line and the 6th biotin is visited
Pin, the distance between the detection line and nature controlling line are 3～6mm；
4) preparation of loading working solution：The base chain GR-5S and enzyme chain GR-5E of GR-5DNA enzymes is dissolved in buffer solution, 95 DEG C of water-baths
5min, is slowly cooled to room temperature, and adds graphene oxide solution mix homogeneously, reacts 0.5～2h, preferred 1h, and deoxygenation is gone in centrifugation
Graphite alkene, takes supernatant as loading working solution；Base chain GR-5S, the enzyme chain GR-5E of the GR-5DNA enzymes and graphite oxide
The mass concentration ratio of alkene is 1:0.3～2:16.6～83.2, preferably 1:1.5:52；
5) analysis of testing sample：Take step 4) the loading working solution that obtains, testing sample is added, loading prepare liquid is obtained, will
Loading prepare liquid is dropped in sample pad, chromatography reaction 5min, and 5 × SSC is added sample pad cleaning test strips, reagent paper after 15min
The detection line and nature controlling line of bar can see the band of redness, and band intensity is analyzed gray value with test strips image analyzer, passed through
Standard curve calculates the concentration of lead ion in testing sample.
6. detection method as claimed in claim 5, it is characterised in that in step (1) nano-Au solution nanometer gold
Particle size is 13～35nm.
7. detection method as claimed in claim 5, it is characterised in that step (4) buffer solution be PBS, HEPES,
Tris-Ac or sodium citrate buffer, preferably sodium citrate buffer, more preferably 5 × sodium citrate delay
Rush solution.
8. detection method as claimed in claim 5, it is characterised in that step (4) centrifugal rotational speed is not less than 10000rpm,
Centrifugation time is not less than 10min.
9. a kind of lead ion gold marks chromatograph test strip, it is characterised in that the gold mark chromatograph test strip includes being mounted in bottom successively
Sample pad, gold standard pad, nitrocellulose filter and absorbent paper on plate, the loading working solution of the sample pad is GR-5DNA enzymes
After base chain GR-5S and enzyme chain GR-5E complementary pairings, Jing graphene oxides have adsorbed the solution of free single-stranded lead ion；The gold
Mark pad is fixed with the first gold medal mark probe and the second gold medal mark probe；There are detection line and nature controlling line on the nitrocellulose filter, it is described
The 3rd biotinylated probes and the 4th biotinylated probes are fixed with detection line, the 5th biotinylated probes on the nature controlling line, are fixed with
With the 6th biotinylated probes.
10. gold as claimed in claim 9 marks chromatograph test strip, it is characterised in that the base chain GR-5S sequences of the GR-5DNA enzymes
A row part is complementary with the first gold medal mark probe sequence, and a part is complementary with the 3rd biotin probe sequence, forms sandwich structure, uses
Colour developing in detection line, an enzyme chain GR-5E sequences part for the GR-5DNA enzymes are complementary with the second gold medal mark probe sequence, and one
Part is complementary with the 4th biotinylated probes sequence, forms sandwich structure, for the colour developing in detection line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610960837.XA CN106546730B (en) | 2016-10-28 | 2016-10-28 | A kind of lead ion visible detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610960837.XA CN106546730B (en) | 2016-10-28 | 2016-10-28 | A kind of lead ion visible detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106546730A true CN106546730A (en) | 2017-03-29 |
| CN106546730B CN106546730B (en) | 2018-07-24 |
Family
ID=58394073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610960837.XA Expired - Fee Related CN106546730B (en) | 2016-10-28 | 2016-10-28 | A kind of lead ion visible detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106546730B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321633A (en) * | 2018-10-25 | 2019-02-12 | 西安交通大学 | Detection of nucleic acids test paper, preparation method and detection method |
| CN109557155A (en) * | 2019-01-17 | 2019-04-02 | 杭州电子科技大学 | It is a kind of based on graphene-In Glassy Carbon Electrode Modified With Nano-gold preparation method and application |
| CN113049578A (en) * | 2021-03-15 | 2021-06-29 | 宁波大学 | DNA enzyme and application thereof, and copper ion detection test paper based on DNA enzyme and preparation method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1910282A (en) * | 2004-01-13 | 2007-02-07 | 伊利诺斯大学理事会 | Biosensors based on directed assembly of particles |
| CN101655494A (en) * | 2009-09-17 | 2010-02-24 | 暨南大学 | Fast detection test paper tape of lead ion aurosol immune layer as well as preparation method and application thereof |
| CN102352413A (en) * | 2011-10-17 | 2012-02-15 | 中国科学院广州生物医药与健康研究院 | Nucleic acid nano-Au biosensor for detecting lead ions and preparation method thereof |
| CN102426239A (en) * | 2011-09-16 | 2012-04-25 | 王利兵 | Colloidal gold chromatographic test strip for rapidly testing lead ion |
-
2016
- 2016-10-28 CN CN201610960837.XA patent/CN106546730B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1910282A (en) * | 2004-01-13 | 2007-02-07 | 伊利诺斯大学理事会 | Biosensors based on directed assembly of particles |
| CN101655494A (en) * | 2009-09-17 | 2010-02-24 | 暨南大学 | Fast detection test paper tape of lead ion aurosol immune layer as well as preparation method and application thereof |
| CN102426239A (en) * | 2011-09-16 | 2012-04-25 | 王利兵 | Colloidal gold chromatographic test strip for rapidly testing lead ion |
| CN102352413A (en) * | 2011-10-17 | 2012-02-15 | 中国科学院广州生物医药与健康研究院 | Nucleic acid nano-Au biosensor for detecting lead ions and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| ZHIYUAN FANG ET AL: "Lateral flow nucleic acid biosensor for Cu2+ detection in aqueous solution with high sensitivity and selectivity", 《CHEM. COMMUN 》 * |
| 赵旭华: "基于DNA酶和氧化石墨烯的高灵敏荧光生物传感体系的研究", 《中国博士学位论文全文数据库信息科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109321633A (en) * | 2018-10-25 | 2019-02-12 | 西安交通大学 | Detection of nucleic acids test paper, preparation method and detection method |
| CN109321633B (en) * | 2018-10-25 | 2020-08-25 | 西安交通大学 | Nucleic acid detection test paper, preparation method and detection method |
| CN109557155A (en) * | 2019-01-17 | 2019-04-02 | 杭州电子科技大学 | It is a kind of based on graphene-In Glassy Carbon Electrode Modified With Nano-gold preparation method and application |
| CN113049578A (en) * | 2021-03-15 | 2021-06-29 | 宁波大学 | DNA enzyme and application thereof, and copper ion detection test paper based on DNA enzyme and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106546730B (en) | 2018-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhong et al. | Synthesis of catalytically active carbon quantum dots and its application for colorimetric detection of glutathione | |
| Liu et al. | Cd-aptamer electrochemical biosensor based on AuNPs/CS modified glass carbon electrode | |
| Xiang et al. | Carbon dots based dual-emission silica nanoparticles as ratiometric fluorescent probe for nitrite determination in food samples | |
| Luo et al. | Fluorescent aptasensor for antibiotic detection using magnetic bead composites coated with gold nanoparticles and a nicking enzyme | |
| Hu et al. | Aptamer-based colorimetric biosensing of abrin using catalytic gold nanoparticles | |
| Ouyang et al. | A facile aptamer-regulating gold nanoplasmonic SERS detection strategy for trace lead ions | |
| CN105296598B (en) | Based on the lead ion fluorescence detection method of 8-17DNAzyme principle and its application | |
| Zhao et al. | A label-free colorimetric sensor for sulfate based on the inhibition of peroxidase-like activity of cysteamine-modified gold nanoparticles | |
| Li et al. | Development of a terminal-fixed aptamer and a label-free colorimetric aptasensor for highly sensitive detection of saxitoxin | |
| Chen et al. | Highly sensitive detection of ochratoxin A based on bio-barcode immunoassay and catalytic hairpin assembly signal amplification | |
| Huang et al. | Protamine-gold nanoclusters as peroxidase mimics and the selective enhancement of their activity by mercury ions for highly sensitive colorimetric assay of Hg (II) | |
| CN106546730B (en) | A kind of lead ion visible detection method | |
| Chen et al. | Sensitive colorimetric detection of K (I) using catalytically active gold nanoparticles triggered signal amplification | |
| CN107064515B (en) | A kind of copper ion detection method and detection kit based on click chemistry | |
| WO2009144914A1 (en) | G-quadruplex detection method, g-quadruplex dna detection method, and telomerase activity measurement method | |
| CN113406329A (en) | Universal aptamer colloidal gold lateral chromatography test paper for detecting small molecular substances | |
| Xie | Colorimetric determination of Hg (II) via the gold amalgam induced deaggregation of gold nanoparticles | |
| Dai et al. | Label-free fluorescence detection of mercury ions based on the regulation of the Ag autocatalytic reaction | |
| CN110646486A (en) | Lead ion alternating current impedance sensor research based on hybrid chain reaction and TdT regulation and control dual signal amplification | |
| Zeng et al. | Zero background and triple-signal amplified fluorescence aptasensor for antibiotics detection in foods | |
| Zhou et al. | Graphene oxide-gated mesoporous silica nanocontainers using aptamers for arsenite detection with glucometer readout | |
| Gu et al. | Development of ochratoxin aptasensor based on DNA metal nanoclusters | |
| Weng et al. | Plasmonic sensing of CTAB in gold nanorods solution based on Cu (II) ions-mediated H 2 O 2 etching effect | |
| Wei et al. | A label-free Exonuclease I-assisted fluorescence aptasensor for highly selective and sensitive detection of silver ions | |
| Song et al. | A DNA functionalized porphyrinic metal-organic framework as a peroxidase mimicking catalyst for amperometric determination of the activity of T4 polynucleotide kinase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180724 Termination date: 20191028 |