CN106497931B - A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease - Google Patents
A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease Download PDFInfo
- Publication number
- CN106497931B CN106497931B CN201610928829.7A CN201610928829A CN106497931B CN 106497931 B CN106497931 B CN 106497931B CN 201610928829 A CN201610928829 A CN 201610928829A CN 106497931 B CN106497931 B CN 106497931B
- Authority
- CN
- China
- Prior art keywords
- aptamers
- her3
- her3ecd
- ssdna
- breast cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57415—Specifically defined cancers of breast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/71—Assays involving receptors, cell surface antigens or cell surface determinants for growth factors; for growth regulators
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Fas lignand system evolution technology (the systematic evolution of ligands by exponential enrichment that the invention discloses a kind of by index concentration, what SELEX) screening obtained is directed to HER3 extracellular region protein (extracellular domain, ECD) high-affinity, highly selective DNA aptamers.The present invention further proves that the aptamers either still all have certain specificity and compatibility to the breast cancer cell of high expression Her3ECD albumen to free Her3ECD by ELISA, cell streaming, laser co-focusing experiment, and the diagnoses and treatment for the highly expressed related disease of HER3 provides new thinking.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to special with the extracellular domain (Her3ECD) of epidermal growth factor HER3
The ssDNA aptamers and its application in diagnoses and treatment HER3 related disease that the opposite sex combines.
Background technique
HER3 is also known as ErbB3, LCCS2, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, c-erbB-3, p180-
ErbB3, p45-sErbB3, p85-sErbB3 are one of tyrosine kinase epidermal growth factor family members, and size is
161kDa.People's HER3 assignment of genes gene mapping is in chromosome 12q13.The family is by 4 member compositions, in addition to HER3, there are also EGFR,
HER2,HER4.Every member is made of three parts again, is extracellular region ligand binding domain, transmembrane region, intracellular kinase respectively
Area.The extracellular region of HER3 has neuregulin binding site but intracellular without kinase activity.Therefore, it is necessary to the family other
Member could activate MAPK, PI3K-Akt access after forming heterodimer, participate in including that breast cancer, lung cancer, head and neck cancer etc. are more
Kind tumor development.
Set about researching and developing anticancer drug as target spot using HER3 currently, having more companies both at home and abroad, HER3 inhibitor includes
The seribantumab (MM-121) of Merrimack pharmacy, is currently in III phase clinical stage；GlaxoSmithKline PLC
GKS2849330 is in I phase clinical development；And under Roche Genentech the two-way inhibitor of HER3/EGFR
MEHD7945A is in research and development mid-term.
The inhibitor medicaments of targeting Her3ECD can be applied in the disease model that HER3 is overexpressed, comprising: 1) HER3 exists
High expression in the tumor of breast that HER2 is mediated.It can cause tumor shrinkage after striking low HER3 expression in HER2 high expression tumour, with
It strikes low HER2 effect to inhibit, and strikes the abatement that low EGFR does not cause tumour then in the tumor model, furthermore clinical samples detect
Show to express in breast cancer sample in HER2 high, HER3 high expression and the high expression of HER2 have a high consistency, and EGFR with
Without this correlation, the studies above highlights unique, key effect of the HER3 in HER2 carcinogenic mechanism for the expression of HER2.2)
HER3 high expression in melanoma.HER3 may be shown in melanoma as the synergistic effect molecule of EGFR and/or HER4
High expression is write, and related to the grade malignancy of disease and poor prognosis.3) highly expressed incidence of the HER3 in lung cancer is 18%-
100%, especially to EGFR tyrosine kinase inhibitor (tyrosine kinase inhibitor, TKI) Gefitinib
(gefitinib) drug resistant non-small cell lung cancer (non-small lung cell lung carcinomas, NSCLC) is treated
In, compared with the NSCLC sensitive with treatment, HER3 high expression rate is 100%, in addition, in NSCLC patient, HER3 high expression
It is short with significant correlation with its brain metastes, life cycle.4) HER3 significantly high expression in children's osteosarcoma；5) HER3 is certain
High expression (expression rate is between 10-90%) in the prostate cancer of type, colon cancer and oophoroma, although its participation mechanism is not yet
Illustrate, but can specify HER3 high expression with its it is high shift, poor prognosis it is closely related.
In recent years, promising substitution molecule of the oligonucleotides aptamers as antibody molecule, research more induces one to infuse
Mesh.Aptamers are Fas lignand system evolution technology (the systematic evolution ofligands by of exponential enrichment
Exponential enrichment, SELEX) from single-stranded random oligonucleotide library screening obtain can be high special with target
Property, high-affinity combine ligand.Aptamers have target molecule in extensive range；High specific and compatibility；With the knot of target molecule
Conjunction condition is controllable, easily artificial synthesized；Stability is good, easily modifies；The advantages such as molecule is small, and steric hindrance is small.And as low immune
" antibody analog " of originality, aptamers class target therapeutic agent have been applied to kinds cancer, macular degeneration, vascular blood friend
The treatment of the diseases such as disease, diabetes, while also can be used as the targeting ligand of drug, develop aptamers-drug conjugates
(aptamer-drug conjugates, ApDCs) assists drug to discharge in specific tissue site.From current research and clinic
From the point of view of test, aptamers provide a good platform for targeted therapy.And some drugs have passed through on FDA authentication approval
City shows huge application prospect in biomedicine field.
Less for the aptamers research of Her3ECD at present, only 2003 document reports have for Her3ECD at present
There are the RNA aptamers of higher affinity, but subsequent again without report.Based on HER3 in the generation of kinds cancer, development, drug resistance and pre-
Play very important role in afterwards, possible application of the present invention is in the diagnosis, treatment and correlative study of HER3 associated cancer.
Summary of the invention
It is an object of that present invention to provide the ssDNA aptamers that a kind of couple of Her3ECD has high-affinity highly selective.
The method of the present invention utilization index grade is enriched with the phyletic evolution technology (SELEX technology) of ligand, and selecting Her3ECD is target egg
It is white.Her3ECD aptamers-drug conjugates (ApDCs) delivery system is constructed, to its targeting, tumor-inhibiting action and related mechanism
It is studied, provides reference for the research and development of similar drugs.
The purpose of the present invention can be achieved by the following measures: the target protein Her3ECD antigen that the present invention is directed to pass through by
Her3ECD plasmid is transiently transfected to 293E cell and is expressed, and albumen size is 100kDa, and culture medium is collected after three days and carries out nickel column
Purifying obtains.
The folding of adaptability can occur in the presence of target molecule for the aptamers in solution of the present invention, will form
The special three-D space structures such as hair clip, stem ring, false knot, bulge loop, the G- tetramer pass through hydrogen bond, hydrophobic sedimentation, Van der Waals
The combination of power etc. and target molecule in close embodies higher affinity.
On the one hand, the present invention provides the ssDNA aptamers of energy specific recognition Her3ECD.
In preferred embodiments, ssDNA aptamers of the present invention, which have, is selected from SEQ ID NO:1 or SEQ ID
Nucleotide sequence shown in NO:2.
Aptamers of the present invention are also possible to RNA, and document report RNA aptamers generally show it is higher affine
Power, but RNA stablizes not as good as ssDNA, and there are bigger difficulty during screening and patent medicine.
Aptamers of the present invention for Her3ECD express breast cancer through free Her3ECD albumen and two kinds of HER3 high
The verifying of cell line MCF7, BT474 has preferable specificity and compatibility.Through ELISA, cell streaming, laser co-focusing experiment
Confirm that aptamers of the present invention have preferable compatibility and specificity to the highly expressed breast cancer cell line of Her3ECD.
Therefore, on the other hand, the present invention provides the reagents for diagnosis of Her-2 3ECD high expression breast cancer, wherein containing
SsDNA aptamers of the present invention.
On the other hand, it the present invention provides the DNA chip for diagnosis of Her-2 3ECD high expression breast cancer, is fixed with thereon
SsDNA aptamers of the present invention.
On the other hand, the present invention provides the pharmaceutical compositions for treating Her3ECD high expression breast cancer, wherein containing
SsDNA aptamers of the present invention.
On the other hand, the present invention provides the ssDNA aptamers in the preparation highly expressed breast cancer diagnosis of Her3ECD
Purposes in reagent.
On the other hand, the present invention provides the ssDNA aptamers expresses breast cancer for Her3ECD high in preparation
Purposes in target therapeutic agent.
Aptamers of the invention are easy to get, and can largely be synthesized, and are easy to be chemically modified transformation, stability
It is good, fluorine or the modification of oxygen methyl, or the polyethylene glycol or cholesterol of connection high molecular weight can be subject to by 2 ' position of glucosides, it is clear to reduce kidney
Except rate, improve its pharmacokinetics.Aptamers can also be connect with nanoparticle after stablizing sex modification, be realized to chemotherapeutic, nucleic acid etc.
The targeted delivery of drug.It can be seen that aptamers no matter clinical diagnosis or in terms of be all widely used.
Beneficial effects of the present invention:
The aptamers of Her3ECD high-affinity high specific of the invention, can be transformed by chemical modification, be applied to HER3
Highly expressed related disease diagnosing and treating, can be by building targeted delivery systems in the base for improving drug effect, reducing toxic side effect
The targeted delivery to chemotherapeutic, nucleic acid drug is realized on plinth.Shown HER3 diseases related includes that EGFR Antybody therapy fails
Type lung cancer, HER2 positive type antibody class Drug-resistant type breast cancer, cervical carcinoma etc..The targeted fit body can be also used for and HER3
The application study of the medicine such as relevant scientific research or tumour or pharmacy.
Sequence of the present invention is as follows:
7#GGGAGCTCAGAATAAACGCTCAAAGGGTCAAGCTGATTACACTTTGTCCACTATTGGGTCCTTCGA
CATGAGGCCCGGATC
13#GGGAGCTCAGAATAAACGCTCAAGGCTAACAGCACGCAACGGGGGGGAGTAATCGTGTCTGTTCG
ACATGAGGCCCGGATC
Detailed description of the invention
What Fig. 1 was illustrated is the secondary structure figure of Her3ECD aptamers of the present invention；
What Fig. 2 was illustrated is the binding specificity of cell flow cytometer detection aptamers of the present invention and MCF-7 cell；
The Binding experiment of Fig. 3 cell flow cytometer detection aptamers and BT474 cell；
Definition
Reference works, patent, patent application and scientific literature mentioned in the present invention, have constituted those skilled in the art
There is knowledge, be hereby incorporated by reference as a whole, range when being specially individually incorporated herein by reference with these documents is identical.?
If any any conflict between the introduced document of the application and this specification specific meanings, it should all be subject to the latter.In addition, ability
The definition that the special explanation of the vocabulary or phrase is fixed in the Rational Solutions and this specification that domain defines vocabulary and phrase
Between if any conflict, be all subject to the latter.
Before the present invention is further explained, we are specific the invention is not limited to description it is necessary to recognize
Embodiment, that is to say, that there may be variations on concrete form.There are also any it is noted that, due to the present invention
Range limited by appended claims, therefore, terms used herein are intended merely to description specific embodiment
Purpose, the purpose being not intended to be limiting of the invention.
It is further noted that as used in this description, singular includes the plural form of its referent, unless
It removes and is explicitly limited to a referent.Term "or" can be used interchangeably with term "and/or", unless the context otherwise clearly
Except indicating.
In certain embodiments, the affinity between aptamers and its target spot is characterized with KD (dissociation constant), it is low
In 10-7M、10-8M、10-9M、10-10M、10-11M or about 10-12M or lower.
Specific embodiment
The invention discloses a kind of aptamers for Her3ECD, and its related affinity confirmatory experiment to prove the adaptation
Body has preferable compatibility and specificity, will provide new thinking for the diagnoses and treatment of the highly expressed related disease of HER3.This
Field technical staff can use for reference present disclosure, be suitably modified realization of process parameters.In particular, it should be pointed out that all similar
Replace and change apparent to those skilled in the art, they are considered as being included in the present invention.Of the invention
It is described using and by preferred embodiment, related personnel can obviously not depart from the content of present invention, spirit and scope
It is interior that method described herein and application are modified or appropriate changes and combinations, carry out implementation and application the technology of the present invention.
In order to make those skilled in the art more fully understand technical solution of the present invention, below with reference to specific embodiment
The present invention is described in further detail.
Embodiment
Embodiment 1. is based on SELEX technology screening Her3ECD ssDNA aptamers
1.1 building 5 '-GGGAGCTCAGAATAAACGCTCAA of random single chain DNA (i.e. ssDNA) oligonucleotide library
(N38) TTCGACATGAGGCCCGGATC-3 ', wherein N38 is the random sequence of 38 bases, and both ends are the fixed primer of sequence
Sequence, primer up I are 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ', and primer down I is 5 '-
GATCCGGGCCTCATGTCGAA-3 ', primer down II are 5 '-biotin-GATCCGGGCCTCATGTCGAA-3 ', storage capacity
It is 1014More than, the random single chain DNA oligonucleotide library of synthesis is dispensed according to 1OD/ pipe, and freeze-dried powder is saved backup in -20 DEG C.
Her3ECD plasmid is transiently transfected 293E cell with PEI reagent (Invitrogen company) by 1.2, is collected after three days
Cells and supernatant obtains the target protein for having His label through ni-sepharose purification, through coomassie brilliant blue staining and Western
Blotting identifies that antigen bands expression is correct and purity is preferable, can be used as target protein and carries out subsequent screening.
1.3 select the magnetic bead with His label to pass through Binding Buffer (sodium phosphate 20mM, sodium chloride 50mM, imidazoles
5mM, PH=7.4) solidification albumen, and corresponding PBST (K is added2HPO450mM, sodium chloride 150mM, Tween-20 0.05%, PH
=7.5) 4 DEG C of refrigerators are put in save.
The library 1.4ssDNA is in conjunction with target protein: taking the library 1nmol ssDNA to be dissolved with 100 μ L PBST, 95 DEG C of denaturation
It after 5min, ice bath 10min, is added in the magnetic bead being connect in 10mL above-mentioned steps (3) with target protein, rotates and combine in room temperature
Then 30min abandons supernatant using magnetic frame, magnetic bead is washed 3 times with PBST buffer, supernatant is abandoned, with Elution buffer (phosphorus
Sour sodium 20mM, sodium chloride 50mM, imidazoles 500mM, PH=7.4) albumen on magnetic bead is eluted, with certain compatibility
SsDNA can be incorporated on albumen, eluent be expanded as QPCR template, primer selects up I and down II, program: pre-
95 DEG C of 15min are denaturalized, PCR reaction: 95 DEG C of 10s denaturation；58 DEG C of 20s annealing；72 DEG C of 30s extend.It (indicates: doing corresponding experiment
Compare and protein nucleic acid mixture progress qPCR or the precipitating recycling of combining nucleic acid are subjected to qPCR again, by more sensitive
Silver staining illustrated handbook is fixed, difference of them very little, and in view of there are a large amount of losses in nucleic acid removal process, directly magnetic bead is taken to elute afterwards
Product is used directly as qPCR template.)
1.5 strepto-s are affine-streptavidin magnetic beads separation dsDNA be ssDNA: take strepto- it is affine-streptavidin magnetic beads correspondence
Buffer (Tris-Hcl (PH=7.5) 10mM, EDTA 1mM, sodium chloride 1M, Tween-20 0.01%-0.1%) washing is appropriate
Magnetic bead twice, is added qPCR product room temperature and mixes in conjunction with 30~60min, Buffer washing abandons net supernatant three times, 50 μ l are added
The NaOH of 0.1mol/L Fresh, in 37 DEG C of incubation 15min, so that dsDNA unwinding.The 50 μ l NaOH containing ssDNA are molten
Liquid or is added in 1ml PBST directly as the screening library of next round, with the biphosphate buffer of 10mmol/ml by pH
It is saved after being adjusted to 7.5.
1.6 uncorrelated albumen counter-selections: taking uncorrelated albumen to be screened, and is that we leave and take and not phase with the difference just sieved
Close the unbonded buffer solution system of albumen.By the system by the way that isometric phenol: chloroform: isoamyl alcohol (25:24:1) extracting is added
(5min is stood, 12000rpm 5min is centrifuged) twice, isometric ice ethyl alcohol to the cold is added, stands 30min after mixing on ice,
12000rpm is centrifuged 10 minutes, abandons supernatant, and 70% ethyl alcohol rinses 1 time, is abandoned supernatant, is dried precipitating.DdH is added2O dissolution is used as mould
Plate carries out qPCR.
1.7qPCR solubility curve combination silver staining band compares, and confirms the accuracy in library after repeatedly screening.
1.8 screening sequences to the end are purified through PCR amplification, and enzyme connects cloning and sequencing and obtains a plurality of aptamers, analysis secondly
Level structure, free energy, homology select several alternative sequences.
The identification of embodiment 2.Her3ECD ssDNA aptamers affinity
With Her3ECD coated elisa plate, various concentration gradient is set, sequentially add 1.25,2.5,5,10,50,100 and
200pmol albumen, the dilution of 100 μ l coating buffers, 4 DEG C of coatings are overnight；37 DEG C of closing 2h of 1%BSA；The end 10pmol 5 ' biology is added
Element modification Her3ECD aptamers, 37 DEG C of incubation 1h；PBST is washed 5 times, is added SA-HRP antibody (1:8000), 37 DEG C of incubation 1h；
PBST is washed 5 times, and tmb substrate colour developing is added.Wherein using GPC3, BSA as negative control.Testing result display screening
Her3ECD aptamers are not combined with remaining two kinds of albumen, and numerical value is consistent with Blank, further prove that the aptamers are directed to
Her3ECD specificity with higher and affinity.Fitting affinity curve obtains the KD value of aptamers, wherein 7#, the KD of 13#
Value is respectively 116nM, 98nM, and sequence is respectively SEQE ID NO:1, SEQE ID NO:2, and secondary structure is shown in Fig. 1.
The identification of embodiment 3.Her3ECD ssDNA Cell binding specificity
Cell streaming: choosing through NRG1 shift to an earlier date 4h stimulation breast cancer cell line MCF-7 (MCF7 cell belong to NRG1 stimulation sun
Property cell, film surface HER3 expression improves after stimulating) and breast cancer cell line BT474 without stimulation carry out the parent of aptamers
With property specificity verification, chooses and buy the HER3 antibody of commercialization and do positive control, select the human embryonic cells system of low expression HER3
293T is as negative control.The cell PBS of cancellationization is washed twice, is resuspended and is counted, takes 1 × 106It is a, it is resuspended with 100 μ l PBS, point
The HER3 antibody and cells from light for not taking the commercialization of aptamers 100pmol and the APC label of 5 ' end FAM labels are incubated for 1h,
PBS is washed twice, and 2% paraformaldehyde is fixed, and detects cell positive rate with Flow cytometry respectively.
Experimental result shows, the affinity of HER3 antibody and cell is commercialized 95%, aptamers combination breast cancer cell
It is MCF-7 (Fig. 2 flow cytometer detection instrument: BD, U.S. biosciences) and BT474 (Fig. 3 flow cytometer detection instrument: Guava, Germany
Merck Millipore) positive rate 75% or so, extremely low compatibility (5% or so) both is shown to 293T,
Embody the good affinity of aptamers itself and specificity.
Embodiment 4.Her3ECD ssDNA is targeted into born of the same parents
Laser co-focusing: the HER3 antibody and aptamers of commercialization theoretically all express HER3ECD antigen with cellular endogenous
In conjunction with the two is incubated for altogether forms target position competition, but can also illustrate itself and cellular endogenous antigenic binding property by common location.
It is thin that breast cancer cell line MCF-7 is planted into the addition NRG1 stimulation MCF-7 before on the big small circular slide of 24 orifice plates, testing 4h in advance
Born of the same parents, PBS wash twice of removal remaining medium, and the fixed cell of 2% paraformaldehyde is added, and PBS is washed twice, and the suitable of FAM label is added
Ligand and the rabbit source HER3 antibody of commercialization are protected from light total incubation 1h, and PBS is washed twice, and the goat-anti rabbit marked for the PE of antibody is added
IgG secondary antibody is incubated for 30min, and PBS is washed twice, and 300nM DAPI is added and contaminates core 3min, and PBS is washed twice, and anti-quencher is added and is inverted
In on coverslip, nail sheet for oil seal, confocal laser scanning microscope.The results show that FITC- aptamers are in cytoplasm and cell
It is distributed in core, PE-HER3 commercial antibody is in mainly distribution endochylema, secondly as it can be seen that still in addition to kernel in kernel
Nucleus in be distributed it is less.
The above results show aptamers and commercial antibody of the invention have common location, prompt both with endogenous
Enter born of the same parents after HER3 antigen binding.It is worth noting that, aptamers except in addition to the antibody common location, the high expression in entoblast,
Its kernel location mechanism may be caused with micro Distribution mechanism is entered after born of the same parents with antibody difference, and specific mechanism needs to be furtherd elucidate.
Sequence table
<110>section, army, INST OF EMISSION & RADIATION M Zheng Yuan (Beijing)
Drug research Co., Ltd
<120>a kind of ssDNA aptamers for Her3ECD and its application in diagnosis, treatment HER3 related disease
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 81
<212> DNA
<213>artificial sequence
<220>
<221> gene
<222> (1)..(81)
<400> 1
gggagctcag aataaacgct caaagggtca agctgattac actttgtcca ctattgggtc 60
cttcgacatg aggcccggat c 81
<210> 2
<211> 81
<212> DNA
<213>artificial sequence
<220>
<221> gene
<222> (1)..(81)
<400> 2
gggagctcag aataaacgct caaggctaac agcacgcaac gggggggagt aatcgtgtct 60
gttcgacatg aggcccggat c 81
Claims (7)
1. a kind of ssDNA aptamers of specific recognition HER3 extracellular domain, nucleotide sequence such as SEQ ID NO:1 or SEQ ID
Shown in NO:2.
2. the modified product of ssDNA aptamers described in claim 1, the modification, which is selected from, is subject to fluorine by 2 ' position of glucosides
Or oxygen methyl, connection high molecular weight polyethylene glycol cholesterol or connection nanoparticle.
3. a kind of highly expressed breast cancer diagnosis reagent of HER3 extracellular domain, wherein being adapted to containing ssDNA described in claim 1
Body.
4. a kind of highly expressed breast cancer diagnosis DNA chip of HER3 extracellular domain, is fixed with described in claim 1 thereon
SsDNA aptamers.
5. a kind of target therapeutic agent of HER3 extracellular domain height expression breast cancer, wherein suitable containing ssDNA described in claim 1
Ligand.
6. ssDNA aptamers described in claim 1 are preparing the use in the highly expressed breast cancer diagnosis reagent of HER3 extracellular domain
On the way.
7. targeted therapy medicine of the ssDNA aptamers described in claim 1 in preparation for HER3 extracellular domain height expression breast cancer
Purposes in object.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610928829.7A CN106497931B (en) | 2016-10-31 | 2016-10-31 | A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610928829.7A CN106497931B (en) | 2016-10-31 | 2016-10-31 | A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106497931A CN106497931A (en) | 2017-03-15 |
| CN106497931B true CN106497931B (en) | 2019-07-12 |
Family
ID=58318757
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610928829.7A Active CN106497931B (en) | 2016-10-31 | 2016-10-31 | A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106497931B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402127B (en) * | 2018-09-29 | 2021-12-10 | 复旦大学附属眼耳鼻喉科医院 | Group of high-affinity nucleic acid aptamers capable of being specifically bound with connective tissue growth factor and application of high-affinity nucleic acid aptamers |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005040339A2 (en) * | 2003-07-18 | 2005-05-06 | The Regents Of The University Of California | Aptamers to human epidermal growth factor receptor-3 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8916696B2 (en) * | 2011-06-12 | 2014-12-23 | City Of Hope | Aptamer-mRNA conjugates for targeted protein or peptide expression and methods for their use |
-
2016
- 2016-10-31 CN CN201610928829.7A patent/CN106497931B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005040339A2 (en) * | 2003-07-18 | 2005-05-06 | The Regents Of The University Of California | Aptamers to human epidermal growth factor receptor-3 |
Non-Patent Citations (2)
| Title |
|---|
| Aptamer based strategy for cytosensing and evaluation of HER-3 on the surface of MCF-7 cells by using the signal amplification of nucleic acid-functionalized nanocrystals;Shaoping Lv等;《Analytica Chimica Acta》;20130220;第772卷;第26-32页 * |
| Inhibition of heregulin signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3;Chi-hong B. Chen等;《PNAS》;20030805;第100卷(第16期);第9226-9231页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106497931A (en) | 2017-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity | |
| Germer et al. | RNA aptamers and their therapeutic and diagnostic applications | |
| Lo | Nuclear mode of the EGFR signaling network: biology, prognostic value, and therapeutic implications | |
| Pereira et al. | Aptamers: Novelty tools for cancer biology | |
| CN109072240A (en) | Use the composition and method of piRNA diagnosing and treating cancer | |
| CN109797151B (en) | Application of Circ-CDH1 inhibitor | |
| CN104411825B (en) | Periostin aptamer and anti-cancer composition comprising same | |
| CN102839181B (en) | Nucleic acid aptamer sequence of gastric cancer cells, and uses thereof | |
| Almasi et al. | Development of a single stranded DNA aptamer as a molecular probe for lncap cells using cell-selex | |
| Catala et al. | Targeted intracellular delivery of trastuzumab using designer phage lambda nanoparticles alters cellular programs in human breast cancer cells | |
| CN110373415A (en) | Specifically bind the aptamer and application thereof of PD-L1 albumen | |
| CN108884128A (en) | Anti-egfr antibodies drug conjugate | |
| Nelissen et al. | Improving breast cancer treatment specificity using aptamers obtained by 3D cell-SELEX | |
| Dang et al. | G-protein-signaling modulator 2 expression and role in a CD133+ pancreatic cancer stem cell subset | |
| CN104498500A (en) | Aptamer for recognizing adriamycin-resistant breast cancer cells as well as screening method and application of aptamer | |
| CN106497931B (en) | A kind of ssDNA aptamers for Her3ECD and its application in diagnoses and treatment HER3 related disease | |
| EP3149167A1 (en) | Aptamer targeting mage-a3 peptide and uses thereof | |
| CN109837281A (en) | Specifically bind aptamer and its screening, identification and application of S100P albumen | |
| CN104109667B (en) | A kind of nucleic acid fragment and application thereof | |
| CN103290018B (en) | A kind of nucleic acid aptamer of being combined with Human epidermal growth factor receptor type III mutant specific and application thereof | |
| CN110950931B (en) | Polypeptide for specifically targeting triple negative breast cancer stem cells and application thereof | |
| CN105602951B (en) | The interference preparation of long-chain non-coding RNA LOC284454 and its application | |
| CN104212800B (en) | Nucleic acid aptamer for specific binding with human epidermal growth factor receptor type III variant and application of nucleic acid aptamer | |
| CN110981961B (en) | Sequence and application of nano antibody H6 specifically binding to cancer cell protein B7-H4 | |
| CN108239646A (en) | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20181008 Address after: 100850 No. 27 Taiping Road, Beijing, Haidian District Applicant after: Academy of military medicine of the PLA Academy of Military Sciences Applicant after: Military science is the source of drug research (Beijing) Co. Ltd. Address before: 100850 No. 27 Taiping Road, Beijing, Haidian District Applicant before: Emission and Radiation Medical Research Institute Applicant before: Military science is the source of drug research (Beijing) Co. Ltd. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |