CN106478824A - A kind of biotinylated antibody of accurate Fc site covalent coupling labelling - Google Patents

A kind of biotinylated antibody of accurate Fc site covalent coupling labelling Download PDF

Info

Publication number
CN106478824A
CN106478824A CN201610897782.2A CN201610897782A CN106478824A CN 106478824 A CN106478824 A CN 106478824A CN 201610897782 A CN201610897782 A CN 201610897782A CN 106478824 A CN106478824 A CN 106478824A
Authority
CN
China
Prior art keywords
site
biotin
antibody
bpa
avitag
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610897782.2A
Other languages
Chinese (zh)
Other versions
CN106478824B (en
Inventor
杨洪鸣
唐金宝
鲍如梦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Weifang Medical University
Original Assignee
Weifang Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Weifang Medical University filed Critical Weifang Medical University
Priority to CN201610897782.2A priority Critical patent/CN106478824B/en
Publication of CN106478824A publication Critical patent/CN106478824A/en
Application granted granted Critical
Publication of CN106478824B publication Critical patent/CN106478824B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of biotinylated antibody of accurate Fc site covalent coupling labelling, the present invention carries the Z affinity peptide Avitag fusion protein of photosensitive group (Bpa) with technique for gene engineering expression and BirA enzyme catalysiss complete the covalent site-directed coupling of its biotin, obtains the biological reagent Z that a kind of accurate Fc site is coupledBpaBiotin, after the affinity coupling of affinity peptide guiding Fc site, then in 365nm ultraviolet excitation photosensitive group and antibody producing covalent bond, realizes the biotinylated antibody of the biotin covalent coupling labelling in Fc site.The biotinylated antibody in accurate Fc site provided by the present invention, it is a kind of irreversible covalent coupling in Fc site, do not affected by pH, temperature, organic solvent and denaturant, the IgG antibody that can be fixed in the carrier surface being coated Avidin is that homogeneous, Fab section fully exposes and keeps the three-dimensional orientation IgG antibody of high antigen-binding activity, and breaches the restriction can not having in analyte with reference to the affine peptide material of Z in actual applications.

Description

A kind of biotinylated antibody of accurate Fc site covalent coupling labelling
Technical field
The present invention relates to genetic engineering and immunoassay field, particularly relate to a kind of accurate covalent coupling of biotin The labelling technique in antibody Fc site, the biotinylated antibody in the accurate Fc site that this invention provides can be coated the carrier of Avidin Firm directional at-tachment is realized on surface, does not affect the antigen binding site of Antibody Fab fragment, and not resisted by endogenouss in testing sample The interference of body.
Background technology
Biotin avidin system (biotin-avidin system, BAS), is the later stage seventies to be applied to immunology, And obtain a kind of new bio reaction amplification system developing rapidly.Affinity between avidin and biotin is extremely strong, the two In conjunction with affinity costant (Ka) be 1015mol-1, avidin is combined with biotin one, is not subject to pH, temperature, organic solvent and change Property agent impact (using denaturant and>Could dissociate in the case of 90 DEG C).Because it has between biotin and avidin High affinity and multistage enlarge-effect, and be organically combined with immunolabelling techniques such as fluorescein, enzyme, isotopes, make various The specificity of immunoassay and sensitivity improve further.Biotin coupling traget antibody is biotinylated antibody is BAS system Application premise, currently used biotinylated antibody technology of preparing is based on various biotin derivatives (activated biotin) Covalent coupling technology and the amino acid residue (amino, carbonyl) in antibody molecule between, antibody molecule can connect multiple Biotin molecule, due to the nonuniqueness of the quantity of reactive amino acid residues, position in antibody molecule, biotin molecule can not be special It is coupled at the Fc section of antibody different in naturely, when biotin molecule is randomly coupled to Antibody Fab fragment, then the antigen of antibody can be hindered to tie Close and lead to antibodies bind antigen activity decrease.
Can achieve the indirect labelling at antibody Fc end using some antibody rabphilin Rabs, such as SP (SpA) and its Derived protein (ZZ affinity peptide), can be combined the Fc section of many animals IgG, and this combination not affect IgG's by hydrophobic interaction The immunocompetence that Fab section is combined with antigenic specificity.ZZ affinity peptide is derived from the repetition sequence in the B structure domain of SP Row, each ZZ is affine, and peptide molecule can be in conjunction with two IgG molecules, and single Z sequence (Z affinity peptide) can be in conjunction with the one of IgG molecule Bar heavy chain, thus an IgG molecule can be in conjunction with two single Z sequences.We are once using the biotinylated ZZ affinity peptide of fixed point Achieve biotin affinity coupling (patent of invention CN103694358B at antibody Fc end《Locus specificity biotin labeling is recombinated And its application in the fixing IgG antibody of three-dimensional orientation》).However, the combination between affinity peptide and IgG is a kind of reversible life Thing combines, and this antibody directional at-tachment technology is applied to based in the immunoassay of chip technology, close in the regenerative process of chip Can dissociate with the conjugate of peptide-IgG, need to repeat with reference to capture antibody；What is more important, if contained in clinical sample analysis Have the IgG class material being combined with affinity peptide, then can severe jamming analysis result, then limit this by affine peptide-mediated anti- The range of application of body directional at-tachment technology.
Content of the invention
For above-mentioned prior art, the present invention carries photosensitive group (4- benzoyl-L- benzene with technique for gene engineering expression Alanine, p-benzoylphenylalanine, abbreviation Bpa) Z affinity peptide-Avitag fusion protein and with BirA enzyme catalysiss Complete the covalent site-directed coupling of its biotin, obtain the biological reagent Z that a kind of accurate Fc site is coupledBpa- Biotin, by Z affinity peptide After the affinity coupling of guiding Fc site, then in 365nm ultraviolet excitation photosensitive group and antibody producing covalent bond, realize Fc site Biotin covalent coupling labelling biotinylated antibody.Because an IgG molecule can be in conjunction with two single Z sequences, the present invention The biotinylated antibody in the accurate Fc site being provided, is that each IgG molecule can quantitatively combine two Biotin molecules, and is one Plant irreversible covalent coupling biotin antibody, do not affected by pH, temperature, organic solvent and denaturant, achievable solid phase carries The IgG antibody that body surface face is fixed is that homogeneous, Fab section fully exposes and keep the three-dimensional orientation IgG of high antigen-binding activity to resist Body, and breach the restriction can not having in analyte with reference to the affine peptide material of Z in actual applications.
The present invention utilizes aminoacyl tRNA synthetase/suppression succinum tRNA (aminoacyl-tRNA synthetase/amber Suppressor tRNA, aaRS/suppressor tRNA) technology realize in the translation process of protein be biosynthesiss contain The target protein of photosensitive group.
The technical solution used in the present invention is as follows：
First purpose of the present invention is biological reagent (the abbreviation Z providing a kind of accurate guiding Fc site to be coupledBpa- Biotin), this biological reagent includes a Z affinity peptide, is characterized in：It is connected with 4- benzene first at α 1 domain of described Z affinity peptide Acyl group-L-phenylalanine, is sequentially connected Avi-tag label protein and poly group ammonia at the carboxyl terminal residue of described Z affinity peptide Sour purification tag albumen, the lysine residue on wherein said Avi-tag label protein connects biotin or derivatives thereof.
Preferably, after illumination with IgG antibody coupling effect for, be connected with described α 1 domain 4- benzoyl- The position of L-phenylalanine is the 17th position of aminoacid.17th position refers to after the 16th aminoacid of Z affinity peptide Position before 17 aminoacid.
Preferably, described polyhistidine purification tag albumen is 6 polyhistidyls (6 × His).
Second object of the present invention is the preparation method of the biological reagent providing above-mentioned accurate Fc site to be coupled, including with Lower step：
(1) construction recombination plasmid pZ firstTAGAvitag expression vector：Wherein, the synthesizing of genes of interest：Basis first Peptide gene sequence that Z is affine, in site insertion amber codon (TAG) needed for α 1 domain sequence of the affine peptide gene sequence of Z, Then insert Avitag gene order in Z affine peptide gene sequence downstream end, polyhistidine purification tag gene order, It is respectively provided with restriction enzyme digestion sites at the 5' end of said gene sequence and 3' end afterwards, chemosynthesis obtain genes of interest Sequence；
(2) and then using prokaryotic micro-organisms give expression to recombiant protein ZBpa–Avitag；
(3) finally utilize biotin ligase (BirA enzyme) to recombiant protein ZBpaAvitag biotinylation, obtains biology The recombiant protein Z of elementizationBpaAvitag, is this biological reagent (ZBpa-Biotin).
In step (1), recombinant plasmid expression vector be prepared as the routine techniquess means that those skilled in the art know.Base This step is：After chemosynthesis objective gene sequence, it is cloned in plasmid, you can obtain corresponding plasmid expression vector. In a currently preferred specific embodiment, by objective gene sequence sub-clone to pTBX1 plasmid, obtain recombiant plasmid pZTAGAvitag expression vector.
Preferably, described polyhistidine purification tag gene order is 6 polyhistidyl gene orders.
Described restricted enzyme is not particularly limited, and can be set according to demand.Currently preferred one In individual specific embodiment, the 5' end setting NdeI restriction enzyme digestion sites of described genes of interest, described genes of interest 3' end arranges XhoI restriction enzyme digestion sites；In a currently preferred specific embodiment, described genes of interest Sequence be：
5’-CATATGGTAGACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTAGCATTTACCT AACTTAAACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGC AGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGGTCTGAACGATATCTTCGAAGCTCAGAAAATCGAATGGC ACGAACATCATCATCATCATCATTAACTCGAG- 3 ', as shown in SEQIDNO.1.Wherein, the base that double underline represents is Amber codon, the sequence that single underscore represents is restriction enzyme digestion sites, and what bolded sequence represented is 6 polyhistidyls Gene order, sequences in italics represents the aminoacid gene order of Avi-tag.
In step (2), recombiant protein ZBpaAvitag includes Z affinity peptide, is connected with α 1 domain of described Z affinity peptide 4- benzoyl-L-phenylalanine, is sequentially connected Avi-tag label protein and many at the carboxyl terminal residue of described Z affinity peptide Polyhistidyl purification tag albumen.
It is the target protein that biosynthesiss contain photosensitive group in the translation process of protein for realizing destination protein, step Suddenly the expression vector in (1) and the pEVOL-pBpF cotransformation containing aminoacyl tRNA synthetase encoding gene be to prokaryote, Obtain genetic engineering bacterium.The recombiant protein Z containing photosensitive group can smoothly be given expression to using this genetic engineeringBpa–Avitag. For the target protein containing photosensitive group for the smooth synthesis, aminoacyl tRNA synthetase/suppression succinum tRNA (aminoacyl-tRNA Synthetase/amber suppressor tRNA, aaRS/suppressor tRNA) technology has been than more conventional skill Art.Translated not at amber codon (TAG) place in the translation process of protein using aaRS/suppressor tRNA technology Can terminate and translate into alpha-non-natural amino acid (the usually alpha-non-natural amino acid containing specific groups, such as Bpa contain photosensitive group), Peptide chain continues translation to destination protein.
In the present invention, pEVOL-pBpF plasmid can conventional obtain for those skilled in the art, for example can be by business way Footpath obtains.
By 30～37 DEG C of said gene engineering bacteria after 12～18h culture, activation, it is transferred in 2 × YT culture medium, 37 DEG C cultivating to OD600 is 0.6 0.8；It is subsequently adding 4- benzoyl-L-phenylalanine, continue culture 0.5～2h；Add IPTG (isopropyl-β-D-thiogalactoside) and arabinose, 30～37 DEG C of inducing culture 5～7h；Through above-mentioned culture Engineering bacteria is collected by centrifugation thalline, resuspended using buffer, freezing-thawing and cracking thalline；After centrifugation removes bacterial chip, using chromatographic column Purification destination protein.
Wherein, the culture medium that described 2 × YT culture medium knows for this area routine.
In step (3), using BirA enzyme vitro reactions system to recombiant protein ZBpaAvitag carries out biotinylation, then leads to Cross chromatographic column and ultra-filtration centrifuge tube obtains biotinylated recombiant protein, i.e. ZBpa-Biotin.
Described BirA enzyme vitro reactions system is as follows：Buffer A, buffer B, ZBpaAvitag, biotin ligase, 25～35 DEG C of reaction 5～7h；Described buffer A is N- bis- (ethoxy) glycine of 0.5M, pH 8.3；Described buffer B In solution for pH 8.0, containing 100mM ATP, 100mM magnesium acetate, 200mM biotin.
Preferably, described buffer A, buffer B and ZBpaThe volume ratio of Avitag is 1：1：4, described BirA enzyme adds Dosage is 40～50U/ μ L.
Third object of the present invention is the biotinylated antibody providing a kind of accurate guiding Fc site to be coupled, and this antibody is It is connected with IgG antibody Fc section by covalent bond by the 4- benzoyl-L-phenylalanine of Z affinity peptide guiding in described biological reagent Connect.
Fourth object of the present invention is the preparation method of the biotinylated antibody that described accurate guiding Fc site is coupled, bag Include following steps：IgG antibody is mixed with described biological reagent, first guides the biological affinity coupling in Fc site, then in 365nm Photosensitive group and the amino of the Fc section of IgG antibody is excited to produce covalent bond under ultraviolet light, you can precisely to be guided Fc position The biotinylated antibody that point is coupled.
5th purpose of the present invention is the application providing above-mentioned biological reagent in the fixing IgG antibody of three-dimensional orientation.Should Application process is：4- benzoyl-L-phenylalanine in described biological reagent is connected with IgG antibody Fc section by covalent bond Connect, acted on by biotin-avidin, thus realizing three-dimensional orientation to fix IgG antibody.
Comprise the following steps that：
IgG antibody and described biological reagent are according to 1:4～6 molecular number ratio mixing, after shaken at room temperature 20～40min, will Above-mentioned reaction system is placed on ice, 365nm ultra-vioket radiation 2～4h, and after irradiation, product removes unnecessary Z with ultra-filtration centrifuge tubeBpa– Biotin molecule, you can precisely guided the biotinylated antibody of Fc site coupling.
Described room temperature refers to 18～37 DEG C.
6th purpose of the present invention is to provide a kind of immune sensing chip, and this immuno-chip includes a substrate sheet, described Avidin is fixed with substrate sheet, Avidin is combined with the biotin in described biotinylated antibody.
Wherein, substrate sheet is fixed with the common knowledge that Avidin is this area, will not be described here.Described substrate sheet is simultaneously It is not particularly limited, one of present invention specific embodiment is CM5 chip, this chip can routine obtain.In the present invention A specific embodiment in, described Avidin be Streptavidin (SA).
The analysis that this chip can be used for biological specimen measures, and is primarily referred to as detecting related antigen, described related antigen refers to Can be with the material of IgG antibody specific binding, such as：The disease markers such as carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP).
From background technology, residual with the aminoacid in antibody molecule based on various biotin derivatives (activated biotin) Covalent coupling technology between base (amino, carbonyl), an antibody molecule can connect multiple biotin molecules, but biotin with anti- The intramolecular active group of body is a kind of random incorporation mode, when reactive group amino acid residue be located at monoclonal antibody or near When, lead to the Fc end of immobilised biotinylated antibody outwards to cover Fab section, still it cannot be guaranteed that the antibody being adsorbed is orientation Fixing antibody.
The present invention carries Z affinity peptide-Avitag fusion protein the BirA enzyme of photosensitive group with technique for gene engineering expression Catalysis completes ZBpaThe covalent site-directed coupling of biotin of-Avitag fusion protein itself, obtains one kind and can precisely guide Fc site occasionally The Z of connectionBpa- Biotin, realizes the antibody of the biotin covalent labeling in Fc site then under 365nm ultraviolet excitation.The present invention The biotinylated antibody in the accurate Fc site being provided, is a kind of irreversible covalent coupling in Fc site, is not subject to pH, temperature, has Machine solvent and the impact of denaturant, may be implemented in the IgG antibody that the coated carrier surface of Avidin fixed is homogeneous, Fab section Fully expose and keep the three-dimensional orientation IgG antibody of high antigen-binding activity, and breach in actual applications in analyte Can not there is the restriction with reference to the affine peptide material of Z.
Brief description
Fig. 1 ZBpaThe accurate Fc site biotinylated antibody schematic diagram of Biotin mediation.
Fig. 2 ZBpaBiotin accurate coupled antibody Fc site electrophoresis and Western analysis.
The three-dimensional orientation of Fig. 3 photo-biotinylated IgG is fixed and application schematic diagram.
The three-dimensional orientation of Fig. 4 NHS-biotinylated IgG is fixed and application schematic diagram.
Fig. 5 immobilised photo-biotinylated IgG and NHS-biotinylated IgG analysis efficiency ratio is relatively.
Specific embodiment
Unless otherwise noted, involved reagent, test method are conventional method reagent, conventional method.
Term in the present invention is explained：
Fab section：Fab (fragment of antigen binding, Fab), is equivalent to antibody molecule Two arms, by the V of a complete light chain and heavy chainHAnd CH1Domain forms.
Fc section/Fc：Crystallizable fragment (fragment crystallizable, Fc) is equivalent to the C of IgH2And CH3Domain, It is the position of Ig and effector molecule or cell interaction.
ZZ affinity peptide：It is derived from two repetitive sequences of the synthetic of SP, can be in conjunction with IgG antibody Fc Section.
Z affinity peptide：It is derived from the simple sequence of the synthetic of SP, can be in conjunction with IgG antibody Fc section.
α 1 domain of Z affinity peptide refers to：The 4th 18 of Z is affine peptide amino acid sequence.
Avi-tag is a small peptide label being made up of 15 amino acid residues, in vivo or in vitro can be by biotin Ligase biotin on lysine residue connects, thus realize the biotinylation of albumen.
With reference to embodiment, the present invention is further described.
As shown in figure 1, biological reagent (the abbreviation Z that a kind of accurate guiding Fc site is coupledBpa- Biotin), this biological reagent Including a Z affinity peptide, it is characterized in：It is connected with 4- benzoyl-L-phenylalanine, institute at α 1 domain of described Z affinity peptide It is sequentially connected Avi-tag label protein and polyhistidine purification tag albumen, wherein at the carboxyl terminal residue stating Z affinity peptide (it is biological that its derivant also refers to activation to connect biotin or derivatives thereof on lysine residue on described Avi-tag label protein Element).
Embodiment 1 recombiant plasmid pZTAGThe structure of Avitag expression vector
For realizing realizing being biosynthesiss in the translation process of protein using aaRS/suppressor tRNA technology Target protein containing photosensitive group, and realize biotin being total in destination protein specific site using BirA/Avitag technology Valency is coupled：
First according to the affine peptide gene sequence of Z, designed by analysis optimization, suitable in α 1 domain sequence of Z affinity peptide Site displacement insertion amber codon (TAG).
The present invention realizes the covalent coupling in destination protein specific site for the biotin using BirA/Avitag technology, in Z parent Insert Avitag gene order with peptide gene sequence downstream, 6 × His purification tag upstream.
The 5' end setting NdeI restriction enzyme digestion sites of above-mentioned purpose gene order, setting XhoI is restricted at 3' end Endonuclease digestion site, the chemical synthesiss Z containing 6 × His purification tag for the synthesisTAG- Avitag gene order is (such as Shown in SEQIDNO.1), in the NdeI/XhoI position of objective gene sequence sub-clone to pTBX1 plasmid, obtain restructuring pZTAG- Avitag plasmid expression vector.
Embodiment 2 recombiant protein ZBpaThe expression and purification of Avitag
(1) recombinant expression plasmid pZTAGAvitag and plasmid pEVOL-pBpF Calcium Chloride Method cotransformation competence bacteria E.coli BL21 (DE3), coats benzyl containing ammonia (100 μ g/mL) and the LB solid culture flat board of chloromycetin (50 μ g/mL), 37 DEG C Incubated overnight, screening positive clone, obtain genetic engineering bacterium；
(2) picking monoclonal bacterium colony is to 10mL LB liquid medium (ammonia benzyl 100 μ g/mL, chloromycetin 50 μ g/mL), 37 DEG C Incubated overnight, activation；
(3) cell activating is transferred in 50mL 2 × YT culture medium, and 37 DEG C are cultivated to OD600 is 0.6 0.8；Add eventually Concentration is 300 μM of Bpa, continues culture 1h；Add final concentration and be respectively the IPTG of 0.5mM and 0.2% arabinose, 37 DEG C inducing culture 6h；
(4), through 4 DEG C, after 6000rpm centrifugation 15min, collects thalline, with 5mL 20mM for the genetic engineering bacterium of above-mentioned culture PBS (imidazoles containing 20mM, 150mM NaCl, pH 8.0) buffer is resuspended, and -70 DEG C of refrigerator multigelations 5 times are with cell lysis； 8000rpm centrifugation 15min removes bacterial chip；After 0.45 μm of membrane filtration supernatant, with HisTrap column chromatography purpose egg In vain.20mM PBS (imidazoles containing 250mM, 150mM NaCl, pH 8.0) buffer solution elution simultaneously collects elution fraction.
(5) Millipore ultra-filtration centrifuge tube (molecular cut off is 10kDa) 8000rpm centrifugation desalination and concentration is to suitable body Long-pending, lyophilization, weigh, about 10mg destination protein can be obtained from 1L thalline fermentation liquid purification.
Embodiment 3 recombiant protein ZBpaThe preparation of Avitag external biological elementization
BirA enzyme vitro reactions system is utilized to recombiant protein Z in the present embodimentBpaAvitag carries out biotinylation, then leads to Cross HisTrap chromatographic column and Millipore ultra-filtration centrifuge tube obtains biotinylated recombiant protein ZBpa–Avitag.
Step is as follows：
(1) adopt BirA enzyme reaction system as follows：25 μ L buffer A, 25 μ L buffer B, 100 μ L ZBpa– Avitag, 45U/ μ L BirA, 250 30 DEG C of μ L reaction volume reaction 6h；
(2) by above-mentioned reacted mixed liquor according to embodiment 2 step (4) and (5), using HisTrap chromatographic column withUltra-4(NMWL:10kDa) ultra-filtration centrifuge tube can obtain biotinylated recombiant protein ZBpaAvitag is ZBpaBiotin, and eliminate unnecessary biotin and BirA enzyme；
(3) biotinylated product ZBpaAfter Biotin separates through 15%SDS-PAGE, move to NC film, after transferring film terminates, warp 5%BSA solution closes 30min, and after TBST (pH of Tris containing 0.1M 7.5,0.05%Tween20) washing, film immerses SA-HRP (horseradish peroxidase-labeled Streptavidin, 1:1000) in solution, 37 DEG C of incubations combine 30min, and TBST washs 3 times, often Secondary 5min, adds chromogenic substrate TMB (TMB is conventional nitrite ion) colour developing.
(4) recombiant protein ZBpaThe biotinylation efficiency test of Avitag：Detect biotin labeling effect using HABA method, Testing result shows after BirA enzyme carries out biotinylation in vitro, has 98% albumen ZBpaAvitag combines biology Element, i.e. ZBpa–Biotin.
Described buffer A is N- bis- (ethoxy) glycine (pH 8.3) of 0.5M；Described buffer B is pH's 8.0 In solution, containing 100mM ATP, 100mM magnesium acetate, 200mM biotin.
Embodiment 4ZBpaThe accurate Fc site biotinylated antibody of Biotin mediation
The present embodiment is based on ZBpaThe characteristic that Biotin passes through bioaffinity can orient combination with IgG, because Bpa is Photosensitive group, under the conditions of 365nm ultra-vioket radiation, promotes the amino of the Bpa and neighbouring IgG activating to form covalent bond, can be real The Fc site (shown in Fig. 1) of existing biotin accurate covalent coupling antibody.
Step is as follows：
(1) IgG antibody and ZBpaBiotin is according to 1:5 molecular number ratios are mixed in quartz colorimetric utensil, and ambient temperature with gentle vibrates 30min.
(2) above-mentioned silica dish is placed on ice, 365nm ultra-vioket radiation 3h, after irradiation, product is usedUltra-0.5 (NMWL:100kDa) ultra-filtration centrifuge tube removes unnecessary ZBpaBiotin molecule, final product is biotinylated antibody name For photo-biotinylated IgG.
(3) photo-biotinylated IgG first 12% non denatured SDS-PAGE and degeneration SDS-PAGE analysis, so After carry out Fc site be coupled confirmation：Pepsin is dissolved in hydrolysis (50mM Sodium Acetate Trihydrate, 10mM EDTA, pH 3.3) buffer, Make its final concentration of 100 μ g/mL；100 μ L pepsin solutions are mixed with 100 μ L photo-biotinylated IgG, 37 DEG C Reaction 2h；15%SDS-PAGE moves to NC film after separating, and after transferring film terminates, closes 30min through 5%BSA solution, TBST (contains 0.1M Tris pH 7.5,0.05%Tween20) washing after, film immerse SA-HRP (1:1000), in solution, 37 DEG C incubate combination 30min, TBST wash 3 times, each 5min, add chromogenic substrate TMB colour developing.Test result indicate that, photo- 12KD band after biotinylated IgG water substantially colours, and shows ZBpaThe Biotin not V with heavy chainH,CH1And hinge region In conjunction with, and be combined with the Fc section of IgG, and 90% IgG molecule covalent has been coupled ZBpaBiotin (shown in Fig. 2).
Embodiment 6ZBpaThe application of the accurate Fc site biotinylated antibody of Biotin mediation
The present embodiment is the biomarker based on CEA (carcinoembryonic antigen) as clinical kinds cancer diagnosis, by CEA Detection carry out application in terms of bio-sensing for the indirect assessment directional at-tachment photo-biotinylated IgG, and with even at random Joining biotinylated antibody is comparison (NHS-biotinylated- rabbit anti-CEA IgG).
Step is as follows：
(1) rabbit anti-CEA IgG and excessive ZBpaBiotin incubated at room 30min, ultra-vioket radiation 3h, obtain product Photo-biotinylated- rabbit anti-CEA IgG,Ultra-0.5 ultra-filtration centrifuge tube is centrifuged, and acetic acid delays (10mM, pH 3.2) rush liquid as cleaning mixture during centrifugation, be separated off unnecessary ZBpaThe rabbit anti-CEA IgG of Biotin and Non-covalent binding.
The anti-CEA IgG of (2) 5 μM of of photo-biotinylated- rabbits is with 30 μ L/min flow velocitys, PBS (10mM, pH 8.0) buffer, as mobile phase, is interacted by Streptavidin (SA)-biotin and is attached to the CM5 core being fixed with SA Piece, produces the photo-biotinylated IgG immune sensing chip of directional at-tachment, as shown in Figure 3.
(3) with the NHS-biotinylated IgG of chemical covalent coupling method for comparison, i.e. 5 μM of of NHS- Biotinylated- rabbit anti-CEA IgG, is passed through as mobile phase with 30 μ L/min flow velocitys, PBS (10mM, pH 8.0) buffer Streptavidin (SA)-biotin interacts and is attached to the CM5 chip being fixed with SA, produces the NHS- of directional at-tachment Biotinylated IgG immune sensing chip, as shown in Figure 4.
(5) dilute the anti-CEA of Mus of 0 to 200ng/mL different series concentration as test sample, with PBS (10mM, pH8.0) A point mobile phase made by buffer, and acetic acid slow (10mM, pH 3.2) rushes liquid and is used for chip surface of living again.Result shows photo- The linear detection range of biotinylated IgG immune sensing chip is 2 100ng/mL, LOD value 2ng/mL；NHS- The linear detection range of biotinylated IgG immune sensing chip is 10 80ng/mL, and LOD value is 10ng/mL, as Fig. 5 institute Show.
(6) 100 times of human serum is diluted with PBS (10mM, 0.05%Tween20, pH 8.0), add different amounts of CEA, make Its final concentration is respectively 10ng/mL, 20ng/mL, 40ng/mL, 80ng/mL, photo-biotinylated IgG immune sensing The above-mentioned sample of chip analysis, the response rate is 103.40% 109.53%, and RSD is 4.51% 13.50%, in result display serum Endogenous antibody do not disturb photo-biotinylated IgG immune sensing chip to CEA measure, show this immune sensing The analysis that chip can be used for biological specimen measures.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment Limit, other any spirit without departing from the present invention and the change made under principle, modification, replacement, combine, simplify, All should be equivalent substitute mode, be included within protection scope of the present invention.

Claims (10)

1. the biological reagent that a kind of accurate guiding Fc site is coupled, this biological reagent includes Z affinity peptide, it is characterized in that：Described Z parent Be connected with 4- benzoyl-L-phenylalanine at α 1 domain of peptide, connect successively at the carboxyl terminal residue of described Z affinity peptide Connect Avi-tag label protein and polyhistidine purification tag albumen, the lysine on wherein said Avi-tag label protein is residual Biotin or derivatives thereof is connected on base.
2. the preparation method of the biological reagent that the accurate guiding Fc site described in claim 1 is coupled, is characterized in that, including following Step：
(1) construction recombination plasmid pZ firstTAGAvitag expression vector：Wherein, the synthesizing of genes of interest：First according to Z parent And peptide gene sequence, insert amber codon (TAG) in site needed for α 1 domain sequence of the affine peptide gene sequence of Z, so Insert Avitag gene order in Z affine peptide gene sequence downstream end, polyhistidine purification tag gene order afterwards, finally It is respectively provided with restriction enzyme digestion sites at the 5' end of said gene sequence and 3' end, chemosynthesis obtain genes of interest sequence Row；
And then the expression vector in step (1) gives expression to recombiant protein Z using prokaryotic micro-organisms (2)Bpa–Avitag；
(3) finally utilize biotin ligase to recombiant protein ZBpaAvitag biotinylation, obtains biotinylated restructuring egg White ZBpaAvitag, is this biological reagent (ZBpa-Biotin).
3. preparation method as claimed in claim 2, is characterized in that：In step (1), by objective gene sequence sub-clone extremely In pTBX1 plasmid, obtain recombiant plasmid pZTAGAvitag expression vector；Preferably, described polyhistidine purification tag gene Sequence is 6 polyhistidyl gene orders；Preferably, the 5' end setting NdeI digestion with restriction enzyme position of described genes of interest Point, the 3' end setting XhoI restriction enzyme digestion sites of described genes of interest；Preferably, described objective gene sequence is such as Shown in SEQIDNO.1.
4. preparation method as claimed in claim 2, is characterized in that：In step (2), described expression vector with contain aminoacyl tRNA The pEVOL-pBpF cotransformation of synthetase-coding gene, to prokaryote, obtains genetic engineering bacterium；Preferably, by described gene 30～37 DEG C of engineering bacteria, after 12～18h culture, activation, is transferred in 2 × YT culture medium, cultivates for 37 DEG C and to OD600 is 0.6–0.8；It is subsequently adding 4- benzoyl-L-phenylalanine, continue culture 0.5～2h；Add isopropyl-beta D-thio half Lactoside and arabinose, 30～37 DEG C of inducing culture 5～7h；Thalline is collected by centrifugation through the engineering bacteria of above-mentioned culture, adopts Buffer is resuspended, freezing-thawing and cracking thalline；After centrifugation removes bacterial chip, using column chromatography destination protein.
5. preparation method as claimed in claim 2, is characterized in that：In step (3), using BirA enzyme vitro reactions system counterweight Histone ZBpaAvitag carries out biotinylation, then obtains biotinylated recombiant protein by chromatographic column and ultra-filtration centrifuge tube, The biological reagent that precisely guiding Fc site is coupled；
Preferably, described BirA enzyme vitro reactions system is as follows：Buffer A, buffer B, ZBpaAvitag, biotin connects Enzyme, 25～35 DEG C of reaction 5～7h；Described buffer A is N- bis- (ethoxy) glycine of 0.5M, pH 8.3；Described buffer B is in the solution of pH 8.0, containing 100mM ATP, 100mM magnesium acetate, 200mM biotin.
6. application in the fixing IgG antibody of three-dimensional orientation for the biological reagent described in claim 1.
7. the biotinylated antibody that a kind of accurate guiding Fc site is coupled, is characterized in that：This antibody is by raw described in claim 1 In thing reagent, the 4- benzoyl-L-phenylalanine of Z affinity peptide guiding is connected with IgG antibody Fc section by covalent bond.
8. the preparation method of the biotinylated antibody that the accurate guiding Fc site described in claim 7 is coupled, is characterized in that：Will IgG antibody is mixed with the biological reagent described in claim 1, first guides the biological affinity coupling in Fc site, then purple in 365nm Photosensitive group and the amino of the Fc section of IgG antibody is excited to produce covalent bond under outer light irradiation, you can precisely to be guided Fc site The biotinylated antibody being coupled.
9. preparation method as claimed in claim 8, is characterized in that：IgG antibody and described biological reagent are according to 1:4～6 molecules Number ratio mixing, after shaken at room temperature 20～40min, above-mentioned reaction system is placed on ice, and 365nm ultra-vioket radiation 2～4h irradiates Product removes unnecessary Z with ultra-filtration centrifuge tube afterwardsBpaBiotin molecule, you can precisely guided the biotin of Fc site coupling Change antibody.
10. a kind of immune sensing chip, this immuno-chip includes a substrate sheet, described substrate sheet is fixed with Avidin, affine Element is combined with the biotin in the biotinylated antibody described in claim 7.
CN201610897782.2A 2016-10-14 2016-10-14 Accurate Fc site covalent coupling labeled biotinylated antibody Active CN106478824B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610897782.2A CN106478824B (en) 2016-10-14 2016-10-14 Accurate Fc site covalent coupling labeled biotinylated antibody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610897782.2A CN106478824B (en) 2016-10-14 2016-10-14 Accurate Fc site covalent coupling labeled biotinylated antibody

Publications (2)

Publication Number Publication Date
CN106478824A true CN106478824A (en) 2017-03-08
CN106478824B CN106478824B (en) 2020-04-24

Family

ID=58270040

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610897782.2A Active CN106478824B (en) 2016-10-14 2016-10-14 Accurate Fc site covalent coupling labeled biotinylated antibody

Country Status (1)

Country Link
CN (1) CN106478824B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110637026A (en) * 2017-05-10 2019-12-31 慕尼黑工业大学 Photoconverted polypeptides and uses thereof
CN110922476A (en) * 2019-12-16 2020-03-27 蓝怡科技集团股份有限公司 Biotin coupled antibody and preparation method and application thereof
CN112326953A (en) * 2020-11-03 2021-02-05 广东海洋大学深圳研究院 Method for directionally labeling polybiotin by using antibody

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1914222A (en) * 2003-12-22 2007-02-14 宾夕法尼亚州大学理事会 Methods and compositions for identifying RNA-binding proteins
CN103694358A (en) * 2013-12-26 2014-04-02 潍坊医学院 Locus specificity biotin labeled recombinant IgG (Intravenous Gamma Globulin) affine peptide and application thereof in IgG antibody three-dimensional oriented fixation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1914222A (en) * 2003-12-22 2007-02-14 宾夕法尼亚州大学理事会 Methods and compositions for identifying RNA-binding proteins
CN103694358A (en) * 2013-12-26 2014-04-02 潍坊医学院 Locus specificity biotin labeled recombinant IgG (Intravenous Gamma Globulin) affine peptide and application thereof in IgG antibody three-dimensional oriented fixation

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110637026A (en) * 2017-05-10 2019-12-31 慕尼黑工业大学 Photoconverted polypeptides and uses thereof
CN110922476A (en) * 2019-12-16 2020-03-27 蓝怡科技集团股份有限公司 Biotin coupled antibody and preparation method and application thereof
CN112326953A (en) * 2020-11-03 2021-02-05 广东海洋大学深圳研究院 Method for directionally labeling polybiotin by using antibody

Also Published As

Publication number Publication date
CN106478824B (en) 2020-04-24

Similar Documents

Publication Publication Date Title
CN101952432B (en) Peptide, use of the peptide, method for production of the peptide, solid support having the peptide immobilized thereon, and method for production of the solid support
CN103728447B (en) The antibody labeling method of controllable quantum dots locus specificity bridge joint coupling and application thereof
CN106478824A (en) A kind of biotinylated antibody of accurate Fc site covalent coupling labelling
WO2005042579A1 (en) Anti-sars virus antibody, hybridoma producing the antibody and immunoassay reagent using the antibody
Ding et al. Sortase-mediated phage decoration for analytical applications
KR101766271B1 (en) Recombinant Secondary Antibody Mimic as a Target-specific Signal Amplifier in Immunoassays
CN102998444B (en) Stereotactic fixing method of IgG antibody on surface of polystyrene carrier
Yue et al. PUP-IT2 as an alternative strategy for PUP-IT proximity labeling
He et al. An enzyme-linked immunosorbent assay and a gold-nanoparticle based immunochromatographic test for amatoxins using recombinant antibody
JPH02253162A (en) Detection using aequorin conjugated with material having specific conjugatability
Yu et al. Fc-specific and covalent conjugation of a fluorescent protein to a native antibody through a photoconjugation strategy for fabrication of a novel photostable fluorescent antibody
JP2022528465A (en) Antibodies to symmetric dimethylated arginine analytes and their uses
CN113621079B (en) Fusion protein of Fab antibody and calf intestinal alkaline phosphatase and preparation method thereof
CN114989257A (en) Amantadine antigen mimic epitope and application thereof in magnetic particle enzymatic chemiluminescence homogeneous immunoassay method
CN110343161B (en) Binding protein composition for detecting plasmodium falciparum HRP2 and plasmodium vivax LDH, and preparation method and application thereof
EP3129403B1 (en) Antibody against ht-2 toxin-ht-2 toxin antibody complex
WO2021113736A1 (en) Single-domain antibody to chloramphenicol
Zeng et al. Development and identification of monoclonal antibodies against parathion
US6713272B2 (en) Attachment of biomolecules to hydrophobic surfaces
Huang et al. Development of competitive and noncompetitive lateral flow immunoassays for pendimethalin using synthetic peptides
CN117347621B (en) Method for detecting aflatoxin B1 by using protein mimic antigen-nano antibody
CN116284424B (en) Nanobody of anti-mouse antibody crystallizable section and application thereof
CN108642017A (en) One plant can the anti-conotoxin of stably excreting cell strain of monoclonal antibody and application
US20050208586A1 (en) Using complement component C1q derived molecules as tracers for fluorescence polarization assays
CN116751260B (en) Method for generating universal multiple color development material with controllable size through cascade polymerization reaction

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP02 Change in the address of a patent holder

Address after: 261056 Shandong Province, Weifang city Weicheng District Baotong Street No. 7166

Patentee after: WEIFANG MEDICAL University

Address before: 261053 No. 288 Shengli East Street, Kuiwei District, Shandong, Weifang

Patentee before: WEIFANG MEDICAL University

CP02 Change in the address of a patent holder