CN106467565A - A kind of deoxyribose oligonucleotide and preparation method thereof - Google Patents

A kind of deoxyribose oligonucleotide and preparation method thereof Download PDF

Info

Publication number
CN106467565A
CN106467565A CN201610118368.7A CN201610118368A CN106467565A CN 106467565 A CN106467565 A CN 106467565A CN 201610118368 A CN201610118368 A CN 201610118368A CN 106467565 A CN106467565 A CN 106467565A
Authority
CN
China
Prior art keywords
product
formula
compound
obtains
dmtr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610118368.7A
Other languages
Chinese (zh)
Inventor
张鸿雁
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHENZHEN RIBO BIOTECHNOLOGY CO Ltd
Suzhou Ribo Life Science Co Ltd
Original Assignee
SHENZHEN RIBO BIOTECHNOLOGY CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHENZHEN RIBO BIOTECHNOLOGY CO Ltd filed Critical SHENZHEN RIBO BIOTECHNOLOGY CO Ltd
Publication of CN106467565A publication Critical patent/CN106467565A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/16—Purine radicals
    • C07H19/20—Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C07H19/207—Purine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids the phosphoric or polyphosphoric acids being esterified by a further hydroxylic compound, e.g. flavine adenine dinucleotide or nicotinamide-adenine dinucleotide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G79/00—Macromolecular compounds obtained by reactions forming a linkage containing atoms other than silicon, sulfur, nitrogen, oxygen, and carbon with or without the latter elements in the main chain of the macromolecule
    • C08G79/02—Macromolecular compounds obtained by reactions forming a linkage containing atoms other than silicon, sulfur, nitrogen, oxygen, and carbon with or without the latter elements in the main chain of the macromolecule a linkage containing phosphorus
    • C08G79/04—Phosphorus linked to oxygen or to oxygen and carbon
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Saccharide Compounds (AREA)

Abstract

A kind of deoxyribose oligonucleotide shown in formula (1) and its liquid-phase synthesis process.The method that the liquid phase synthesis that the present invention provides prepare deoxyribose oligonucleotide; include a kind of deoxyribose oligonucleotide protection group combined method; by directly protecting 3 ' phosphate groups of deoxyribose oligonucleotide with β cyanoethyl; and can directly participate in the synthesis of next round after sloughing β cyanoethyl; synthetic reaction is carried out in reaction bulb or reactor; do not limited by solid phase carrier or synthesizer, can achieve and prepare deoxyribose oligonucleotide on a large scale.

Description

A kind of deoxyribose oligonucleotide and preparation method thereof
Technical field
The present invention relates to a kind of deoxyribose oligonucleotide and preparation method thereof.
Background technology
Chemosynthesis deoxyribose oligonucleotide refers to, by promoting to form 5 ' -3 ' phosphodiester bonds between nucleotide monomer, thus multiple nucleotide units are connected as the process of deoxyribose oligonucleotide chain, be directed to the synthesis of the nucleotide of protection.
Deoxyribose oligonucleotide synthetic method general at present uses solid-phase synthesis; first 5 '-OH on nucleotide are protected to Methoxytrityl (DMT) with two; amino in base is protected with benzoyl, and 3 '-OH are activated with amino phosphorons acid compound.3 '-OH of first nucleotide are combined together with solid-phase resin; and slough the protection group on 5 '-OH; make to be formed a tris phosphite between the 3 '-OH being activated with amino phosphorons acid compound of exposed 5 '-OH and second nucleotide; tris phosphite forms phosphotriester through iodine oxidation, adds trichloroacetic acid and removes the protection group on 5 '-OH of second nucleotide.So far, deoxyribose oligonucleotide chain has extended nucleotide units, and can put into next round extension.Through the extension of some wheels, after whole deoxyribose oligonucleotide fragment synthesis finishes, with dense ammonium hydroxide, deoxyribose oligonucleotide fragment is eluted from solid-phase resin, obtain deoxyribose oligonucleotide through deprotection and purification.
The advantage of above-mentioned solid phase synthetic method is：1) automatization, synthetic reaction is all automatically performed by synthesizer；2) synthesis cycle is short；3) yield is high, and the general yield of condensation reaction of single step is more than 98%.But solid-phase synthesis there is also some shortcomings：1) synthesize small scale, solid phase synthesis scale fairly large at present is usually no more than 100 micromoles, much can not meet the requirement for medicine material；2) it is difficult to reach high-purity, due to the restriction of synthetic method, the deoxyribose oligonucleotide obtaining inevitably contains base number N-1, the deoxyribose oligonucleotide fragment of the non-targeted such as N-2, and this is very unfavorable for medicinal application；3) waste seriously, react for abundant, in each synthesis cycle, often need to add the phosphoramidite monomer being several times as much as reacting actual consumption amount to reach excess, and need after loop ends a large amount of organic solvents to be used as rinse solvent, wash away unreacted phosphoramidite monomer, 4) high cost, the required solid phase carrier of reaction and phosphoramidite monomer are expensive, make the deoxyribose oligonucleotide of synthesis with high costs.
Because critical function in vital movement for the deoxyribose oligonucleotide and the high speed development of current nucleic acids research technology, the synthesis meaning of extensive deoxyribose oligonucleotide is very great.
Content of the invention
The invention aims to overcoming the shortcomings of synthesis small scale of current deoxyribose oligonucleotide synthetic method, high cost, provide a kind of method that can synthesize deoxyribose oligonucleotide on a large scale.
The invention provides the deoxyribose oligonucleotide shown in a kind of formula (1)：
Wherein, R is hydrogen or R1, R1Represent trityl, monomethoxytrityl, two pairs of Methoxytrityl or trimethoxytrityl；
N is the integer of 1-100；
B represents cytosine base, thymine base or the uracil base that adenyl, exocyclic amino group that guanyl-, exocyclic amino group that exocyclic amino group protected by acyl group protected by acyl group are protected by acyl group, and the B in each repetitive is identical or different；R3Represent halogen atom, nitro or methoxyl group.
Wherein, described acyl group can be benzoyl, isobutyryl or acetyl group；Halogen atom can be chlorine or bromine.
In the compound of formula (1) that the present invention provides, when R is for H, the formula (2) that formula (1) and x as described below are more than or equal to when 1 is of equal value；When R is R1When, formula (1) is of equal value with formula (4) as described below.
Present invention also offers a kind of method of liquid phase synthesis deoxyribose oligonucleotide, it is characterized in that, the method includes in the presence of condensing agent, under the conditions of condensation reaction, so that the compound of formula (2) is contacted in the first liquid reaction medium with the compound of formula (3), obtain the compound of formula (4)；
Wherein,
X is the integer of 0-50；Y is the integer of 1-50；
B1And B2Each represent cytosine base, thymine base or uracil base that adenyl, exocyclic amino group that guanyl-, exocyclic amino group that exocyclic amino group protected by acyl group protected by acyl group are protected by acyl group, and the B in each repetitive1Or B2Identical or different；
R1And R3Definition as described in formula (1)；
A+Represent trialkylammonium ion or dialkyl ammonium ion.
The deoxyribose oligonucleotide sloughing protection group that the method that the present invention provides obtains, can have biological activity, can be used for the purposes of various deoxyribose oligonucleotides, and such as RNA disturbs.
The method that the liquid phase synthesis that the present invention provides prepare deoxyribose oligonucleotide; include a kind of deoxyribose oligonucleotide protection group combined method; by directly protecting 3 ' phosphate groups of deoxyribose oligonucleotide with β-cyanoethyl; and do not use solid phase carrier; formula (4) compound is made can directly to participate in the synthesis of next round after sloughing β-cyanoethyl; and synthetic product is consistent with solid-phase synthesis deprotection procedure, purity is higher.
The present invention is due to being reacted in the liquid phase it is not necessary to be used solid phase carrier, and because substrate is not required to several times excessively, saves raw material, reduce cost.Using the deoxyribose oligonucleotide salt protected as raw material, synthetic reaction is carried out in reaction bulb or reactor the present invention, is not limited by solid phase carrier or synthesizer, can achieve and prepares deoxyribose oligonucleotide on a large scale.
Brief description
The mass spectral analyses figure of 21 aggressiveness ribonucleic acid of the deprotection that Fig. 1 obtains for embodiment 1.
21 aggressiveness ribonucleic acid of the deprotection that Fig. 2 obtains for embodiment 1 and polyacrylamide gel electrophoresis (PAGE) figure of homotactic solid-phase synthesis product.
Specific embodiment
The invention provides the deoxyribose oligonucleotide shown in a kind of formula (1).
In formula (1)：
R is hydrogen or R1, R1Represent blocking group, can be the various groups that can protect 5 '-hydroxyl, preferably trityl, monomethoxytrityl, two pairs of Methoxytrityl or trimethoxytrityl；
N can be any positive integer, the preferably integer of 1-100, the more preferably integer of 1-50, the still more preferably integer for 1-30 in theory；
B represents cytosine base, thymine base or the uracil base that adenyl, exocyclic amino group that guanyl-, exocyclic amino group that exocyclic amino group protected by acyl group protected by acyl group are protected by acyl group, and the B in each repetitives can be identical or different；
R3Represent the substituent group on phenyl ring, the preferably R in halogen atom, nitro or methoxyl group, and each repetitive3Can be identical or different, wherein R3Position on phenyl ring does not limit, and can be ortho position, meta or para position.
During wherein n=1, what above-mentioned formula (1) represented is nucleotide, and when n is the integer more than 1, what above-mentioned formula (1) represented is deoxyribose oligonucleotide.
In formula (1), each the described acyl group as protection group can be identical or different, can be each benzoyl, isobutyryl or acetyl group.
In formula (1), described halogen atom can be fluorine, chlorine, bromine or iodine, preferably chlorine or bromine, more preferably chlorine.
In the compound of formula (1) that the present invention provides, when R is for H, the formula (2) that formula (1) and x as described below are more than or equal to when 1 is of equal value；When R is R1When, formula (1) is of equal value with formula (4) as described below, and, when R is R1When, formula (1) is of equal value with formula (6) as described below.
Present invention also offers a kind of method of liquid phase synthesis deoxyribose oligonucleotide, it is characterized in that, the method includes in the presence of condensing agent, under the conditions of condensation reaction, so that the compound of formula (2) is contacted in the first liquid reaction medium with the compound of formula (3), obtain the compound of formula (4).
In formula (2), (3) or (4),
X can be any nonnegative integer, the preferably integer of 0-50, the more preferably integer of 0-25, the still more preferably integer for 0-15 in theory；Y can be any positive integer, the preferably integer of 1-50, the more preferably integer of 1-25, the still more preferably integer for 1-15 in theory；
B1And B2Each represent cytosine base, thymine base or uracil base that adenyl, exocyclic amino group that guanyl-, exocyclic amino group that exocyclic amino group protected by acyl group protected by acyl group are protected by acyl group, and the B in each repetitive1Or B2Can be identical or different；The definition of described acyl group is as described in formula (1)；
R1、R2And R3Definition as described in formula (1)；
A+Represent trialkylammonium ion or dialkyl ammonium ion；Each alkyl in described trialkylammonium ion or dialkyl ammonium ion can be identical or different, can each have 1-6 carbon atom, preferably have 1-4 carbon atom.
The condensing agent that described condensation reaction is used and the condition of condensation reaction are well known within the skill of those ordinarily skilled, the present invention has no particular limits to it, it is, for example possible to use one or more of 1- sym-trimethylbenzene. sulphonyl triazole, 1- sym-trimethylbenzene. sulphonyl (3- nitro)-triazole, 1- sym-trimethylbenzene. sulphonyl tetrazolium, 1- equal tri isopropyl benzenesulfonyl triazole, 1- equal triisopropyl tosyl (3- nitro)-triazole and 1- equal triisopropyl sulphonyl tetrazolium are as condensing agent；Pyridine, dichloromethane, acetonitrile, dioxane and oxolane one or more of can be used as described first liquid reaction medium；
Described condensation reaction condition can include：The compound of the formula (3) with respect to 1 mole, when x is equal to 0, when that is, the compound of formula (2) is 3- hydroxypropionitrile, the consumption of the compound of formula (2) can be 1-5 mole, preferably 1.2-3 mole can be, more preferably 1.5-2 mole can be；When x is more than or equal to 1, the consumption of the compound of formula (2) can be 0.3-1.25 mole.
With respect to the compound of 1 mole of formula (3), the consumption of condensing agent can be 2-20 mole, preferably 2-5 mole.
The compound of the formula (3) with respect to 1 mole, the consumption of the first liquid reaction medium can be 2-50 liter, can be preferably 2-30 liter.
Reaction temperature can be 0-50 DEG C, preferably can be 20-40 DEG C；Response time can be 0.5-100 hour, can be preferably 1-10 hour.
After condensation reaction completes, condensation reaction can be terminated, and isolate product.The method of described termination condensation reaction and the method isolating product are well known within the skill of those ordinarily skilled, and the present invention has no particular limits to it.
For example, the described method terminating condensation reaction, can be at 0-15 DEG C, by reaction solution and water mixing 5-30 minute, the first liquid reaction medium with respect to 1 liter, the consumption of water can be 0.05-0.2 liter.
Described terminate the method for condensation reaction or reaction solution mixed with saturated sodium bicarbonate solution, at 0-50 DEG C, holding 5-10 minute under agitation.Saturated sodium bicarbonate solution can be 0.05-0.2 with the volume ratio of described first liquid reaction medium：1.
Described detached method, when the displacement needing to be discussed below the compound of formula (4) is reacted, can include：Reaction solution rotation after terminating reaction is evaporated off solvent, it is re-dissolved in organic solvent, with acid for adjusting pH value to 3-5, wash one or many with water, the first liquid reaction medium with respect to 1 liter, the consumption of organic solvent is 2-20 liter, the consumption of the water of washing is 2-20 liter, after anhydrous sodium sulfate drying organic faciess, rotation again is evaporated off solvent, and normal pressure post separation obtains final product product.Described organic solvent can be one or more of dichloromethane, chloroform and ethyl acetate, and described acid can be the oxalic acid and/or acetic acid that concentration is 1-10 weight %.
Described detached method; when needing the hydrolysis being discussed below the compound of formula (4) or sloughing whole protection group; can include being evaporated off after solvent mixing with organic solvent by the reaction solution rotation after terminating reaction; saturated sodium bicarbonate solution is added to be washed; by dry for organic faciess, filtration, concentration, normal pressure post separation, you can obtain product.Described organic solvent can be one or more of dichloromethane, chloroform and ethyl acetate.Described organic solvent can be 2-20 with the volume ratio of described first liquid reaction medium：1.Described washing can carry out one or many, and the cumulative volume of saturated sodium bicarbonate solution of washing can be 2-20 with the volume ratio of described first liquid reaction medium：1.Described drying, filtration, concentration, normal pressure post separation method known to those skilled in the art, will not be described here.
Therefore, the first embodiment according to the present invention, the method of liquid phase synthesis deoxyribose oligonucleotide provided by the present invention, it is additionally may included in the second liquid reaction medium, in the presence of trialkylamine or dialkylamine, under conditions of hydrolysis, the compound of formula (4) is contacted generation hydrolysis with water, slough β-cyanoethyl, obtain sloughing the product after the hydrolysis of β-cyanoethyl.
Wherein, the condition of described hydrolysis can include：The compound of the formula (4) with respect to 1 mole, the consumption of trialkylamine or dialkylamine can be 1-200 mole, preferably 40-150 mole；The consumption of the second liquid reaction medium can be 5-50 liter, preferably 5-40 liter；The consumption of water can be 2-20 liter, preferably 2-15 liter；Reaction temperature can be 0-50 DEG C, preferably 10-35 DEG C；Response time can be 0.25-2 hour, preferably 0.25-1 hour.
Wherein, the second described liquid reaction medium is preferably pyridine and/or acetonitrile.
Each alkyl in described trialkylamine or dialkylamine is identical or different, and each has 1-6 carbon atom.For example, described trialkylamine can be one or more of trimethylamine, triethylamine and diisopropyl ethyl amine, and described dialkylamine can be one or more of dimethylamine, diethylamine and diisopropylamine.
After described hydrolysis complete, the product after hydrolysis can be isolated.The method isolating the product after hydrolysis is well known within the skill of those ordinarily skilled, and the present invention has no particular limits to it, and for example, this separation method can include：Reactant liquor rotation is evaporated off solvent, then with organic solvent dissolving, adds wash solution to be washed, point liquid obtains organic faciess, after anhydrous sodium sulfate drying, revolving removes solvent, you can obtain product.Described organic solvent can be one or more of dichloromethane, chloroform or ethyl acetate, and described organic solvent can be 1-10 with the volume ratio of described second liquid reaction medium：1.Described wash solution can be triethylamine bicarbonate (TEAB) aqueous solution or the saturated sodium bicarbonate solution of 0.1-1 mol/L concentration.Described washing can carry out one or many, and the cumulative volume of TEAB aqueous solution of washing can be 1-10 with the volume ratio of described second liquid reaction medium：1.
It is then possible to using the product after the described hydrolysis isolated as the compound of described formula (3), carry out foregoing condensation reaction again with the compound of described formula (2).
Second embodiment according to the present invention, the method of liquid phase synthesis deoxyribose oligonucleotide provided by the present invention, is additionally may included in the 3rd liquid reaction medium, in the presence of organic acid, under conditions of replacement reaction, by the R of the compound of formula (4)1Group displacement is hydrogen, obtains R1Group is replaced into the product of hydrogen.
Wherein, described conditions of replacement reaction can be：The compound of the formula (4) with respect to 1 mole, the usage amount of organic acid can be 2-20 mole, preferably 2-10 mole；The consumption of the 3rd liquid reaction medium can be 10-150 liter, preferably 10-130 liter；Reaction temperature can be -10 DEG C to 40 DEG C, preferably -10 DEG C to 30 DEG C；Response time can be 1-60 minute, preferably 1-20 minute；Described organic acid is preferably selected from one or more of toluenesulfonic acid, benzenesulfonic acid, trichloroacetic acid, dichloroacetic acid, trifluoroacetic acid；The 3rd described liquid reaction medium can be one or more of dichloromethane, chloroform, acetonitrile and methanol.
Wherein, after described displacement reaction completes, R can be isolated1Group is replaced into the product of hydrogen.Isolate R1The method that group is replaced into the product of hydrogen is well known within the skill of those ordinarily skilled, the present invention has no particular limits to it, for example, the method that this isolates and purifies can include with the mixture with displacement reaction gained in aqueous slkali, liquid is divided to obtain organic faciess, be washed once multiple again with aqueous slkali, by dry for organic faciess, filtration, concentration, normal pressure post separation, you can obtain the reacted product of displacement of purification.The 3rd liquid reaction medium with respect to 1 liter, the aqueous slkali consumption of washing can be 0.2-1 liter, and described aqueous slkali can be the sodium carbonate liquor of the sodium bicarbonate aqueous solution, the potassium bicarbonate aqueous solution of saturation or saturation of saturation.Described drying, filtration, concentration, normal pressure post separation method known to those skilled in the art, will not be described here.
It is then possible to by the R isolating1Group be replaced into hydrogen after product as the compound of described formula (2), carry out foregoing condensation reaction again with the compound of described formula (3).
When x is more than or equal to 1, the compound of formula (2) can pass through the R of the compound of formula (6)1Group displacement obtains for hydrogen；
Wherein, x, B1、R3Definition as described in formula (2), but x be more than or equal to 1；R1Definition as described in formula (3).
The R of the described compound by formula (6)1Group displacement is the method for hydrogen, according to by the R of the compound of formula (4)1Group displacement is that the method for hydrogen is carried out, and except for the difference that replaces the compound of formula (4) with the compound of formula (6).
The preparation method of the compound of described formula (6) includes：Using the compound of formula (5) as the compound of formula (3), it is equal to the compound of the formula (2) when 0, i.e. 3- hydroxypropionitrile with x, carries out foregoing condensation reaction.
Wherein, x, B1And R3Definition as described in formula (2), but x be more than or equal to 1；R1And A+Definition as described in formula (3).
When the y in formula (3) is equal with the x in formula (5), formula (3) is equivalent to formula (5).
The preparation method of the compound of the described compound of formula (3) and/or formula (5), is documented in open file, will not be described here.
For the small nucleic acids of long segment, the invention provides modular synthesis strategy, such as 21 poly- nucleic acid chains, it is split into the fragment that 4 parallel 5-6 gather, the poly- short-movie section of 5-6 splits into the parallel poly- short-movie section of more 2-3 again.Through 2 described poly- short-movie sections of synthesis, the oligonucleotide chain that n poly- (n is purpose length) is gathered in described 3 then can be synthesized.Therefore, in theory, the oligonucleotide chain of random length can be synthesized using the method that the present invention provides, only the present invention will be described taking up to 42 aggressiveness as a example for following examples.
By method provided by the present invention, the deoxyribose oligonucleotide of the full guard with formula (4) can be synthesized.Whole blocking groups of the deoxyribose oligonucleotide of described full guard include：The group of the acyl group in formula (4), β-cyanoethyl and formula (7), R1、R2,
Wherein R3Definition identical with formula (4).
Can divide 2 steps that the deoxyribose oligonucleotide of described full guard is sloughed described whole blocking groups：
1st step, by formula (4) compound in the 4th liquid reaction medium, under the conditions of the first deprotection reaction, is contacted with ammonia, sloughs the blocking group of partial category, obtains sloughing the product of the blocking group of partial category；The blocking group of described partial category is one or more of group of acyl group, β-cyanoethyl and formula (7) in formula (4).
Wherein, the 4th described liquid reaction medium can be one or more of dioxane, acetonitrile, pyridine, ethanol and methanol；The first described deprotection reaction condition includes, the compound of the formula (4) with respect to 1 gram, and the consumption of ammonia can be 0.02-0.5L, preferably 0.05-0.3L；The consumption of the 4th liquid reaction medium can be 0.01-0.2L, preferably 0.02-0.1 liter；Reaction temperature can be 10-60 DEG C, preferably 10-30 DEG C；Response time can be 5-100 hour, preferably 10-60 hour；The concentration of wherein said ammonia is 25-28 mass %.After the completion of first deprotection reaction, concentrating under reduced pressure can be passed through, remove solvent to being completely dried, the product of the blocking group of partial category as sloughed by the solid obtaining.
2nd step; in the 5th liquid reaction medium, under the conditions of the second deprotection reaction, the product of the described blocking group sloughing partial category is contacted with triethylamine three Fluohydric acid. (TEA 3HF); slough the other protection group of residue class, obtain sloughing the product of whole blocking groups；The other protection group of described residue class is R1And R2, wherein R1And R2Definition identical with formula (4).
Wherein, the 5th described liquid reaction medium is dimethyl sulfoxide；The second described deprotection reaction condition includes：The product sloughing part blocking group with respect to 1 gram, the consumption of triethylamine three Fluohydric acid. is 0.002-0.05L, preferably 0.005-0.03L；The consumption of the 5th liquid reaction medium is 0.002-0.05L, preferably 0.005-0.03L；Reaction temperature is 40-85 DEG C, preferably 50-75 DEG C；Response time is 1-5 hour, preferably 2-4 hour.
After described deprotection reaction completes, the product after deprotection reaction can be isolated.The method isolating the product after deprotection reaction is well known within the skill of those ordinarily skilled, and the present invention has no particular limits to it, and for example, detached method can be：Add the n-butyl alcohol of pre-cooling, precipitation desoxydation ribooligonucleotide in reactant liquor, precipitation is collected by centrifugation, obtains deoxyribose oligonucleotide crude product.
Purification can be carried out to the deoxyribose oligonucleotide crude product obtaining, the method for purification deoxyribose oligonucleotide crude product is well known within the skill of those ordinarily skilled, and the present invention has no particular limits to it, for example, the method for purification can be：Deoxyribose oligonucleotide crude product is splined on anti-phase octadecylsilane chemically bonded silica filler (ODS) chromatograph, collects effluent, then by effluent lyophilization, obtain target product.
The deoxyribose oligonucleotide sloughing protection group that the method that the present invention provides obtains, has biological activity, can be used for the purposes of various deoxyribose oligonucleotides, such as nucleic acid vaccine and nucleic acid drug.
The gas being used in the present invention and liquid volume refer both to 1 standard atmosphere pressure, 20 DEG C when volume.
It is more fully described the present invention below by embodiment, but the scope of the present invention is not limited to the citing in embodiment.
In embodiment, the acquisition modes of used raw material are as follows：
The deoxyribonucleotide of four kinds of protections, including adenine deoxyribonucleotide (A), thymine deoxyribotide (T), cytosine deoxyribonucleotide (C), guanine deoxyribonucleotide (G)；Wherein with the exocyclic amino group of benzoyl protection base, with 5 ' hydroxyls of two pairs of Methoxytrityl protections；The nucleotide of whole four kinds of protections is purchased from Shanghai JiMa pharmacy Technology Co., Ltd.
Triethylamine：Purchased from Tianjin north sky medical chemistry chemical reagent work；
1,2,4- triazole：Purchased from Alfa Aesar；
2- chlorphenyl dichloro substituted phosphate：Purchased from Alfa Aesar；
1- sym-trimethylbenzene. sulphonyl (3- nitro)-triazole (MSNT) is purchased from Sigma Aldrich.
Embodiment 1
This embodiment synthesizes deoxyribose oligonucleotide.
Synthesis target：21 poly- full guard widow's ribose deoxyribose oligonucleotides
Sequence：DMTr[CCTTGAGGCATACTTCAAATT]OE
Note：The deoxyribonucleotide of four kinds of protections of tetra- letter representations of A, T, C, G in bracket, its exocyclic amino group is protected with benzoyl, omits the phosphate ester between base and phosphoric acid phenol ester protection group；
The group on the bracket left side represents the protection group of 5 ' ends, is two pairs of Methoxytrityl (DMTr), and the group on the bracket left side can also be hydroxyl (HO)；
Group on the right of bracket represents phosphoric acid propionitrile ester protection group (OE) of 3 ' ends, and the group on the right of bracket can also be phosphate (PO-).
The synthesis of the present embodiment divides 30 steps to complete according to following synthesis strategy.
(1) compound monomer DMTr [A] PO of synthesis type (3)-：
1 is added in 1L round-bottomed flask, 2, 4- triazole (13.8g, 200mmol) with anhydrous pyridine (31.6g, 400mmol), with the dissolving of 130ml dichloromethane, Deca 2- chlorphenyl dichloro substituted phosphate (19.6g under condition of ice bath, dichloromethane solution 65ml 80mmol), stirring reaction 0.5h, adenine deoxyribonucleotide (the 39.4g of Deca protection again, dichloromethane solution 150ml 50mmol), the TEAB solution that 150ml concentration is 1M is added after stirring reaction 2h under condition of ice bath, after continuing stirring 10 minutes, washed with the TEAB solution of 1M concentration after three times (each 90ml), all organic faciess anhydrous Na2SO4It is dried, filters, rotation is evaporated off solvent, obtains product 54.0g, yield 100%.Yield is the percentage ratio with the theoretical yield calculating by the adenine deoxyribonucleotide of protection for the weight of product.
Detect this product31PNMR composes, and obtaining data is31PNMR(CDCl3, 121M) and δ -6.09, with pentavalent di-phosphate ester31PNMR theoretical range is consistent (ask for an interview list of references Tetrahedron, 1980 (36), the 3075-3085 page) it was demonstrated that this product has the structure of formula (3) really.
Obtain product M with ESI-MS detection-For 976.2915, the M with target product-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(2) compound monomer DMTr [T] PO of synthesis type (3)-
Synthesized according to step (1) identical method, except for the difference that, replaced the adenine deoxyribonucleotide protected with the thymine deoxyribotide of protection.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(3) compound monomer DMTr [G] PO of synthesis type (3)-
Synthesized according to step (1) identical method, except for the difference that, replaced the adenine deoxyribonucleotide protected with the guanine deoxyribonucleotide of protection.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(4) compound monomer DMTr [C] PO of synthesis type (3)-
Synthesized according to step (1) identical method, except for the difference that, replaced the adenine deoxyribonucleotide protected with the cytosine deoxyribonucleotide of protection.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(5) compound monomer HO [A] OE of synthesis type (2)：
DMTr [A] PO that step (1) obtains is added in 250ml round-bottomed flask-(17.3g, 16mmol), after anhydrous pyridine (100ml) dissolving, adds 3- hydroxypropionitrile (1.70g, 24mmol), adds MSNT (13.3g, 44.8mmol).20 DEG C of reaction 2h, thin layer chromatography chromatograph (TLC) display is reacted completely, adds water (10ml) terminating reaction, and revolving is dissolved in CH after removing solvent again2Cl2(200ml) oxalic acid aqueous solution, adding appropriate 5 weight % adjusts pH value to 3-4, and point liquid obtains organic faciess, then washes once with water (100ml), organic faciess anhydrous Na2SO4It is dried, revolving removes solvent again, add the CH of the p-methyl benzenesulfonic acid (TsOH) of 2 weight %2Cl2/CH3OH(v：V=7：3) solution (700ml), 0 DEG C of strong agitation 5 minutes, use saturation NaHCO immediately3Solution neutralizes, and point liquid obtains organic faciess, then uses saturation NaHCO3Solution (300ml) is washed once, organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification obtains product 10.9g, yield 93.4%.Yield be product weight with by DMTr [A] PO-The percentage ratio of the theoretical yield calculating.
Detect this product31PNMR composes, and obtaining data is31PNMR(CDCl3, 121M) and δ -7.66, -7.79, with pentavalent phosphotriester31PNMR theoretical value is consistent it was demonstrated that this product has the structure of formula (2) really.
Obtain the M of this product with ESI-MS detection-For 728.1956, the M with target compound-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(6) compound monomer HO [T] OE of synthesis type (2)：
Synthesized according to step (5) identical method, except for the difference that, DMTr [T] PO that obtained with step (2)-Replace DMTr [A] PO that step (1) obtains-.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(7) compound monomer HO [G] OE of synthesis type (2)：
Synthesized according to step (5) identical method, except for the difference that, DMTr [G] PO that obtained with step (3)-Replace DMTr [A] PO that step (1) obtains-.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(8) compound monomer HO [C] OE of synthesis type (2)：
Synthesized according to step (5) identical method, except for the difference that, DMTr [C] PO that obtained with step (4)-Replace DMTr [A] PO that step (1) obtains-.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(9) dimer DMTr [AA] OE of synthesis type (4)：
DMTr [A] PO that step (1) obtains is added in 100ml round-bottomed flask-(2.59g, 2.40mmol), HO [A] OE (1.46g, 2.00mmol) that step (5) obtains, after the dissolving of 10ml anhydrous pyridine, add MSNT (1.66g, 5.60mmol), room temperature reaction 2h, TLC show and react completely, add 2ml saturation NaHCO3Solution terminating reaction, revolving is dissolved in the CH of 50ml again after removing solvent2Cl2In, saturation NaHCO3Solution washs 2 times (each 30ml), organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification, obtains product 3.26g.
Detect this product31PNMR composes, and obtaining data is31PNMR(CDCl3, 121M) and δ -7.36, -7.46, -7.55, -7.90, and containing 2 pentavalent phosphotriester structures31PNMR theoretical value is consistent it was demonstrated that this product has the structure of formula (4) really.
Obtain the M of this product with ESI-MS detection-For 1687.64, the M with target compound-Theoretical value is consistent it was demonstrated that this product has the structure of formula (4) really.
(10) dimer synthon DMTr [AA] PO-：
DMTr [AA] OE that step (9) is purified into is dissolved in 60ml pyridine/triethylamine/water (v：v：V=3：1：1), be stirred at room temperature 30 minutes, TLC shows and reacts completely, will reactant liquor revolving remove solvent after be re-dissolved in the CH of 100ml2Cl2In, the TEAB solution being 1M with concentration washs three times (each 50ml), and point liquid obtains organic faciess, anhydrous Na2SO4Remove solvent after organic faciess are dried, obtain product 3.20g, step (9) and step (10) reaction gross production rate 93.9%.Yield is the percentage ratio with the theoretical yield calculating by HO [A] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(11) dimer synthon DMTr [GG] PO-：
Synthesized according to step (9) and step (10) identical method, except for the difference that, DMTr [G] PO that obtained with step (3)-Replace DMTr [A] PO that step (1) obtains-, HO [G] OE that obtained with step (7) replaces HO [A] OE that step (5) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(12) dimer synthon DMTr [AC] PO-：
Synthesized according to step (9) and step (10) identical method, except for the difference that, HO [C] OE that obtained with step (8) replaces HO [A] OE that step (5) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(13) dimer synthon HO [AT] OE：
DMTr [A] PO that step (1) obtains is added in 500ml round-bottomed flask-(16.2g, 15mmol), after the dissolving of 100ml anhydrous pyridine, add HO [T] OE (7.53g, 12.5mmol) that step (6) obtains, add MSNT (10.4g, 35mmol), room temperature reaction 2h, TLC show and react completely, add 10ml water terminating reaction, revolving is dissolved in 300ml CH after removing solvent again2Cl2, add appropriate 5% oxalic acid aqueous solution to adjust pH value to 3-4, point liquid obtains organic faciess, then with 150ml water washing once, anhydrous Na2SO4Organic faciess are dried, revolving removes solvent again, add the CH of the toluenesulfonic acid (TsOH) of 2 weight %2Cl2/CH3OH(v：V=7：3) solution (700ml), 0 DEG C of strong agitation 5 minutes, use saturation NaHCO immediately3Solution neutralizes, and point liquid obtains organic faciess, then uses saturation NaHCO3Solution (300ml) is washed once, organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification obtains product 12.9g.Yield 81.8%.Yield is the percentage ratio with the theoretical yield calculating by HO [T] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(14) dimer synthon HO [CT] OE：
Synthesized according to step (13) identical method, except for the difference that, DMTr [C] PO that obtained with step (4)-Replace DMTr [A] PO that step (1) obtains-.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(15) dimer synthon HO [GA] OE：
Synthesized according to step (13) identical method, except for the difference that, DMTr [G] PO that obtained with step (3)-Replace DMTr [A] PO that step (1) obtains-, HO [A] OE that obtained with step (5) replaces HO [T] OE that step (6) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(16) dimer synthon HO [TC] OE：
Synthesized according to step (13) identical method, except for the difference that, DMTr [T] PO that obtained with step (2)-Replace DMTr [A] PO that step (1) obtains-, HO [C] OE that obtained with step (8) replaces HO [T] OE that step (6) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(17) dimer synthon HO [TT] OE：
Synthesized according to step (13) identical method, except for the difference that, DMTr [T] PO that obtained with step (2)-Replace DMTr [A] PO that step (1) obtains-.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(18) synthesize trimer DMTr [CCT] PO-：
DMTr [C] PO that step (4) obtains is added in 100ml round-bottomed flask-(3.17g, 3.00mmol), HO [CT] OE (3.09g that step (14) obtains, 2.50mmol), after the dissolving of 20ml anhydrous pyridine, add MSNT (2.08g, 7.00mmol), room temperature reaction 2h, TLC show and react completely, add 2ml saturation NaHCO3Solution terminating reaction, revolving is dissolved in 100ml CH after removing solvent again2Cl2, with 50ml saturation NaHCO3Solution washs, and point liquid obtains organic faciess, uses anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after organic faciess are dried2Cl2/CH3OH(v：V=10：1)) purification.Purified product is dissolved in 60ml pyridine/triethylamine/water (v：v：V=3：1：1), it is stirred at room temperature 30 minutes, after TLC shows reaction completely, reactant liquor revolving is removed after solvent, is re-dissolved in 100ml CH2Cl2, TEAB solution three times (each 50ml) of washing of 1M concentration, separate organic faciess, anhydrous Na2SO4Remove solvent after drying, obtain product 4.89g, yield 88.5%.Yield is the percentage ratio with the theoretical yield calculating by HO [CT] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(19) synthesize trimer HO [TGA] OE：
DMTr [T] PO that step (2) obtains is added in 250ml round-bottomed flask-(10.0g, 10.5mmol), HO [GA] OE (12.0g, 8.76mmol) that step (15) obtains, after the dissolving of 50ml anhydrous pyridine, divide 3 addition MSNT (7.31g, 24.5mmol), room temperature reaction 2h, TLC show and react completely, add 5ml water terminating reaction, revolving is dissolved in 200ml CH after removing solvent again2Cl2, add appropriate 5% oxalic acid aqueous solution to adjust pH value to 3-4, separate organic faciess, then washed once with 100ml, anhydrous Na2SO4Organic faciess are dried, revolving removes volume again, add the CH of the TsOH of 550ml 2%2Cl2/CH3OH(v：V=7：3) solution, 0 DEG C of strong agitation, after 5 minutes, uses saturation NaHCO immediately3Solution neutralizes, and separates organic faciess, then with 200ml saturation NaHCO3Solution is washed once, organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification.Obtain product 13.0g, yield 78.0%.Yield is the percentage ratio with the theoretical yield calculating by HO [GA] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(20) synthesize trimer HO [CAT] OE：
Synthesized according to step (19) identical method, except for the difference that, DMTr [C] PO that obtained with step (4)-Replace DMTr [T] PO that step (2) obtains-, HO [AT] OE that obtained with step (13) replaces HO [GA] OE that step (15) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(21) synthesize trimer HO [TTC] OE：
Synthesized according to step (19) identical method, except for the difference that, HO [TC] OE that obtained with step (16) replaces HO [GA] OE that step (15) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(22) synthesize trimer HO [ATT] OE：
Synthesized according to step (19) identical method, except for the difference that, DMTr [A] PO that obtained with step (1)-Replace DMTr [T] PO that step (2) obtains-, HO [TT] OE that obtained with step (17) replaces HO [GA] OE that step (15) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(23) six aggressiveness DMTr [CCTTGA] PO are synthesized-：
DMTr [CCT] PO that step (18) obtains is added in 100ml round-bottomed flask-(4.18g, 1.89mmol), HO [TGA] OE (3.00g that step (19) obtains, 1.58mmol), after the dissolving of 10ml anhydrous pyridine, add MSNT (1.31g, 4.42mmol), after room temperature reaction 3h, TLC show reaction completely, add 2ml saturation NaHCO3Solution terminating reaction, after revolving removing solvent, (eluent is CH to column chromatography2Cl2/CH3OH(v：V=10：1)) purification.Product after purification is dissolved in 60ml pyridine/triethylamine/water (v：v：V=3：1：1), it is stirred at room temperature 30 minutes, after TLC shows reaction completely, reactant liquor revolving is removed and after solvent, is re-dissolved in 100ml CH2Cl2, TEAB solution three times (each 50ml) of washing of 1M concentration, separate organic faciess anhydrous Na2SO4Remove solvent after drying, obtain product 5.00g, yield 79.3%.Yield is the percentage ratio with the theoretical yield calculating by HO [TGA] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(24) synthesize pentamer DMTr [ACTTC] PO-：
Synthesized according to step (23) identical method, except for the difference that, DMTr [AC] PO that obtained with step (12)-Replace DMTr [CCT] PO that step (18) obtains-, HO [TTC] OE that obtained with step (21) replaces HO [TGA] OE that step (19) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(25) synthesize pentamer HO [GGCAT] OE：
DMTr [GG] PO that step (11) obtains is added in 250ml round-bottomed flask-(5.72g, 3.36mmol), HO [CAT] OE (5.30g, 2.80mmol) that step (20) obtains, after the dissolving of 15ml anhydrous pyridine, add MSNT (2.34g, 7.84mmol), room temperature reaction 2h, TLC show and react completely, add 1.5ml water terminating reaction, revolving is dissolved in 100ml CH after removing solvent again2Cl2, add appropriate 5% oxalic acid aqueous solution to adjust pH value to 3-4, separate organic faciess, then washed once with 50ml, anhydrous Na2SO4Organic faciess are dried, revolving removes volume again, add the CH of the TsOH of 170ml 2%2Cl2/CH3OH(v：V=7：3) solution, 0 DEG C of strong agitation, after 5 minutes, uses saturation NaHCO immediately3Solution neutralizes, and separates organic faciess, then with 80ml saturation NaHCO3Solution is washed once, organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification.Obtain product 5.3g, yield 59.6%.Yield is the percentage ratio with the theoretical yield calculating by HO [CAT] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(26) synthesize pentamer HO [AAATT] OE：
Synthesized according to step (25) identical method, except for the difference that, DMTr [AA] PO that obtained with step (10)-Replace DMTr [GG] PO that step (11) obtains-, HO [TTC] OE that obtained with step (22) replaces HO [CAT] OE that step (20) obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(27) 11 aggressiveness DMTr [CCTTGAGGCAT] PO are synthesized-：
DMTr [CCTTGA] PO that step (23) obtains is added in 100ml round-bottomed flask-(4.86g, 1.20mmol), HO [GGCAT] OE (3.18g that step (25) obtains, 1.0mmol), after the dissolving of 10ml anhydrous pyridine, add MSNT (0.83g, 2.80mmol), room temperature reaction 4h, TLC show and react completely, add 1ml saturation NaHCO3Solution terminating reaction, adds 100mlCH2Cl2, then with 50ml saturation NaHCO3Solution is washed once, then is washed once with 50ml, anhydrous Na2SO4It is dried, revolving removes solvent, (eluent is CH to column chromatography2Cl2/CH3OH(v：V=10：1)) purification, purified product is dissolved in 40ml pyridine/triethylamine/water (v：v：V=3：1：1), it is stirred at room temperature 30 minutes, TLC shows and reacts completely, reactant liquor revolving is removed and after solvent, is re-dissolved in 100mlCH2Cl2, TEAB solution three times (each 50ml) of washing of 1M concentration, separate organic faciess, anhydrous Na2SO4Organic faciess are dried, remove solvent, obtain product 2.89g, yield 42.7%.Yield is the percentage ratio with the theoretical yield calculating by HO [GGCAT] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(28) ten aggressiveness HO [ACTTCAAATT] OE are synthesized
DMTr [ACTTC] PO that step (24) obtains is added in 100ml round-bottomed flask-(4.86g, 1.43mmol), HO [AAATT] OE (3.70g that step (26) obtains, 1.19mmol), after the dissolving of 10ml anhydrous pyridine, add MSNT (0.99g, 3.33mmol), room temperature reaction 4h, TLC show and react completely, add 1ml saturation NaHCO3Solution terminating reaction, adds 100ml CH2Cl2, then with 50ml saturation NaHCO3Solution is washed once, then is washed once with 50ml, anhydrous Na2SO4Organic faciess are dried, revolving removes solvent, cross post separation, the product obtaining adds the CH of the TsOH of 150ml2%2Cl2/CH3OH(v：V=7：3) solution, 0 DEG C of strong agitation 10 minutes, use saturation NaHCO immediately3Solution neutralizes, and separates organic faciess, then with 50ml saturation NaHCO3Solution is washed once, organic faciess anhydrous Na2SO4Solvent is removed, (eluent is CH to column chromatography after drying2Cl2/CH3OH(v：V=10：1)) purification obtains product 4.6g.Yield 63.5%.Yield is the percentage ratio with the theoretical yield calculating by HO [AAATT] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(29) 21 aggressiveness DMTr [CCTTGAGGCATACTTCAAATT] OE are synthesized：
DMTr [CCTTGAGGCAT] PO that step (27) obtains is added in 50ml round-bottomed flask-(2.80g, 0.39mmol), HO [ACTTCAAATT] OE (2.17g that step (28) obtains, 0.36mmol), after the dissolving of 10ml anhydrous pyridine, add MSNT (321mg, 1.08mmol), room temperature reaction 10h, adds 1ml saturation NaHCO3Solution terminating reaction, adds 100ml CH2Cl2, with saturation NaHCO of 50ml3Solution is washed once, then is washed once with 50ml, anhydrous Na2SO4Organic faciess are dried, revolving removes solvent, (eluent is CH to column chromatography2Cl2/CH3OH(v：V=10：1)) purification, obtains product 2.48g, yield 50.1%.Yield is the percentage ratio with the theoretical yield calculating by HO [ACTTCAAATT] OE for the weight of product.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (4) really.
So far, 21 aggressiveness ribonucleic acid DMTr [CCTTGAGGCATACTTCAAATT] OE of full guard have been obtained with liquid phase method synthesis.
(30) deprotection：
21 aggressiveness ribonucleic acid DMTr [CCTTGAGGCATACTTCAAATT] OE of the full guard that 10mg step (29) is obtained are dissolved in the dioxane of 0.5ml, add the ammonia of 1ml 25 mass % concentration, and vibration mixes, and room temperature places 40h.After the completion of reaction, concentrating under reduced pressure, remove solvent to being completely dried.Remaining solid is dissolved in 100 μ l dimethyl sulfoxide again, add 125 μ l triethylamine three Fluohydric acid. (TEA 3HF), after mixing, it is heated to 65 DEG C, after reaction 2.5h, add the n-butyl alcohol that 1ml is cooled to -20 DEG C in advance, precipitation desoxydation ribooligonucleotide, precipitation is collected by centrifugation, obtains 3mg crude product.Through anti-phase ODS column chromatography polishing purification, specific operating procedure reference literature (Molecular Cloning:A Laboratory guide (third edition), Science Press's in September, 2002 is published) is carried out, then lyophilization, obtains 1.6mg target product.
The quality of the target product being obtained with Shimadzu AXIMA-CFR plus type MALDI-TOF mass spectrometry procedure (30), obtains mass spectrum as shown in Figure 1.
Mass spectrometry results show：The few ribonucleic acid that step (30) obtains has two main peaks that m/z is 6701.97 and 3351.22, it is respectively single electric charge peak and the double charge peak of this few ribonucleic acid, consistent with its theoretical charge peak (m/z is 6702 and 3351), and no other miscellaneous peaks in mass spectrum.Therefore, mass spectrometry results show：The few ribonucleic acid quality that step (30) obtains is correct, and has higher purity.
Take the use ABI3900 type RNA solid phase synthetic instrument synthesis of step (30) product of 300ng and 300ng respectively, there is the solid phase synthesis product (purchased from Shanghai JiMa pharmacy Technology Co., Ltd) of target sequence (5 '-CCTTGAGGCATACTTCAAATT-3 '), and the sample 300ng of both mixed in equal amounts carries out polyacrylamide gel electrophoresis (PAGE) detection.Glue figure testing result is as shown in Figure 2.Electrophoresis result shows：The oligodeoxyribonucleotide of the same sequence that two kinds of distinct methods synthesize, on glue figure, pillar location is identical, and will be still identical for the pillar location after two sample mix, and no obvious miscellaneous band.Prove that the oligodeoxyribonucleotide of the same target sequence that two kinds of distinct methods synthesize has identical electrophoretic mobility.
By tiny RNA cloning and sequencing technology (list of references Bartel, D.P., (2004), cell, the 116th phase, page 281), using the tiny RNA Cloning Kit (production number of TaKaRa company：DRR065) the deoxyribose oligonucleotide of the product of cloning process (30), concrete operation step is carried out with reference to this kit specification, after clone's success, deliver to Invitrogen company and measure base sequence, concrete steps reference literature (Poth, M.J etc., (1985), journal of biological chemistry, the 260th phase, page 9326) carry out.
Cloning and sequencing result is as follows：5 '-CCTTGAGGCATACTTCAAATT-3 ' are it was demonstrated that the base sequence of the product of step (30) is target sequence really.
Embodiment 2
This embodiment synthesizes deprotection, and has a target sequence and be
The deoxyribose oligonucleotide of 5 '-TTTGAAGTATGCCTCAAGGTT-3 '.The base sequence part reverse complementary sequence each other of the product of this target sequence and embodiment 1.
The synthesis of the present embodiment divides 19 steps to complete according to following synthesis strategy.
(1) synthesis has dimer HO [AA] OE of formula (2)：
Synthesized according to step (13) the identical method in embodiment 1, except for the difference that, replaced HO [T] OE that the step (6) in embodiment 1 obtains with HO [A] OE that the step (5) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(2) dimer synthon DMTr [GT] PO-：
According to embodiment 1 in step (9) and step (10) identical method synthesized, except for the difference that, DMTr [G] PO that obtained with the step (3) in embodiment 1-Replace DMTr [A] PO that the step (1) in embodiment 1 obtains-, HO [A] OE that the step (5) in embodiment 1 obtains is replaced with HO [T] OE that the step (6) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(3) dimer synthon DMTr [AT] PO-：
According to embodiment 1 in step (9) and step (10) identical method synthesized, except for the difference that, HO [A] OE that the step (5) in embodiment 1 obtains is replaced with HO [T] OE that the step (6) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(4) dimer synthon DMTr [CC] PO-：
According to embodiment 1 in step (9) and step (10) identical method synthesized, except for the difference that, DMTr [C] PO that obtained with the step (4) in embodiment 1-Replace DMTr [A] PO that the step (1) in embodiment 1 obtains-, HO [A] OE that the step (5) in embodiment 1 obtains is replaced with HO [C] OE that the step (8) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(5) dimer synthon DMTr [TC] PO-：
According to embodiment 1 in step (9) and step (10) identical method synthesized, except for the difference that, DMTr [T] PO that obtained with the step (2) in embodiment 1-Replace DMTr [A] PO that the step (1) in embodiment 1 obtains-, HO [A] OE that the step (5) in embodiment 1 obtains is replaced with HO [C] OE that the step (8) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(6) dimer synthon DMTr [AG] PO-：
According to embodiment 1 in step (9) and step (10) identical method synthesized, except for the difference that, HO [A] OE that the step (5) in embodiment 1 obtains is replaced with HO [G] OE that the step (7) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(7) synthesize trimer DMTr [TTT] PO-：
Synthesized according to step (18) the identical method in embodiment 1, except for the difference that, DMTr [T] PO that obtained with the step (6) in embodiment 1-Replace DMTr [C] PO that the step (4) in embodiment 1 obtains-, HO [CT] OE that the step (14) in embodiment 1 obtains is replaced with HO [TT] OE that the step (17) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(8) synthesize trimer HO [GAA] OE：
Synthesized according to step (19) the identical method in embodiment 1, except for the difference that, DMTr [G] PO that obtained with the step (3) in embodiment 1-Replace DMTr [T] PO that the step (2) in embodiment 1 obtains-, HO [GA] OE that the step (15) in embodiment 1 obtains is replaced with HO [AA] OE that the step (1) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(9) synthesize trimer HO [ATG] OE：
Synthesized according to step (19) the identical method in embodiment 1, except for the difference that, DMTr [AT] PO that obtained with the step (3) in embodiment 2-Replace DMTr [T] PO that the step (2) in embodiment 1 obtains-, HO [GA] OE that the step (15) in embodiment 1 obtains is replaced with HO [G] OE that the step (7) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(10) synthesize trimer HO [TCA] OE：
Synthesized according to step (19) the identical method in embodiment 1, except for the difference that, DMTr [TC] PO that obtained with the step (5) in embodiment 2-Replace DMTr [T] PO that the step (2) in embodiment 1 obtains-, HO [GA] OE that the step (15) in embodiment 1 obtains is replaced with HO [A] OE that the step (5) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(11) synthesize trimer HO [GTT] OE：
Synthesized according to step (19) the identical method in embodiment 1, except for the difference that, DMTr [G] PO that obtained with the step (3) in embodiment 1-Replace DMTr [T] PO that the step (2) in embodiment 1 obtains-, HO [GA] OE that the step (15) in embodiment 1 obtains is replaced with HO [TT] OE that the step (17) in embodiment 1 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(12) six aggressiveness DMTr [TTTGAA] PO are synthesized-：
Synthesized according to step (23) the identical method in embodiment 1, except for the difference that, DMTr [TTT] PO that obtained with the step (7) in embodiment 2-Replace DMTr [CCT] PO that the step (18) in embodiment 1 obtains-, HO [TGA] OE that the step (19) in embodiment 1 obtains is replaced with HO [GAA] OE that the step (8) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(13) synthesize pentamer HO [GTATG] OE：
Synthesized according to step (25) the identical method in embodiment 1, except for the difference that, DMTr [GT] PO that obtained with the step (2) in embodiment 2-Replace DMTr [GG] PO that the step (11) in embodiment 1 obtains-, HO [CAT] OE that the step (20) in embodiment 1 obtains is replaced with HO [ATG] OE that the step (9) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(14) synthesize pentamer DMTr [CCTCA] PO-：
Synthesized according to step (23) the identical method in embodiment 1, except for the difference that, DMTr [CC] PO that obtained with the step (4) in embodiment 2-Replace DMTr [CCT] PO that the step (18) in embodiment 1 obtains-, HO [TGA] OE that the step (19) in embodiment 1 obtains is replaced with HO [TCA] OE that the step (10) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(15) synthesize pentamer HO [AGGTT] OE：
Synthesized according to step (25) the identical method in embodiment 1, except for the difference that, DMTr [AG] PO that obtained with the step (6) in embodiment 2-Replace DMTr [GG] PO that the step (11) in embodiment 1 obtains-, HO [CAT] OE that the step (20) in embodiment 1 obtains is replaced with HO [GTT] OE that the step (11) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(16) 11 aggressiveness DMTr [TTTGAAGTATG] PO are synthesized-：
Synthesized according to step (27) the identical method in embodiment 1, except for the difference that, DMTr [TTTGAA] PO that obtained with the step (12) in embodiment 2-Replace DMTr [CCTTGA] PO that the step (23) in embodiment 1 obtains-, HO [GGCAT] OE that the step (25) in embodiment 1 obtains is replaced with HO [GTATG] OE that the step (13) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (3) really.
(17) ten aggressiveness HO [ACTTCAAATT] OE are synthesized
Synthesized according to step (28) the identical method in embodiment 1, except for the difference that, DMTr [CCTCA] PO that obtained with the step (14) in embodiment 2-Replace DMTr [ACTTC] PO that the step (24) in embodiment 1 obtains-, HO [AAATT] OE that the step (26) in embodiment 1 obtains is replaced with HO [AGGTT] OE that the step (15) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (2) really.
(18) 21 aggressiveness DMTr [TTTGAAGTATGCCTCAAGGTT] OE are synthesized：
Synthesized according to step (29) the identical method in embodiment 1, except for the difference that, DMTr [TTTGAAGTATG] PO that obtained with the step (16) in embodiment 2-Replace DMTr [CCTTGAGGCAT] PO that the step (27) in embodiment 1 obtains-, HO [ACTTCAAATT] OE that the step (28) in embodiment 1 obtains is replaced with HO [ACTTCAAATT] OE that the step (17) in embodiment 2 obtains.
Detect this product31PNMR spectrum and M-, product31PNMR spectrum and M-With target compound31PNMR spectrum and M-Theoretical value is consistent completely it was demonstrated that this product has the structure of formula (4) really.
So far, 21 aggressiveness ribonucleic acid DMTr [TTTGAAGTATGCCTCAAGGTT] OE of full guard have been obtained with liquid phase method synthesis.
(19) deprotection
Carry out deprotection according to step (30) the identical method in embodiment 1.Except for the difference that, DMTr [CCTTGAGGCATACTTCAAATT] OE that the step (29) in embodiment 1 obtains is replaced with DMTr [TTTGAAGTATGCCTCAAGGTT] OE that the step (18) in embodiment 2 obtains.
Mass spectral analyses, electrophoresis result and sequencing result all support that the base sequence of the product of step (19) is target sequence really.

Claims (10)

1. the deoxyribose oligonucleotide shown in a kind of formula (1)：
Wherein, R is hydrogen or R1, R1Represent trityl, monomethoxytrityl, two pairs of methoxies Trityl or trimethoxytrityl；N is the integer of 1-100；
B represents that the gland that guanyl-, exocyclic amino group that exocyclic amino group protected by acyl group are protected by acyl group is fast Cytosine base, thymine base or uracil base that purine base, exocyclic amino group are protected by acyl group, and each B in repetitives is identical or different；
R3Represent halogen atom, nitro or methoxyl group.
2. deoxyribose oligonucleotide according to claim 1, wherein, described acyl group is benzene first Acyl group, isobutyryl or acetyl group；Described halogen atom is chlorine or bromine.
3. a kind of method of liquid phase synthesis deoxyribose oligonucleotide is it is characterised in that the method includes In the presence of condensing agent, under the conditions of condensation reaction, make the compound of formula (2) and the chemical combination of formula (3) Thing contacts in the first liquid reaction medium and carries out condensation reaction, obtains the compound of formula (4)；
Wherein, R1Represent trityl, monomethoxytrityl, two pairs of Methoxytrityl or three Methoxytrityl；X is the integer of 0-50；Y is the integer of 1-50；
B1And B2Each represent that protected by acyl group by the guanyl- protected, exocyclic amino group by acyl group for exocyclic amino group Cytosine base, thymine base or uracil that the adenyl of shield, exocyclic amino group are protected by acyl group B in base, and each repetitive1Or B2Identical or different；
R3Definition identical with claim 1；A+Represent trialkylammonium ion or dialkyl ammonium ion.
4. method according to claim 3, wherein, described acyl group is benzoyl, isobutyryl Base or acetyl group；Each alkyl in described trialkylammonium ion or dialkyl ammonium ion is identical or not With, and each there is 1-6 carbon atom.
5. method according to claim 3, wherein, described condensing agent is 1- sym-trimethylbenzene. sulphonyl Triazole, 1- sym-trimethylbenzene. sulphonyl (3- nitro)-triazole, 1- sym-trimethylbenzene. sulphonyl tetrazolium, the equal triisopropyl of 1- Benzene sulfonyl triazole, 1- equal triisopropyl tosyl (3- nitro)-triazole and 1- equal triisopropyl sulphonyl tetrazolium One or more of；Described first liquid reaction medium is pyridine, dichloromethane, acetonitrile, dioxy One or more of six rings and oxolane；
The condition of described condensation reaction includes：The compound of the formula (3) with respect to 1 mole, condensing agent Consumption be 2-20 mole, the consumption of the first liquid reaction medium is 2-50L, is equal to 0 up-to-date style (2) in x The consumption of compound be 1-5 mole, the consumption of compound being more than or equal to 1 up-to-date style (2) in x is 0.3-1.25 mole；Reaction temperature is 0-50 DEG C；Response time is 0.5-100 hour.
6. the method according to any one in claim 3-5, wherein, the method also includes In the second liquid reaction medium, in the presence of trialkylamine or dialkylamine, in the bar of hydrolysis Under part, the compound of formula (4) is contacted the reaction that is hydrolyzed with water, obtain sloughing the water of β-cyanoethyl Product after solution.
7. method according to claim 6, wherein, the condition of described hydrolysis includes：Phase The compound of the formula (4) for 1 mole, the consumption of trialkylamine or dialkylamine is 1-200 mole； The consumption of the second liquid reaction medium is 5-50 liter；The consumption of water is 2-20 liter；Reaction temperature is 0-50℃；Response time is 0.25-2 hour.
8. method according to claim 7, wherein, described second liquid reaction medium is pyridine And/or acetonitrile；Each alkyl in described trialkylamine or dialkylamine is identical or different, and respectively From having 1-6 carbon atom.
9. method according to claim 6, wherein, the method is also included after described hydrolysis Product, as the compound of described formula (3), carries out described contracting again with the compound of described formula (2) Close reaction.
10. the method according to any one in claim 3-5, wherein, the method also includes In the 3rd liquid reaction medium, in the presence of organic acid, under conditions of replacement reaction, by formula (4) Compound R1Group displacement is hydrogen, obtains R1Group is replaced into the product of hydrogen.
CN201610118368.7A 2015-08-17 2016-03-02 A kind of deoxyribose oligonucleotide and preparation method thereof Pending CN106467565A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201510504294 2015-08-17
CN2015105042946 2015-08-17

Publications (1)

Publication Number Publication Date
CN106467565A true CN106467565A (en) 2017-03-01

Family

ID=58229864

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610118368.7A Pending CN106467565A (en) 2015-08-17 2016-03-02 A kind of deoxyribose oligonucleotide and preparation method thereof

Country Status (1)

Country Link
CN (1) CN106467565A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468171A (en) * 2019-09-20 2019-11-19 凯莱英医药集团（天津）股份有限公司 The synthetic method of nucleic acid

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468171A (en) * 2019-09-20 2019-11-19 凯莱英医药集团（天津）股份有限公司 The synthetic method of nucleic acid
CN110468171B (en) * 2019-09-20 2021-10-29 凯莱英医药集团（天津）股份有限公司 Method for synthesizing nucleic acid

Similar Documents

Publication Publication Date Title
CN102344477B (en) Nucleotide and / or oligonucleotide and preparation method thereof
Broka et al. Simplifications in the synthesis of short oligonucleotide blocks
JP3081882B2 (en) Orthogonal removal of hydroxyl protecting groups by reduction and their use in the chemical synthesis of oligonucleotides
AU2018284131B2 (en) Synthesis of substantially diastereomerically pure phosphate protides
WO2005023828A1 (en) Process for producing ribonucleotide or ribonucleotide derivative
EP0241363A1 (en) Nucleoside derivatives and their use in the synthesis of oligonucleotides
EP3778619A1 (en) Segment for oligonucleotide synthesis, production method for same, and oligonucleotide synthesis method using same
JPH11510790A (en) Improved method for oligonucleotide synthesis
EP3684780B1 (en) Floxuridine synthesis
EP0289619A1 (en) Process for synthesizing oligonucleotides and compounds for forming high-molecular protective group
WO1995024413A1 (en) Compositions and methods for use in the synthesis of oligonucleotides
CN100484949C (en) Be used for RNA oligonucleotide synthetic nucleoside phosphoramidites and synthetic method thereof
CA2844769A1 (en) Block synthesis of oligoribonucleotides
FI111265B (en) Process for the preparation of modified oligodeoxyribonucleotides useful as pharmaceuticals and intermediates thereof
WO2001002415A1 (en) C3'-methylene hydrogen phosphonate monomers and related compounds
CN106467565A (en) A kind of deoxyribose oligonucleotide and preparation method thereof
JP7371829B2 (en) Polymerizable compound, compound, and method for producing boranophosphate oligomer
WO2001002419A1 (en) C3'-methylene hydrogen phosphonate oligomers and related compounds
CN102827225B (en) A kind of Nucleotide and/or oligonucleotide and preparation method thereof
AU659078B2 (en) Polynucleotide phosphorodithioates as therapeutic agents for retroviral infections
EP3778616A1 (en) Optically active segment for stereocontrolled oligonucleotide synthesis, production method for same, and stereocontrolled oligonucleotide synthesis method using same
CN114014902A (en) Dimeric nucleotide and synthetic method thereof
JP2003002895A (en) Method for synthesizing nucleic acid
JPS6360993A (en) Formation of phosphoric ester linkage
JPH07165786A (en) Uridines substituted at 5-position, its production and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170301