CN106460071A

CN106460071A - Compositions and methods for enhancing and/or predicting dna amplification

Info

Publication number: CN106460071A
Application number: CN201580033738.0A
Authority: CN
Inventors: 拉斯·彼得斯; 斯蒂芬·A·朱迪斯; 丹尼尔·谢弗; 布雷克·帕克
Original assignee: One Imperial Co
Current assignee: One Imperial Co; Envirologix Inc
Priority date: 2014-04-22
Filing date: 2015-04-22
Publication date: 2017-02-22
Anticipated expiration: 2035-04-22
Also published as: US20230220495A1; JP6596442B2; MX2016013877A; EP3134551B1; US20170044628A1; AU2015249739A1; BR112016024622A2; RU2016145402A; WO2015164494A1; JP2017513495A; US11505836B2; EP3748011A1; AU2015249739B2; RU2016145402A3; AU2021205135A1; EP3134551A4; AU2021205135B2; EP3134551A1; UA123387C2; RU2723079C2

Abstract

The present invention features compositions and methods for amplifying a target oligonucleotide in a sample, including detection of the target oligonucleotide in real time.

Description

Strengthen and/or predict composition and the method for DNA cloning

Cross-Reference to Related Applications

This application claims enjoy on April 22nd, 2014 submit to U.S. Provisional Application No. 61/982,784 priority and Rights and interests, this provisional application is fully incorporated herein by quoting.

Background technology

It although nucleic acid amplification method is common and it is well known that still, is largely attributable to existence and relates to primer and set The difficulty of meter, nucleic acid amplification reaction is still affected by unpredictability and/or undesirable property.The unpredictability of nucleic acid amplification Being largely attributable to lack the sequence-predictability design parameter for primer and probe, these primers and probe realize Target-specific primer carried out qualitative assessment and detect antagonism miss the target connect heterozygosis effect, self/self and self/ Non-self dimerization.In fact, select the changeability of potential primer sequence and the sequence constraints of target nucleic acid sequence applying The outward appearance of empirical and systemic examination primer combination and effect thereof is made to become difficulty.

The design parameter of PCR-based test concentrates on primer and probe melt temperature, GC (guanine and cytimidine) content, Primer length and outside minimizing primer and target nucleic acid the interaction of all nucleic acid (see, e.g. www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html).Especially, do not encourage very much to make With can be with the primer (such as primer-dimer) of self-molecules present interphase interaction, because such primer can undesirably shadow Ring the interaction of primer and target nucleic acid molecules.Further, it is suggested that the optimum length of nucleic acid primer is 18 to 22 nucleotides, this Individual length is thought long enough thus is had enough specific and enough short so that primer can easily and template at an annealing temperature Link.For G/C content, it is recommended that G/C content is 40% to 60%.Mistake, conventional test PRACTICE OF DESIGN supposes on all State the forward that parameter is amplification test and reverse primer and during equal design, also can prove the power of both primer hybridization effects Be similar.These conventional design parameter neither ones are fully and the complicated thermodynamics of two benches oligonucleotide hybridization effect Related, they relate to enthalpy, entropy, solvation, closest to effect and from strand to double stranded heteroduplex phase transition hydrogen bond In conjunction with change.And, even if two stage models of oligonucleotides heterozygosis effect as thermodynamics algorithm basis purposes all By over-simplification and correctly reflect actual conditions.It therefore meets the character of the primer of all proposed standards still can not Prediction.

Determine that the progress of the effect that one group of primer expands to predictability target nucleic acid under conditions of basic isothermal has to subtract The potentiality of few resource consumption, including synthesis (for example designs many with the energy, time and the expense that empirically detect a large amount of primer sets Plant primer and screen the combination of multiple primer in couples).Need new parameter and method to strengthen and more preferably to predict that nucleic acid amplification is anti- The performance answered and productivity.

Content of the invention

As described herein, the invention provides to design the primer that can predictably expand target nucleic acid molecules Modification method and the method carrying out nucleic acid amplification with these primers, including strengthen amplification target nucleic acid molecules and/or minimizing or Reduce and generate hidden product.Further, the invention provides to expand and detect the composition of sample target oligonucleotide And method.In a particular embodiment, the compositions and methods of the invention and isothermal nucleic acid amplification react compatible.

One aspect of the present invention provides the few core of primer of a kind of from 5 ' to the 3 ' separation including the firstth district and the secondth district Thuja acid, described firstth district have self-the complementary series reverse complementary sequence of nickase recognition sequence (from 5 ' to 3 ' include), return Literary composition sequence and described nickase recognition sequence, the length in described secondth district be at least 16 nucleotides and specific binding extremely Complementary region in target nucleic acid molecules (has than relating to the secondth district or any with the interaction of the secondth district to form double-stranded hybrids The Δ G of the low at least 15kcal/mol of Δ G of alternating structure), wherein said secondth district has one or more 2 ' on 3 ' ends The nucleotides modified.

Another aspect provides the primer-dimer of a kind of separation including two kinds of oligonucleotide monomer, institute State two kinds of oligonucleotide monomer from 5 ' to 3 ' and comprise the firstth district and the secondth district, described firstth district have self-complementary series is (from 5 ' To the 3 ' reverse complementary sequences including nickase recognition sequence), palindromic sequence and nickase recognition sequence, described secondth district Length is 16 nucleotides and specific binding complementary region to target nucleic acid molecules (has ratio to form double-stranded hybrids Relate to described secondth district or and the Δ of the low at least 15kcal/mol of Δ G of any alternating structure that interacts of described secondth district G), wherein said secondth district has the one or more 2 ' nucleotides modified at 3 ' ends.

Another aspect provides the oligonucleotide probe of separation for detecting target nucleic acid molecules, including： Oligonucleotides；Fluorescent reporter；The quencher molecule of excitation energy can be absorbed from fluorescent reporter；Wherein fluorescent reporter and cancellation divides Son covalently attaches to the 5 ' ends relative with oligonucleotides and 3 ' ends, and wherein oligonucleotides includes that the firstth district (has substantially complementary Nucleotide sequence in target nucleic acid sequence) and the first upstream, district second district 5 ' end and the first downstream, district the 3rd district 3 ' end (there is the nucleotide sequence being complementary to described secondth district), wherein when oligonucleotides is not associated with to target nucleic acid molecules, few nucleosides Acid can by the secondth district and the heterozygosis effect of the 3rd district are formed stem loop hairpin structure, wherein the target sequence of oligonucleotide probe and The Δ G of the double-stranded hybrids between First ray ratio relates to oligonucleotide probe or any with what oligonucleotide probe interacted The low at least 15kcal/mol of Δ G of alternating structure.

Another aspect of the present invention provides the method for amplification specific product in cutting and extension amplified reaction, the party Method includes：Under substantially isothermy, by target nucleic acid molecules and polymerase, (each is at target core for two or more primers All specifically be connected to complementary series on acid molecule), nickase and detectable polynucleotide probes contact, at least a part of which One primer from 5 ' to 3 ' includes the firstth district and the secondth district, described firstth district have self-(from 5 ' to 3 ' include cutting complementary series The reverse complementary sequence of mouth enzyme recognition sequence, palindromic sequence and described nickase recognition sequence), the length in described secondth district is 16 Individual nucleotides and specific binding complementary region to target nucleic acid molecules (have ratio to form double-stranded hybrids and relate to second The Δ G of the low at least 15kcal/mol of Δ G of district or any alternating structure with the interaction of the secondth district, wherein the secondth district is at 3 ' ends End has the one or more 2 ' nucleotides modified)；And generate the amplicon comprising at least a portion target nucleic acid molecules.

Another aspect provides the method for detection specific product in cutting and extension amplified reaction, the method Including：Under substantially isothermy, by target nucleic acid molecules with polymerase, (each is at target nucleic acid for two or more primers Specifically be connected to complementary series on molecule), nickase and detectable polynucleotide probes contact, at least one of which Primer from 5 ' to 3 ' includes the firstth district and the secondth district, described firstth district include self-(from 5 ' to 3 ' have nickase to complementary series The reverse complementary sequence of recognition sequence), palindromic sequence, described nickase recognition sequence, the length in described secondth district is 16 cores Thuja acid and specific binding complementary region to target nucleic acid molecules with formed double-stranded hybrids (have than relate to the secondth district or With the Δ G of the low at least 15kcal/mol of Δ G of any alternating structure that the secondth district interacts, wherein the secondth district has at 3 ' ends Have one or more 2 ' terminal modified nucleotides)；Comprise the amplicon of at least a portion target nucleic acid molecules with generation；And inspection Surveying the signal specific of oligonucleotide probe and target nucleic acid molecules or its amplicon heterozygosis effect, wherein said signal shows sample There is target nucleic acid molecules or there is its amplicon.

Another aspect of the present invention provides the kit of amplification target sequence in cutting off amplified reaction, this kit Including one or more primer tasteless nucleotides (from 5 ' to 3 ' include the firstth district and the secondth district), described firstth district include self-mutually Complementary series (from 5 ' to 3 ' reverse complementary sequence, palindromic sequence and the described nickase identification sequences including nickase recognition sequence Row), described second section length is 16 nucleotides and specific binding complementary region to target nucleic acid molecules is double to be formed (the Δ G with described secondth district or any alternating structure with described secondth district interaction than relating to is low at least for chain heterozygote The Δ G of 15kcal/mol, wherein said secondth district has the one or more 2 ' nucleotides modified at 3 ' ends)；And this The operation instruction of primer tasteless nucleotide in bright method.

According to invention described herein any aspect, the related fields of the present invention provide selects primer tasteless nucleotide Method, including provide on tangible, permanent computer computer-readable recording medium, is used for performing to select the computer journey of the method for oligonucleotides Sequence instructs.

In the different embodiments of above-mentioned aspect, the 12nd, the 13rd, the 14th, the 15th, the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the length in the firstth district be 22nd, 23 or 24 oligonucleotides.In different embodiments, described firstth district all self-complementary.The different enforcements of above-mentioned aspect In example, the length of the palindromic sequence in described firstth district is the 2nd, 4 or 6 nucleotides.In the different embodiments of above-mentioned aspect, described The length in 2nd district is the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, the 23rd, the 24th, the 25th, the 26th, the 27th, the 28th, 29 or 30 nucleotides.

In the different embodiments of above-mentioned aspect, alternating structure is one or more partially double stranded heterozygotes, one Or the heterozygote of some double-strands self can be formed by the secondth district (such as self-self primer), by described secondth district with The partial sequence (such as heterodimer) in the firstth district formed, by described secondth district and other oligonucleotides in amplified reaction, Primer or probe are formed, or (are for example missed the target miscellaneous with the nucleotide sequence of the partial complementarity outside target sequence district by described secondth district Fit) formed.

In the different embodiments of above-mentioned aspect, the form of oligonucleotides (such as primer tasteless nucleotide, oligonucleotide monomer) It is the homodimer (example by forming the first region sequence heterozygosis effect of two kinds of primer tasteless nucleotide molecules self-complementation Such as primer-dimer).In different embodiments, homodimer has primer tasteless nucleotide or and the few core of primer than relating to The Δ G of the low at least 15kcal/mol of Δ G of any alternating structure that thuja acid interacts, including containing primer tasteless nucleotide Stablize alternating structure.It in the different embodiments of above-mentioned aspect, in 25 DEG C and/or an atmospheric pressure (atm) (101.3kPa) is Nucleic acid determines or calculates free energy (Δ G) (Δ G_25℃).In the different embodiments of above-mentioned aspect, free energy (Δ G) passes through MFold algorithm determines or calculates.

In the different embodiments of above-mentioned aspect, the of oligonucleotides (such as primer tasteless nucleotide, Oligonucleolide primers) 2nd district include one or more 2 ' terminal modified nucleotides, and wherein 2 ' end variants are selected from by 2 '-O-methyl, 2 '-methoxyl group ethoxy Base, 2 '-fluoro, 2 '-hydroxyl, 2 '-alkyl, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4’-(CH₂)₂-O-2 '-bridge, 2 '-LNA and 2 '-O-(N-methyl carbamate) group forming or include base analogue those Structure.In a particular embodiment, the one or more 2 ' nucleotides modified are placed on the 3 ' terminals in the secondth district.In other embodiments In, two or more 2 ' nucleotides modified are adjacent.Further, in other embodiments, adjacent 2 ' modify The quantity of nucleotides is the 2nd, the 3rd, the 4th, 5 or 6.In different embodiments in any aspect described herein, nickase is one or many Individual Nt.BspD6I and Nt.BstNBI.In different embodiments in any aspect described herein, the nickase in the firstth district is known Other sequence is 5 '-GAGTC-3 ' (reverse complementary sequence of nickase recognition sequence is 5 '-GAGTC-3 ').Described herein arbitrarily In different embodiments in aspect, place oligonucleotides (such as primer tasteless nucleotide, oligonucleotide monomer) and there is nickase Recognition sequence is to cut the phosphodiester bond between the firstth district and the secondth district.In the different embodiments of above-mentioned aspect, polymerase is Bacillus or thermophilic fat bacillus DNA polymerase I or active fragment and derivative thereof.In a particular embodiment, polymerase It is one or more Bst DNA polymerase is, Gst DNA polymerase i or Gka DNA polymerase i.

In the different embodiments of any aspect described herein, oligonucleotides (such as primer tasteless nucleotide, oligonucleotides list Body) there is the firstth district comprising following nucleotide sequence：

5’-GACTCN₁N_1’GAGTC-3’；

5’-GACTCN₁N_1’GAGTCN-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’N-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N-3’；

5’-N₅N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N_5’-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTC-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTCN-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’N-3’；With

5’-N₆N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’N_6’-3’,

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTC-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNNN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NNN-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N-3’；

5’-N₆N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N_6’-3’；

5’-N₆N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N_6’N-3’；And

5’-N₇N₆N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N_6’N_7’-3’,

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementation, N₄And N_4’Complementation, N₅And N_5’Complementation, N₆And N_6’ Complementation, and N₇And N_7’Complementary.In a particular embodiment, oligonucleotides (such as primer tasteless nucleotide, oligonucleotide monomer) bag Include 5 ' the end tailers containing the sequence listed in the sequence list submitted to herein.

In the different embodiments of any aspect described herein, the oligonucleotide probe of detection target nucleic acid molecules includes： Oligonucleotides；Fluorescent reporter；And the quencher molecule of excitation energy can be absorbed from fluorescent reporter；Wherein fluorescent reporter and Quencher molecule covalently attaches to the 5 ' ends relative with described oligonucleotides and 3 ' ends, and wherein oligonucleotides includes having nucleic acid sequence Second district 5 ' end of row and substantially complementary the firstth district in target nucleic acid sequence and the first upstream, district and the first downstream, district are simultaneously And have the nucleotide sequence being complementary to the secondth district the 3rd district 3 ' end, wherein when oligonucleotides is not associated with to target nucleic acid molecules When, described oligonucleotides can be by forming stem loop hairpin structure by the secondth district and the 3rd district's heterozygosis.Any aspect described herein Different embodiments in, the Δ G ratio of the double-stranded hybrids between target sequence and the First ray of oligonucleotide probe relates to widow Nucleotide probe or at least low 15kcal/mol of Δ G of any alternating structure with oligonucleotide probe interaction.In difference Aspect, the secondth district of oligonucleotide probe and the length in the 3rd district are 4 to 8 nucleotides.

In the different embodiments of any aspect described herein, provide primer tasteless nucleotide of the present invention and/or few nucleosides The operation instruction of acid probe.In the different embodiments of any aspect described herein, for implement together amplification and detection reaction and Primer in design and/or selection reaction and probe.

By detailed description and claims, other features of the present invention and advantage become obvious.

Definition

The polynucleotides that " amplicon " generates during meaning to expand concerned polynucleotides.In one example, gather Amplicon is generated during synthase chain reaction.

" rate of amplification modifying agent " means to affect the reagent of polymerase spreading rate.

" base replacement " means that the core base polymer that will not interfere significantly with heterozygosis effect between complementary nucleotide chain is put Change.

In the disclosure, " include (comprises) ", " including (comprising) ", " contain (containing) " and " there is (having) " and similar statement has United States patent law and to its described meaning and can refer to " comprise (comprises) " with " comprising (comprising) " and similar statement thereof；" substantially by .... constitute " or similar " substantially Constitute ... " and similar statement has the meaning described by United States patent law and term is open, can allow to be more than The meaning of cited statement (as long as basic or novel feature) exists, and the meaning not changing cited statement can be allowed to deposit The meaning existence more than cited statement can allowed, but getting rid of the embodiment of prior art.

By " complementary " or " complementary " mean by tradition Watson-Crick or Hu Sitan base pairing nucleic acid can with separately One nucleotide sequence forms hydrogen bond.Complementary base pairing not only includes G-C and A-T base pairing, also includes relating to common base The base pairing of (such as inosine).In complementary show nucleic acid molecule as a percentage, the percentage of adjacent residues, described Nucleic acid molecules can be with the second nucleotide sequence (the 5th, the 6th, the 7th, the 8th, 9 or 10 in whole 10 nucleotides in the such as first oligonucleotides Individual nucleotides presents the 50%th, the 60%th, the 70%th, the 80%th, 90% and 100% complementary respectively, the alkali of described first oligonucleotides Base and the second nucleotide sequence pairing with 10 nucleotides) form hydrogen bond (such as Watson-Crick base pairing).In order to really Fixed complementary at least specific percentage as a percentage, calculates and can form hydrogen bond with the second nucleotide sequence in nucleic acid molecules The percentage of the adjacent residues of (such as Watson-Crick base pairing) and be rounded to nearest integer (the such as first few core In whole 23 nucleotides in thuja acid the 12nd, the 13rd, the 14th, the 15th, 16 or 17 nucleotides can present respectively the 52%th, the 57%th, the 61%th, 65%th, 70% and 74% and at least have respectively the 50%th, the 50%th, the 60%th, the 60%th, 70% and 70% complementarity, described The base of one oligonucleotides and the pairing of the second nucleotide sequence).As used herein, " substantially complementary " means the complementation between chain Property, so they can be in heterozygosis under biotic factor.Substantially complementary sequence has the 60%th, the 70%th, the 80%th, the 90%th, 95% or even The complementarity of 100%.In addition, by checking that their nucleotide sequence determines whether two chains can be in heterozygosis under biotic factor Technology be known to art.

As used herein, " double helix " means the double-spiral structure being formed by two single-chain nucleic acids interactions.Double Spiral generally passes through the pairing Hydrogenbond of base, i.e. " base pairing " shape between two mutually opposing parallel single-chain nucleic acids Become.Double-helical base pairing generally presents with Watson-Crick base pairing, such as guanine (G) and born of the same parents in DNA and RNA Pyrimidine (C) formed base pairing, in DNA adenine (A) and thymidine (T) formation base pairing, in RNA adenine (A) and Uracil (U) forms base pairing.The condition forming base pairing includes that physiology or biological correlated condition are (for example intracellular：pH Value：7.2,140mM potassium ion；Extracellular：PH value：7.4,145mM sodium ion).Further, double helix passes through adjacent nucleotide Between accumulation interact be stabilized.As used herein, can be set up or tie up by base pairing or accumulation interaction Hold double helix.Double helix is formed by complementary nucleic acid chains, and they can substantially complementary or complete complementary.Carry out alkali with some bases The single-chain nucleic acid of basigamy pair is considered as having carried out " heterozygosis ".

" detection " means to identify analyte or its quantity occurring, lacking detection to be measured.

" a detectable part " means when being connected to concerned molecule, by detectable molecule rearward via light The composition of spectrum, photochemistry, biochemistry, immunochemistry or chemical means dyeing.For example, useful label includes radioactivity Isotope, magnetic bead, bead, colloidal particle, fluorescent dye, electron-dense reagents, enzyme (for example generally use in ELISA Those), biotin, foxalin or haptens.

" fragment " means a part for nucleic acid molecules.Preferably, this part at least includes with reference to nucleic acid molecules or polypeptide Whole length the 10%th, the 20%th, the 30%th, the 40%th, the 50%th, the 60%th, the 70%th, 80% or 90%.The 10th, the 15th, the 5th, fragment can include 20th, the 30th, the 40th, the 50th, the 60th, the 70th, the 80th, 90 or 100 nucleotides.

" free energy (Δ G) " means under the steady temperature that formula Δ G=Δ H-T Δ S describes and pressure, system and its ring The energy of net exchange between border.Free energy represents and forms how favourable structure has, and wherein has more negative Δ G (for example with kcal/mol Statement) formation structure in the dynamic equilibrium of multiple alternating structures thermodynamically advantageously.Therefore, Δ Δ G can measure shape Become there is tendentious difference between two kinds of structures of different Δ G.On the one hand, Δ Δ G provides measurement shape in dynamic equilibrium The oligonucleotide structure needing is become not form other tendentious numerical value score perhaps without structure.An embodiment In, the first structure is (to have and the first few core in firstth district (5 ' end tailer) of an oligonucleotides and the second oligonucleotides The identical nucleotide sequence of thuja acid) the firstth district (5 ' end tailer) between the double helix heterozygote that formed；And the second structure is Including other alternating structures any of oligonucleotides.

" heterozygosis " means under different stringent conditions, complementary polynucleotide sequence (for example, gene described herein), Or between its part, form duplex molecule.(see, e.g. Wahl, G.M. and S.L.Berger (1987) Enzymology method .152: 399；Kimmel, A.R. (1987) Enzymology method .152:507).Heterozygosis acts through Hydrogenbond and presents, and it can be in complementation Watson-Crick between core base, Hu Sitan or reverse Hu Sitan Hydrogenbond.For example, adenine and thymine is logical Cross the complementary core base forming hydrogen bond and matching.

" nucleic acid hybrid " means the molecule of the substantially double-strand being formed by combining complementary nucleic acid molecule.A reality Executing in example, the molecule of double-strand is part or all of double-strand.

" oligonucleotides of separation " means the nucleic acid (such as DNA) at removing gene, and it is from the nucleic acid molecules of the present invention From both sides Protecting gene in the genome of the derivative natural appearance of organism obtaining.Therefore, this term includes, for example, is incorporated to Carrier, the autonomous chromosomal DNA repairing plasmid or virus, prokaryotic or eukaryotic or only as independent of other sequences Vertical molecule (for example, cDNA or PCR or restriction enzyme nuclease digestion generate chromosome or cDNA fragment) restructuring DNA.In addition, this term includes RNA molecule and recombinant DNA (the heterozygote base of a part of encoding additional polypeptide sequence that DNA transcribes Cause).

Term " separation ", " pure " or " biologically isozygotying " means the constant material of the intensity of variation of component, Such as discovery in its native state, described component is generally with described material." separate " expression to a certain extent from primary source Or environment separates." purify " separation representing more higher than isolation to a certain extent." pure " or " biologically isozygotying " Protein is stripped of other materials fully, and so any impurity is all without the biological property of substantial effect protein or causes Other negative consequences.In other words, if substantially not containing microporous substances, viral material or the training utilizing recombinant DNA technology to generate The precursor of foster base or chemical synthesis or other chemical substances, the nucleic acid of the present invention or peptides are exactly pure.Purity and with Matter generally utilizes technique of analytical chemistry (such as gel electrophoresis or high performance liquid chromatography) to measure.Term " pure " can represent Nucleic acid or protein substantially create the band in gel electrophoresis.For may be trimmed (such as phosphorylation or glycosyl Change) protein for, different modifying may produce and different separate protein, and this can purify respectively.

" melt temperature (Tm) " means the temperature of system in balance, and in described balance, 50% molecular population is in a state And 50% colony is in other state.For the nucleic acid of the present invention, Tm be 50% colony be strand and 50% Temperature for double-strand (such as intramolecular or intermolecular double-strand).

" monitoring reaction " means the process of detection reaction.In one embodiment, monitor reaction process and include detection polymerization Enzyme extension and/or detection amplified reaction complete.

As used herein, inner " acquisition " includes synthesis, buys or use additive method " to obtain (obtaining) reagent " Obtain reagent.

As used herein, term " nucleic acid " means deoxynucleotide, the ribonucleotide of strand or double chain form or repaiies The nucleotides adornd and polymer thereof.This term includes framework residue or the connection containing known nucleic acid analog or modified Nucleic acid, they be synthesis, natural appearance and non-natural occur, they have with reference to the similar associativity of nucleic acid Matter, and they are metabolic in the way of similar with reference to nucleotides.The example of this analog includes, but does not limits For 2 ' terminal modified nucleotides (such as 2 '-O-methyl ribonucleotides, 2 '-F nucleotides).

As used herein, " nucleotides of modification " means to carry out having one to nucleosides, core base, pentose ring or phosphate Kind or the nucleotides of more modification.For example, the nucleotides of modification is got rid of and is included AMP, Guanosine 5'-Monophosphate, monophosphate urine The ribonucleotide of glycosides and monophosphate cytidine and include dAMP, monophosphate deoxyguanosine, monophosphate BrdU Deoxynucleotide with monophosphate deoxycytidine.Variant includes repairing by enzyme (the such as transmethylase) using modified nucleotide Decorations generate, those variants of natural appearance.The nucleotides modified also includes the nucleotides that synthesis or non-natural occur.Nucleotides Middle synthesis or non-natural occur variant include 2 '-O-methyl, 2 '-methoxy ethoxy, 2 '-fluoro, 2 '-hydroxyl, 2 '-alkane Base, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4 '-(CH₂)₂-O-2 '-bridge, 2 '-LNA With 2 '-O-(N-methyl carbamate) or those structures including base analogue.

" nucleotides adduct " means will necessarily covalently or be otherwise affixed to of standard nucleobases Point.

" nickase " means to identify and to be connected to the ad hoc structure of the nucleic acid molecules of double-strand and is once connected to its knowledge Other ad hoc structure, can destroy the phosphodiester bond between adjacent nucleotide on strand, thus cut off the terminal before site The chemical entities of 3 '-hydroxyl is generated on nucleotides.In a preferred embodiment, 3 ' ends can be by lacking the poly-of exonuclease Synthase and extend.Exemplary cut-out reagent includes nickase, RNase, DNA enzymatic and transition metal chelator.

" palindrome " means when 5 ' ends on 5 ' ends on a chain to 3 ' ends or complementary strand to 3 ' ends read, nucleic acid sequence Row are identical.Perfect palindrome refers to have the sequence of adjacent subsequence (for example when a subsequence is from end to 3 ' The sequence that the direction of end is read), it is identical from 5 ' ends to 3 ' the direction reading subsequences held with other.

" polymerase-seizure molecule " mean and stop or substantially reduce on polynucleotide template polymerase advance multinuclear Thuja acid template or a part for primer association.Preferably, this part is incorporated into polynucleotides.In a preferred embodiment, This part stops polymerase to advance in template.

" polymerase extension " means on template polynucleotide, with it, monomer that will enter is combined object and mates Polymerase travel forward.

As used herein, " primer-dimer " means the dimer of two monomeric oligonucleotides primers.The widow of the present invention In nucleotide primer, the mer primers of 5 ' end tailers carries out dimerization.

" specific product " means oligonucleotides heterozygosis to complementary target sequence and mediates the poly-of target sequence extension subsequently Polynucleotide products obtained from synthase.

" substantially isothermy " means single temperature or the narrow temperature not having significant change.An embodiment In, the reaction carrying out under substantially isothermy is only changing at a temperature of 1 DEG C to 5 DEG C (for example with the 1st, the 2nd, the 3rd, 4 or 5 degree of changes) Carry out.In one embodiment, single temperature in the operating parameter using instrument for the reaction is carried out.

" reference " means standard or collating condition.Such as one of ordinary skill in the art it will be apparent that suitable with reference to be for The condition measuring element effect and changing element.

" object " means mammal, including but not limited to, the mankind, non-human animal, such as ox, horse, dog class, sheep Or cat.

" target nucleic acid molecules " means polynucleotides to be analyzed.Such polynucleotides can for target sequence justice or Antisense strand.Term " target nucleic acid molecules " also means the amplicon of original object sequence.

Scope provided herein is interpreted as all numerical value in the range of taking down in short-hand.For example, the scope of 1 to 50 is interpreted as including appointing What numeral, counts combinatorics on words or includes the 1st, the 2nd, the 3rd, the 4th, the 5th, the 6th, the 7th, the 8th, the 9th, the 10th, the 11st, the 12nd, the 13rd, the 14th, the 15th, the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, 22、23、24、25、26、27、28、29、30、31、32、33、34、35、36、37、38、39、40、41、42、43、44、45、46、 47th, the 48th, 49 or 50 the subrange of group.

Unless illustrated especially or from context it is clear that as used herein, term "or" is interpreted as comprising.Unless it is special Do not illustrate or from context it is clear that as used herein, term " (a) ", " one (an) " and " that/these (the) it " is interpreted as odd number or plural number.

Unless illustrated especially or from context it is clear that as used herein, term " about " is interpreted as at affiliated neck Within the normal tolerance in territory, such as within 2 standard mean differences.About can be regarded as state numerical value the 10%th, the 9%th, the 8%th, 7%th, the 6%th, the 5%th, the 4%th, the 3%th, the 2%th, the 1%th, the 0.5%th, the 0.1%th, within 0.05% or 0.01%.Clear unless the context otherwise Clearly, all numerical value provided in this article is about modified by term.

Quote a series of chemical groups in any variable defined herein include definition changeable type be any single group or The combination of cited group.The embodiment of herein cited modification or aspect includes as any single embodiment or and any The embodiment of the combination of other embodiments or its part.

Any composition provided herein or method can be with one or more any other compositions provided herein or sides Method and be used in combination.

Brief description

Fig. 1 describes that represent can the machine of the efficient strand displacement nucleic acid amplification reaction of the target nucleic acid molecules of exponential amplification Reason.It shows that 3 ' ends of target nucleic acid molecules (grey) and correspondence, sequence specific primers (have 3 ' end cog regions (red Look) and " 5 ' end afterbody " district of dimerization (black) can be carried out) interact.The specific amplification for target, 3 ' end cog regions (red) and be complementary in sequence and can specific hybrid to target nucleic acid.The primer of active configuration is by two monomers The stable homodimer (term is referred to as " primer-dimer ") that 5 ' end tailer dimerizations of primer are formed.A spy Determine in embodiment, primer have self-complementary, the sequence of symmetrical upset.Primer-the dimer obtaining has double-strand or big Causing the dimerization district (black) of double-strand, it is 5 ' ends relative to the cog region of strand (red).In other words, primer (can be to mesh Mark nucleic acid molecules annealing) target specific part primer-dimer expose as 3 ' end strands districts.When reaction starts, primer- Target nucleic acid molecules is annealed and starts the duplication of target nucleic acid molecules by the part of dimeric 3 ' end strands.Course of reaction In, mer primers is by polymerase chain displacement behavior, to synthesize complementary strand release from the primer-dimer stretching.In order to increase Specific and/or the efficiency of strong amplified reaction, mer primers be designed as having (1) 5 ' end tailer (containing self-complementary, right Claim or substantially symmetric and can and the sequence of own bases pairing) and (2) 3 ' hold cog regions (in sequence ideally or substantially mutual Mend in and can specific hybrid to target nucleic acid molecules).When the Δ G that primer-dimer is formed is relatively low, primer is to have exhibition Opening the time that the monomer of configuration presents is reduced to minimum.Do not need mer primers, because they can be at non-targeted specific primer As template or primer in extension reaction, thus generate and/or amplification things concealed.Preferably, monomer is to the dimeric transitional period " almost moment " or may be of short duration as dynamics.Kinetic factor (for example form primer-dimeric relatively low Δ G, High primer concentration, high dimer Tm) it is used for supporting to form primer-dimer.

Fig. 2 describes that represent can the mechanism of strand displacement nucleic acid amplification reaction of target nucleic acid of poor efficiency amplification.It shows 3 ' ends of target nucleic acid molecules (grey) and the interaction of corresponding Sequence-Specific primer (red and black).Isothermal Reaction (mer primers of deployed configuration is continuously present in wherein) causes linear non-specifically amplification things concealed.Do not support to be formed Primer-dimeric primer monomer has, for example, minimum or non-self in 5 ' end positions of mer primers (black)-complementary Sequence, this can result in primer-dimer needs higher Δ G.Mutual due to primer-dimer and target nucleic acid molecules Effect drives annealing and extension reaction, so forming primer-dimer can affect synthesis and/or the efficiency of amplification target nucleic acid. In the configuration launching wholly or in part, primer monomer can be as the mould of non-targeted specific primer extension reaction (seeing illustration) Plate or primer, this can cause extra reaction to be lost efficacy.When the deployed configuration of mer primers does not has minimized (for example being set by sequence Meter), monomer to dimer transition slowly because it not by Thermodynamics (for example multiple dimers with there is similar Δ G simultaneously Part dimer configuration with Tm) support.

Fig. 3 describes prevention and forms primer-dimeric primer construction, for example, cause the structure that non-specific byproduct expands The structure (A) of (structure (H) arrives (J)) arrives (C) or structure (D) arrives (K), and they can not carry out target heterozygosis effect.It shows Interaction between primer (red and black) nucleic acid fragment (grey).Structure (A) describes to be had in desired specificities district Have the primer monomer of discontinuous reverse sequence, it can backward " cyclization " with formed extendible 3 ' ends carrying out " self-multiple System ".Structure (A) also have from looped 5 ' petiolareas backward.Structure (B) describes at the desired specificities district of primer tool Have the primer-dimer of discontinuous reverse sequence, it can backward " cyclization " with formed extendible 3 ' ends carrying out " self- Replicate ".Structure (C) describes the primer monomer in " expansion " configuration and the DNA fragmentation (grey) of strand (is cut with archaeal dna polymerase Disconnected extension reaction replaces with the Sequence-Specific breach in the tight random behavior placed and/or template DNA) between puppet Hybrid structure.Structure (D) describes partially double stranded dimeric structure, wherein the pith in desired specificities district be difficult to into Row target heterozygosis effect.Can be replicated by the reverse sequence of primer monomer and form structure (D).Structure (E) describes from structure (A) Generate, the product of transition, pseudo-primer extension/strand displacement.Structure (G) describes and generates from structure (B), transition , the product of pseudo-primer extension/strand displacement.The reaction ripe, pseudo-that structure (H) describes " otch ＆ concave bottom " pattern is produced Thing, causes occurring that continuity circulates and expands strand byproduct.Structure (J) describe " otch ＆ concave bottom " pattern ripe, Pseudo-product, causes occurring that continuity circulates and carries out expanding strand byproduct.Structure (K) describes structure in reaction (D) partially double stranded dimeric continuation.Because the pith in desired specificities district is difficult to carry out target heterozygosis effect, Replicate and/or amplification stops or do not starts target nucleic acid.According to the design of primers of the present invention promote to be formed optimal primer- Dimer, this results in formation and does not needs primer construction and they are minimum to the inhibitory action of desired specificities nucleic acid amplification Change.

Fig. 4 shows the primer construction on preferably (the right) and undesirable (left side).Due to exist self-complementary sequence Row, the optional structure favourable to amplified reaction of the primer of the present invention, including primer-dimer and/or hair clip.It is not limited to reason Opinion, primer dimer is more stable and is formed in the presence of primer is in reaction (when for example reaction starts) with high concentration, when When primer concentration reduces (when for example reaction process starts), form hair clip.

Fig. 5 describes undesirable primer configuration when there is kinetic balance between the configuration of non-optimal primer.When right Should be in about the same (the i.e. Δ G of Δ G forming each structure₁≈ΔG₂≈ΔG₃≈ΔG₄) when, there is not preferred primer configuration Or structure.It when primer is present in such multiple configuration, is configured to promote nucleic acid amplification reaction non-optimal.

Fig. 6 shows that optimal primer is highly preferred (i.e. Δ G₁>>ΔG₂), particularly than next preferred configuration (for example when When interacting in primer and self-molecules present) primer of preferred dimer configuration.This configuration and accompanying drawing 5 form comparison, its There is dynamic equilibrium between middle configuration.Primer may be designed as having the structural stability favourable to nucleic acid amplification reaction and structure, with When reduce or eliminate formation undesirable primer configuration and structure.For there is the primer in 5 ' end afterbody dimerization districts, Preferably 5 ' hold tail sequence and than other structures (Δ G₁≤-30 arrive-62kcal/mol) more stable.For in cut-out reaction Primer, 5 ' end tail sequence substantially self-complementary and symmetry ground reversion.Such primer is likely to be of formation intramolecular The potentiality of interaction (such as hairpin loop).But, as primer-dimer (has and Δ G than hairpin ring structure₂Compare very low Δ G₁) more stable indicated, when symmetry reverse sequence complete complementary, such configuration is reduced to minimum.Therefore, when It when the concentration of primer is sufficiently high, is not effectively formed hair clip.

Fig. 7 describes the stable primer-dimeric structure sequence in primer useful in cutting off amplified reaction.Fig. 7 retouches State and there is the same of the 5 ' primer dimers holding tailers (having the nickase recognition sequence on top chain nickase (Nt.BstNBI)) Source dimer.Cut off site and be designed as being placed on the nucleotides of 3 ' ends on 5 ' end tailers and 5 ' ends of 3 ' end cog regions Between nucleotides.Being not limited to theory, when 3 ' end cog regions are strands, nickase is not cutting off site cutting.But, when 3 ' When end cog region is double-strand (when for example, during nucleic acid amplification reaction, primer is incorporated into double stranded target nucleic acid molecule), cutting off There is cutting in site.

Fig. 8 A-8C describes the sequence of exemplary 5 ' end tailers.Fig. 8 A describes the 5 ' ends that length is 24 nucleotides Tailer, it has Nt.BstNBI recognition sequence and based on following formula：5’-NNNNGACTCNNNNNNGAGTCNNNN- 3’.According to this formula, having 537,824 5 ' end tailers, they have following character：Δ G=-34.2kcal/mole to- 65kcal/mole；ΔΔG<-40kcal/mole；And G/C content is 68% to 84%.Certainly, 1050 selections are provided Sequence, represents the 0.2% of full sequence space (248,832).Fig. 8 B describes exemplary 5 ' that length is 22 nucleotides End tailer sequence, it has Nt.BstNBI recognition sequence and based on following formula：5’- NNNNGACTCNNNNGAGTCNNNN-3’.According to this formula, having 248,832 5 ' end tail sequence, they have following property Matter：Δ G=-47kcal/mole to-55kcal/mole；ΔΔG<-40kcal/mole；And G/C content is 72% to 82%. Certainly, provide 200 sequences selecting, represent the 0.08% of full sequence space (248,832).Fig. 8 C describes to be had Exemplary 5 ' the end tailer sequences in 6 nucleotide spacer districts.

Fig. 9 is to show that utilizing primer of the present invention to carry out primer specificity nucleic acid amplification (has such as DNA cloning Dual channel detection Detected 5 ' end afterbodys and 3 ' end cog regions) chart.Desired specificities product is examined by molecular beacon probe (top panel) Survey.Non-specific nucleic acid amplification utilizes SYBRGreen to detect.As shown in two charts, started when about 6 minutes to refer to Number amplification, this shows to expand is desired specificities.The control reaction without input does not produce substantial things concealed.

Figure 10 be show to utilize the present invention primer (have 5 ' end afterbodys and 3 ' end cog regions) nucleic acid amplification have right The quick chart detecting target nucleic acid useful feature.Such reaction is characterised by high s/n ratio ([RFU_MAX-RFU_BL])、 Slope ([RFU_MAX-RFU_BL]/[T_OSEA-T_RFUmax] high numerical value), relatively early start index amplification stage (T_OSEA<10min) and Relatively low signal difference between the replicated test reaction of same sample.

Figure 11 is the chart of the test primer coming into force and losing efficacy described according to their relative stabilities.Observe have 3 ' The primer of end recognition sequence (Δ Δ G≤about-16kcal/mole) comes into force in cutting off amplified reaction, primer (Δ Δ G simultaneously> About-16kcal/mole) it is easy to lose efficacy.Observe that there are 3 ' ends cog region (Δ Δ G≤about-16kcal/mole) and 5 ' ends The primer of afterbody (Δ Δ G≤about-30kcal/mole) comes into force.

Figure 12 describes the isothermal DNA amplification test of the soybean agglutinin to the optimal primer construction from a pair prediction, With Individual forecast and the design of the optimal probe of primer a large amount of to be selected combination do not known without screenability.

Figure 13 depicts the chart of the first tentative trial result of the isothermal DNA amplification test of soybean agglutinin, it Empirically confirm the prediction to experimental performance.In the reaction comprise Soybean genomic DNA, observe that desired specificities expands Increase.Amplification is not observed in the reaction not having target to compare.

Figure 14 describes the isothermal of the pathogenic salmonella invA gene to the optimal primer construction from a pair prediction DNA cloning test and Individual forecast and the design of the optimal probe of primer a large amount of to be selected combination do not known without screenability.

The first tentative trial that Figure 15 depicts the isothermal DNA amplification test of pathogenic salmonella invA gene is tied The chart of fruit, it empirically confirms the prediction to experimental performance.Mesh is observed in the reaction comprise Soybean genomic DNA Mark specific amplification.Do not observe amplification in the reaction of driftlessness comparison.

Figure 16 includes showing, because salmonella invA gene optimizes easily, two charts that isothermal DNA amplification is tested.

Figure 17 A to 17I shows primer construction parameter (Tm, %GC, bp length, Δ G_25℃,ΔΔG_25℃) cluster analysis.Figure 17A is to describe to come into force to test the first guiding region (5 '-afterbody) self-self dimeric Δ Δ of primer and failure test primer The chart of Δ Δ G (kcal/mol) to the second guiding region/target hybrid duplexes for the G (kcal/mol).Come into force test primer and The cluster of failure test primer shows the contact with function/non-functional.Figure 17 B is to describe come into force test primer and failure test The figure of the %GC content to the second primer target-complementary district for the length that the base in the second primer target-complementary district of primer represents Table.Come into force test primer and failure test primer demonstrate random distribution.Figure 17 C is to describe come into force test primer and failure test The Δ G to the second guiding region/target hybrid duplexes for the length that the base in the second primer target-complementary district of primer represents (kcal/mol) chart.Come into force test primer and failure test primer demonstrate random distribution.Figure 17 D is to describe to come into force test The Tm (DEG C) of the second guiding region of primer and failure test primer/target hybrid duplexes is double to the second guiding region/target heterozygosis The chart of spiral.Come into force test primer and failure test primer show itself and function/non-functional it doesn't matter.Figure 17 E is to describe The Δ G (kcal/mol) of the most preferably second guiding region/hybrid duplexes that misses the target of test primer and failure test primer of coming into force is right The chart of guiding region/target hybrid duplexes Δ G (kcal/mol).Come into force test primer and failure test primer demonstrate at random Distribution.Figure 17 F is that the %GC content of the second guiding region depicting come into force test primer and failure test primer is to the second primer The chart of the Tm (DEG C) of district/target hybrid duplexes.Come into force test primer and failure test primer demonstrate random distribution.Figure 17G is that describe the to come into force %GC content of the second guiding region of test primer and failure test primer is miscellaneous to the second guiding region/target Close the chart of double-helical Δ G (kcal/mol).Come into force test primer and failure test primer demonstrate random distribution.Figure 17 H It is that describe the to come into force %GC content of the second guiding region of test primer and failure test primer is double to the second guiding region/target heterozygosis The chart of the Tm (DEG C) of spiral.Come into force test primer and failure test primer demonstrate random distribution.Figure 17 I is to describe to come into force examination The length that the base of the primer (3 ' end cog region) testing primer and failure test primer represents is to primer-target hybrid duplexes The chart of Tm (DEG C).Come into force test primer and failure test primer demonstrate random distribution.

Detailed description of the invention

The present invention relates to the beneficial method of measurable design to primer and utilize such primer anti-at nucleic acid amplification The method that target nucleic acid molecules in Ying expands.Said composition and method (include cutting off amplification anti-to nucleic acid amplification reaction Should) in target nucleic acid molecules amplification and detection also beneficial.

The present invention is at least partially based on some discoveries of the oligonucleotides relating to using in nucleic acid amplification reaction, including primer With probe and their strengthen or realize the effect of nucleic acid amplification reaction.One of these discoveries that what applicant first understood that is or Multiple combinations can be applicable to designing nucleic acid amplified reaction and/or the primer using and probe are tested in detection.

The present invention is based, at least in part, on oligonucleotides in particular configuration (such as primer and probe) and has enhancing nucleic acid expansion Increase reactivity worth potentiality and can by check specific oligonucleotide-target sequence heterozygote of needing with difference non-specific The intermolecular complex of property intramolecular (partially double stranded monomer) and oligonucleotides (primer-primer and primer-probe dimer, Miss the target heterozygote) between the discovery of ability (oligonucleotides selection preferred configuration) of Gibbs free (Δ G) difference.It is so far Only, primer and probe are designed using the difference of free energy between desired specificities and non-specific primer and probe structure as ranking Instrument is to differentiate the optimal primer to target sequence amplification test.Apply above-mentioned design of primers consider need to design measurable The primer of property function (reducing or eliminating the needs of empirical test).Therefore, the invention provides selection primer sequence, draw Thing modifies and/or the method for probe design (promoting nucleic acid amplification and the detection reaction of operability).

It is found by the applicant that (form stable (the such as G of primer-target containing 3 ' terminal sequences_25℃≤ about-20kcal/mol or more Many)) primer have enhancing nucleic acid amplification reaction performance.In a particular embodiment, 3 ' end target recognition sequences include 12 to 24, 12 to 17 or 12 to 14 bases.In a particular embodiment, form primer-target than formed self dimer (such as Δ Δ G≤ About-15 ,-16 ,-17 ,-18 ,-19 ,-20kcal/mol) more stable.In practice it has been found that come into force and do not come into force examination Difference between testing is at Δ Δ G<Occur during about-15kcal/mol (see, e.g. accompanying drawing 11).

In addition, it is found by the applicant that the primer with 5 ' ends tailer (can carry out self dimerization) can strengthen nucleic acid amplification Reactivity worth.Being not limited to theory, in nucleic acid amplification reaction, the annealing of primer just target nucleic acid becomes primer-dimer (ginseng See, for example accompanying drawing 1).Wondrous and it was unexpected that this primer-dimer configuration disturbs polymerization with not having detectability Enzymatic activity and minimizing or prevention primer 5 ' hold part and self or other nucleic acid molecules to carry out nonspecific interaction.5’ End tailer includes perfect palindromic sequence, and it can be formed by mer primers dimerization.For example, primer have be positioned at 5 ' end The cut-out agent recognition site (related with the primer binding specificity of target recognition sequence) of end.From non-specific primer phase interaction By the potentiality obtaining non-specific concealed product and having isolation reactive component (being originally used in the amplification of specific products).In difference In embodiment, forming homodimer is stable (such as G_25℃≤ about-30 ,-35 ,-40 ,-45 ,-50 ,-55 ,-60kcal/ Mol or more).In various embodiments, homodimer has than the extension higher melt temperature of reaction temperature.Specific In embodiment, 5 ' end tailers have the structure of the palindrome.In a further embodiment, the length of 5 ' end tailers is at least 20 Individual base (for example the 20th, the 21st, the 22nd, the 23rd, 24 bases).In a further embodiment, the G/C content of 5 ' end tailers is 80% to arrive 90%.In a particular embodiment, form homodimer ratio and form other poor stabilities primer dimer configuration (Δ Δ of some G≤about-15 ,-20 ,-25 ,-30 ,-35 ,-40kcal/mol or more) more stable.

Further, it is found by the applicant that include on 3 ' ends of 3 ' end cog regions 2 ' terminal modified (such as 2 '-O-methyl, 2 '-fluorine, 2 '-alkyl) the primer of nucleotides can reduce or eliminate non-specific concealed product.This adds increased nucleic acid amplification anti- The situation generating specific products in should and not generating concealed product.In different embodiments, 3 ' end cog regions is one or more Nucleotides includes shaking the core base of the modification of base mismatch pair.In a particular embodiment, when position 1 is positioned at 3 ' terminals During nucleotides, the core base modified is positioned on two or more continuous nucleotides (from 3 ' terminals, in position the 1st, the 2nd, the 3rd, the 4th, 5 or 6 Start).In a particular embodiment, it is no less than 8 and the nucleotides of not more than 10 unmodifieds is positioned over 3 ' end cog regions Between one 5 ' terminal nucleotide and nearest 3 ' terminal modified nucleotides.

In a particular embodiment, primer includes 3 ' end cog regions and 5 ' end afterbody dimerization districts.At reaction conditions, single Body primer carries out dimerization to form primer-dimer by combining their 5 ' end afterbody dimerization districts.It is not limited to theory, Target nucleic acid molecules is annealed and synthesizes complementary target chain by primer-dimeric strand 3 ' end cog region.By synthesis complementation Chain carries out polymerase chain displacement, and mer primers discharges from extended chain.The mer primers of release is by combining with 5 ' end tailers Carry out dimerization with another Free Monomer.Multiple circulations achieve index targets nucleic acid amplification.

Design of primers

The conventional method of design of primers concentrates on primer melt temperature, primer annealing temperature, GC (guanine and cytimidine) Content, primer length and beyond minimizing primer and target nucleic acid all nucleic acid (see, e.g. Www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html) interaction.With these sides Method is contrary, it has been found that is formed and stablize primer/dimer and with term formation free energy (Δ G) primer stated at nucleic acid amplification Reaction plays a role to predictability.Although free energy (Δ G) and melt temperature (Tm) have identical main component enthalpy (Δ H) With entropy (Δ S), but obtained different Δ G and Tm numerical value and they do not have correlative connection, Δ G will be given and associate with providing Tm Unique method be from place (Man Di, " mFold, the Delta G, and melt temperature " obtaining themIntegrate with 2011 DNA technique) it is expressly understood that Δ H and the numerical value of Δ S.Fig. 1 to 11 relates to the design of optimal primer.

The formula of available art calculates the formation free energy (Δ G) of intermolecular primer construction.Substantial amounts of program can Be used for determining and define in different molecular and intermolecular primer construction and calculate their Δ G, including, such as mfold and UNAfold prediction algorithm (see, e.g., Markham and Zucker.UNAFold：Nucleic acid folds and heterozygosis effect software. and biological Informatics：Volume 2, the 1st chapter, page 3 to 31, Humana publishing house., 2008；Zucker etc..The algorithm of RNA secondary structure prediction And thermodynamics：RNA biochemistry and the application manual of biotechnology, 11 to 43, NATO ASI series, Kluwer academic publishing Society, 1999；M, Zucker. utilize energy minimization prediction RNA secondary structure.《Molecular biology method》, 267 to 294, 1994；Jaeger etc..The prediction optimal and sub-optimal secondary structure of RNA.Molecular evolution：The computer of protein and nucleotide sequence divides Analysis,《Enzymology method》183,281 to 306,1990；Zucker.Fold with regard to all sub-optimal RNA molecule of discovery.Science 244, 48 to 52,1989).Oligonucleotide analysis device 3.1 utilizes mfold that a design of primers (www.idtdna.com/ is implemented analyzer/Applications/OligoAnalyzer/).For example, with regard to oligonucleotide analysis device 3.1, may utilize following ginseng Number calculates Δ G：Target type：DNA；Oligonucleotides concentration 0.25 μM；Na⁺Concentration：60mM；Mg⁺⁺Concentration：15mM；And dNTPs Concentration:0.3mM.

3 ' end cog regions

The invention provides have 3 ' end recognition sequences (its formed primer-target be stable and there is enhancing nucleic acid The potentiality of amplified reaction performance) primer.3 ' end cog regions are specific and target nucleic acid combines, the complementary sequence of such as target nucleic acid Row.In a particular embodiment, 3 ' end cog regions have and are complementary to target nucleic acid sequence the 12nd, the 13rd, the 14th, the 15th, the 16th, the 17th, the 18th, 19 or 20 Or the sequence of more base.In different embodiments, primer-target melt temperature is equal to or higher than 8 DEG C or than reaction or examination The extended temperature (Tm >=test temperature-8 DEG C) tested is low 6 DEG C.In a particular embodiment, 3 ' end recognition sequences include 12 to 20,12 To 17 or 12 to 14 nucleotides.In a particular embodiment, primer-target formed than the formation of self dimer (such as Δ Δ G≤ About-15 ,-16 ,-17 ,-18 ,-19 ,-20kcal/mol or more) more stable.In practice it has been found that come into force and not The difference coming into force between test is present in Δ Δ G<(accompanying drawing 11 is see, e.g.) when about-15kcal/mol.Preferably, 3 ' End recognition sequence do not include self-complementary series, short inverted repeats is (for example,>4 base/repetitive sequences), or originally Can promote the sequence of intramolecular interaction, it has the potentiality of interference primer target annealing.

Specifically, the present invention have 3 ' end recognition sequences primer to cut off amplification test beneficial.In addition, desired specificities 3 ' end cog regions include one or more 2 ' terminal modified nucleotides (such as 2 '-O-methyl, 2 '-methoxy ethoxy, 2 '-fluorine Generation, 2 '-hydroxyl, 2 '-alkyl, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4 '- (CH₂)₂-O-2 '-bridge, 2 '-LNA and 2 '-O-(N-methyl carbamate)).It is not limited to theory, it is assumed that one or more 2 ' ends are repaiied The nucleotides of decorations is incorporated to recognition sequence and can reduce or eliminate the intermolecular of primer and/or intermolecular interaction (such as primer-two Aggressiveness is formed) and thus reduce or eliminate hidden signal in isothermal duplication.2 ' terminal modified nucleotides preferably have and The base of target sequence base pairing.In a particular embodiment, two or more of desired specificities cog region are 2 ' terminal modified Nucleotides (for example the 2nd, the 3rd, the 4th, 5 or more 2 ' terminal modified nucleotides) is continuous print.In certain embodiments, special in target On 3 ' ends of property cog region, 2 ' terminal modified nucleotides are blockaded.In other embodiments, in desired specificities identification On the 5 ' ends in district, 2 ' terminal modified nucleotides are blockaded.Repair when holding to 2 ' on the 5 ' ends at desired specificities cog region The nucleotides of decorations is blockaded, and the nucleotides of an available meeting or more unmodified (for example the 2nd, the 3rd, the 4th, repair by 5 or more 2 ' ends The nucleotides of decorations) from 2 ' the terminal modified nucleotides cutting off separation site.Repair it is found by the applicant that position one or more 2 ' ends The nucleotides of decorations or carry out blockading to 2 ' terminal modified nucleotides and change the dynamics of amplification.When one or more 2 ' terminal modified Nucleotides or 2 ' terminal modified nucleotides are carried out blockade and be positioned or close to 5 ' ends of cog region or neighbouring cut off position During point, the time of real-time amplification reaction and display detection increases.In addition, signal curve shortens and the slope of curve changes.

In a related embodiment, the ratio of the primer with one or more 2 ' terminal modified nucleotides can be used to change inspection Survey time and/or the efficiency of tuning reaction, it is achieved that the predictability control to kinetics.Increase and identifying 3 ' hunting End has the primer of one or more 2 ' terminal modified nucleotides and is identifying that the 5 ' ends hunted have one or more 2 ' The ratio of the primer of terminal modified nucleotides shortens signal curve and changes the slope of curve.Tuning reaction (control can be provided Detection time processed and the means of reaction efficiency) it is favourable.Tuning reaction can be used to coupling target core in quantitative PCR (qPCR) Acid amplification and the efficiency with reference to nucleic acid amplification.In addition, the amplification curve of target nucleic acid and internal standard can change, so their amplification The detection time of product is separable opens, simultaneously for target nucleic acid amplification and the identical efficiency of internal standard amplification offer.By using spy The ratio of the oligonucleotide structure in fixed combination and reaction, can create and can realize that the condition that can tune reactivity worth is possible to 's.

5 ' end afterbody dimerization districts

The invention provides the primer with 5 ' end tailers (self dimerization of energy), it can strengthen nucleic acid amplification reaction Performance.Being not only restricted to theory, in nucleic acid amplification reaction, target nucleic acid annealing is become primer-dimer and (sees, example by primer Such as accompanying drawing 1).For example, cut off amplimer, at 5 ' ends, there is cut-out agent recognition site, its primer with target recognition sequence Specific binding unrelated.From the non-specific concealed product that non-specific primer interacts, there is isolation reacted constituent (former Originally be used as specific products amplification) potentiality.In different embodiments, formed homodimer stable (such as Δ G≤about- 30th ,-35 ,-40 ,-45 ,-50 ,-55 ,-60kcal/mol or more).In different embodiments, homodimer has than extension The higher melt temperature of reaction temperature.In a particular embodiment, there is the sequence of the palindrome.In a further embodiment, 5 ' end tail The length in district of portion is at least 12 bases (for example 12, the 13rd, the 14th, the 15th, the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, the 23rd, 24 bases).? In further embodiment, the G/C content of 5 ' end tailers is 80% to 90%.In a particular embodiment, homodimer forms ratio Other poor stabilities primer dimer configuration of some formed more stable (such as Δ Δ G≤about-12 ,-13 ,-14 ,-15 ,- 16th ,-17 ,-18 ,-19 ,-20 ,-25 ,-30 ,-35 ,-40kcal/mol or more).

Specifically, the present invention have 5 ' end tail sequence primer to cut off amplified reaction beneficial.In order to cut off amplification Using in reaction, 5 ' end tailers include that one or more cut-out agent recognition site and 5 ' end tailers have symmetrical upset Sequence.In certain embodiments, cut off site and be designed as the nucleotides on 3 ' ends of 5 ' end tailers and 3 ' end cog regions 5 ' ends on nucleotides between.Being not only restricted to theory, when 3 ' end identifications are strands, nickase does not enter in cut-out site Row cutting.But, when 3 ' end cog regions are strands, (for example during nucleic acid amplification reaction, primer is incorporated to double stranded target nucleic acid During molecule), cut off site and cutting occurs.

In different embodiments, 5 ' end tail sequence include reverse nickase recognition sequence from 5 ' ends to 3 ' ends, and it is operable It is connected to property palindromic sequence (or self-complementary series), it is possible to be operationally coupled to nickase recognition sequence.At particular implementation In example, spacer region has even number nucleotides (for example the 2nd, the 4th, 6 etc.).

Based on Nt.BstNBI nickase recognition sequence (5 '-GAGTC-3 ') and the example with 2 nucleotide spacer districts Property 5 ' end afterbodys include the nucleotide sequence according to following formula：

5’-GACTCN₁N_1’ GAGTC-3’

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementary.

The exemplary sequence of such 2 base intervals tail sequence includes, for example, according to the nucleotide sequence of following formula：

5’-GACTCN₁N_1’ GAGTC-3’；

5’-GACTCN₁N_1’ GAGTCN-3’；

5’-N₂ GACTCN₁N_1’ GAGTCN_2’-3’；

5’-N₂ GACTCN₁N_1’ GAGTCN_2’N-3’；

5’-N₃N₂ GACTCN₁N_1’ GAGTCN_2’N_3’-3’；

5’-N₃N₂ GACTCN₁N_1’ GAGTCN_2’N_3’N-3’；

5’-N₄N₃N₂ GACTCN₁N_1’ GAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂ GACTCN₁N_1’ GAGTCN_2’N_3’N_4’N-3’；and

5’-N₅N₄N₃N₂ GACTCN₁N_1’ GAGTCN_2’N_3’N_4’N_5’-3’,

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementation, N₄And N_4’Complementation, N₅And N_5’Complementary etc..

In certain embodiments, 2 base intervals afterbodys get rid of those cores including the nucleotide sequence according to following formula Acid sequence：

5’-TCGACTCN₁N_1’ GAGTCGA-3’；

5’-TCGACTCN₁N_1’ GAGTCGAN-3’；

5’-N₂TCGACTCN₁N_1’ GAGTCGAN_2’-3’；

5’-N₂TCGACTCN₁N_1’ GAGTCGAN_2’N-3’；

5’-GTCGACTCN₁N_1’ GAGTCGAC-3’；

5’-GTCGACTCN₁N_1’ GAGTCGACN-3’；

5’-N₃N₂TCGACTCN₁N_1’ GAGTCGAN_2’N_3’-3’；

5’-N₃GTCGACTCN₁N_1’ GAGTCGACN_3’-3’；and

5’-AGTCGACTCN₁N_1’ GAGTCGACT-3’,

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementary etc..

Based on Nt.BstNBI nickase recognition sequence (5 '-GAGTC-3 ') and the example with 4 nucleotide spacer districts Property 5 ' end afterbodys include the nucleotide sequence according to following formula：

5’-GACTCN₂N₁N_1’N_2’ GAGTC-3’

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementary.

The exemplary sequence of such 4 base intervals tail sequence includes, for example, according to the nucleotide sequence of following formula：

5’-GACTCN₂N₁N_1’N_2’ GAGTC-3’；

5’-GACTCN₂N₁N_1’N_2’ GAGTCN-3’；

5’-N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’-3’；

5’-N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N-3’；

5’-N₄N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N_4’-3’；

5’-N₄N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N_4’N-3’；

5’-N₅N₄N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N_4’N_5’-3’；

5’-N₅N₄N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N_4’N_5’N-3’；With

5’-N₆N₅N₄N₃ GACTCN₂N₁N_1’N_2’ GAGTCN_3’N_4’N_5’N_6’-3’,

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementation, N₄And N_4’Complementation, N₅And N_5’Complementation and N₆And N_6’ Etc..

In certain embodiments, 4 base intervals afterbodys get rid of those cores including the nucleotide sequence according to following formula Acid sequence：

5’-GACTCGATCGAGTC-3’；

5’-GACTCGATCGAGTCN-3’；

5’-N₁ GACTCGATCGAGTCN_1’-3’；

5’-N₁ GACTCGATCGAGTCN_1’N-3’；

5’-N₂N₁ GACTCGATCGAGTCN_1’N_2’-3’；

5’-N₂N₁ GACTCGATCGAGTCN_1’N_2’N-3’；

5’-TCGACTCN₂N₁N_1’N_2’ GAGTCGA-3’；

5’-TCGACTCN₂N₁N_1’N_2’ GAGTCGAN-3’；

5’-N₃N₂N₁ GACTCGATCGAGTCN_1’N_2’N_3’-3’；

5’-N₃N₂N₁ GACTCGATCGAGTCN_1’N_2’N_3’N-3’；

5’-N₃TCGACTCN₂N₁N_1’N_2’ GAGTCGAN_3’-3’；

5’-N₃TCGACTCN₂N₁N_1’N_2’ GAGTCGAN_3’N-3’；

5’-GTCGACTCN₂N₁N_1’N_2’ GAGTCGAC-3’；

5’-GTCGACTCN₂N₁N_1’N_2’ GAGTCGACN-3’；

5’-N₄N₃N₂N₁ GACTCGATCGAGTCN_1’N_2’N_3’N_4’-3’；

5’-N₄N₃TCGACTCN₂N₁N_1’N_2’ GAGTCGAN_3’N_4’-3’；

5’-N₃GTCGACTCN₂N₁N_1’N_2’ GAGTCGACN_3’-3’；With

5’-AGTCGACTCN₂N₁N_1’N_2’ GAGTCGACT-3’,

Based on Nt.BstNBI nickase recognition sequence (5 '-GAGTC-3 ') and the example with 6 nucleotide spacer districts Property 5 ' end afterbodys include the nucleotide sequence according to following formula：

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTC-3’

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementary.

The exemplary sequence of 6 base spacer tail sequence includes, for example, according to the nucleotide sequence of following formula：

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTC-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCNNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCNNNN-3’；

5’-N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’-3’；

5’-N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N-3’；

5’-N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’NN-3’；

5’-N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’NNN-3’；

5’-N₅N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N_5’-3’；

5’-N₅N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N_5’N-3’；

5’-N₆N₅N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N_5’N_6’-3’；

5’-N₆N₅N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N_5’N_6’N-3’；With

5’-N₇N₆N₅N₄ GACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCN_4’N_5’N_6’N_7’-3’,

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementation, N₄And N_4’Complementation, N₅And N_5’Complementation, N₆And N_6’ Complementation, and N₇And N_7’Complementary.

In certain embodiments, 6 base spacer afterbodys get rid of those with nucleotide sequence according to following formula Nucleotide sequence：

5’-GACTCGAN₁N_1’TCGAGTC-3’；

5’-GACTCGAN₁N_1’TCGAGTCN-3’；

5’-N₂ GACTCGAN₁N_1’TCGAGTCN_2’-3’；

5’-N₂ GACTCGAN₁N_1’TCGAGTCN_2’N-3’；

5’-N₃N₂ GACTCGAN₁N_1’TCGAGTCN_2’N_3’-3’；

5’-N₃N₂ GACTCGAN₁N_1’TCGAGTCN_2’N_3’N-3’；

5’-TCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGA-3’；

5’-TCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGAN-3’；

5’-N₄N₃N₂ GACTCGAN₁N_1’TCGAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂ GACTCGAN₁N_1’TCGAGTCN_2’N_3’N_4’N-3’；

5’-N₄GTCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGACN_4’-3’；

5’-GTCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGAC-3’；

5’-GTCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGACN-3’；

5’-N₅N₄N₃N₂ GACTCGAN₁N_1’TCGAGTCN_2’N_3’N_4’N_5’-3’；

5’-N₅N₄TCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGAN_4’N_5’-3’；

5’-N₄GTCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGACN_4’-3’；With

5’-AGTCGACTCN₃N₂N₁N_1’N_2’N_3’ GAGTCGACT-3’,

Accompanying drawing 8E to 8E provides exemplary 5 ' end tailer sequences.Length is 24 nucleotides and has Exemplary 5 ' end tailer sequences of Nt.BstNBI recognition sequence can according to following template 5 '- NNNNGACTCNNNNNNGAGTCNNNN-3 ' (accompanying drawing 8A) and generate.Based on this template, exist and there is the 537 of following character, 824 5 ' end tail sequence：Δ G=-48kcal/mole to-62kcal/mole；ΔΔG<-40kcal/mole；And GC contains Amount is 68% to 84%.Certainly, provide 1050 sequences selecting, represent full sequence space (248,832) 0.2%.Length is 22 nucleotides and has exemplary 5 ' the end tailer sequences of Nt.BstNBI recognition sequence based on following mould Plate 5 '-NNNNGACTCNNNNGAGTCNNNN-3 ' (accompanying drawing 8B).Based on this template, exist and there is the 248,832 of following character Individual 5 ' tail sequence：Δ G=-47kcal/mole to-55kcal/mole；ΔΔG<-40kcal/mole；And G/C content is 72% to 82%.Certainly, provide 200 sequences selecting, represent the 0.08% of full sequence space (248,832).

Nucleic acid amplification method

Nucleic acid amplification technologies provides the means of intelligible complex biological technique, detection and discriminating and causes a disease and non-cause Diease occurrence object, legal medical expert commit a crime the means of analysis, disease correlation studies, genetic modification organism detection item etc..Polymerase chain is anti- Should (PCR) be the nucleic acid amplification technologies commonly depending on thermal cycle, it be used for utilizing archaeal dna polymerase DNA amplification, and it includes weight It is added with hot and cold and but react the circulation of (melt for DNA and DNA enzymatic replicates and carries out).Real-time quantitative PCR (qPCR) is in biology examination Sample is used for quantifying to be given the technology of the duplicate quantity of nucleotide sequence.Currently, qPCR monitoring reaction when the reaction real whole story is produced Product and expand amplification situation and check experiment compare, and it includes nucleic acid that is known and that quantify when each reaction starts (or known relative scale of nucleic acid and unknown test nucleic acid).The result of comparison is used for building calibration curve, and this is typically based on Standard reaction amplification curve to fractional part.Based on their amplification curve (comparing with standard control quantity), these numerical value is used Insert the quantity of unknown material.

Except PCR, depend on that the amplification system of thermodynamic cycle or isothermal amplification are present in, including, but not It is limited to：Cut-out amplified reaction, rolling circle amplification (RCA), unwindase-dependent amplification (HDA), ring mediated amplification (LAMP), chain are put Change amplification (SDA), transcript mediated amplification (TMA), self-supporting sequence replicating (3SR), nucleic acid sequence based amplification (NASBA), single Primer isothermal duplication (SPIA), Q-β replicase system and recombinase polymeric enzymatic amplification (RPA).

Isothermal cuts off amplified reaction and has part similar with PCR thermal cycle.Such as PCR, cut off amplified reaction use and be complementary to The oligonucleotide sequence of target sequence (referred to as primer).In addition, the cut-out amplified reaction of target sequence causes target sequence logarithm Increase, just as it is in standard PCR.Unlike standard PCR, cut off amplified reaction and isothermally advance.In standard PCR, rise High-temperature is so that two chains of DNA separate.In cutting off amplified reaction, target nucleic acid sequence is being present in the spy of test sample Surely cut off and cut on site.Polymerase infiltration is cut off site and starts synthesis cutting target nucleic acid sequence (outside addition Source DNA) complementary strand simultaneously will exist complementary dna chain displacement.Strand displacement duplication process is no longer necessary to hot chain and separates.Now, The displacement complementary series of the foreign DNA adding is annealed by primer molecule.Present polymerase extends from primer 3 ' end, is previous Displacement chain generates complementary strand.Newly synthesized complementary strand is annealed and extends to generate DNA by the second primer tasteless nucleotide subsequently Double helix, it includes cutting off reagent recognition sequence.This chain is subsequently easy to utilize follow-up strand displacement to extend by polymerase And be cut, this results in the interim amplicon generating DNA (having cut-out site on the two ends of original object DNA) double-strand. Once synthesizing this interim amplicon, being replicated by utilizing line primer molecule will replace chain, molecule continues exponential amplification.In addition, By repeating nick translation synthesis behavior on the cut-out site at Primed template, amplification is also from each products molecule linear travel. Result is quickly to increase the amplification of echo signal；This generates more quick and proliferation time less than 10 than by PCR thermal cycle Minute.

Cut off the test of reagent dependence isothermal nucleic acid amplification

The invention provides detection target nucleic acid molecules (obtaining in isothermal cut-out amplification test amplification).To side described herein The useful polymerase of method can be catalyzed be incorporated to nucleotides for work in coordination with strand displacement behavior extension oligonucleotides (such as primer) be bound by 3 ' the hydroxy terminals cutting off on site on 3 ' hydroxy terminals in target nucleic acid molecules and/or double chain DNA molecule.Such poly- Synthase also lacks or substantially reduces 5 '-3 ' excision enzyme behavior and these polymerases potentially including thermophilic.To relating to drawing The useful archaeal dna polymerase of the method for thing (there are on guiding region 2 ' terminal modified nucleotides (including 63 ' terminal nucleotides)) Including derivative (separates from bacillus stearothermophilus with DNA polymerase i, is also classified as bacillus stearothermophilus and comes Self-osculation contact bacterial strain, conivium and species (including Bacillus)) variant, this lacks or substantially reduces 5 '-3 ' outward Cut enzymatic activity and there is strand-displacement activity.Exemplary polymerases includes, but is not restricted to Bst DNA polymerase i, Gst DNA The large fragment of polymerase I, Gka DNA polymerase i.

The useful cut-out reagent of the method that describes the present invention is to identify on double chain acid molecule and combine ad hoc structure And (when being attached to its ad hoc structure identifying, its speed is real for cutting phosphodiester bond between the adjacent nucleotide pushing up chain In matter than the phosphodiester bond between the syncaryon thuja acid on cutting end chain faster), thus, generating (can profit in cut-out site With lacking 5 '-3 ' the strand displacement polymerase of excision enzyme and be expanded) before terminal nucleotide on freely 3 ' hydroxyls.Herein In the preferred embodiment of disclosed method, the speed of " cut-out reagent " cutting top chain phosphodiester bond is cut close to 100% simultaneously The speed of end chain phosphodiester bond is close to 0%.Can be enzyme to the cut-out reagent that method described herein is favourable, i.e. turning multiple ends Thing molecule self-regenerated catalyst or the non-renewable catalyst only overturning single substrate molecule with equimolar ratio.

The DNA of nickase and double-strand and the chain cutting double-stranded duplex.In the method for the present invention, nickase cuts Top chain (this chain includes 5 '-3 ' sequences cutting off agent recognition site).Nickase can cut binding site or nickase identification The upstream in site or downstream.In specific embodiment disclosed by the invention herein, nickase only cuts top chain and recognition site 3 ' end downstreams.In the exemplary embodiment, reaction includes using downstream (the such product serial that can cut or cut off binding site Do not include cut off site) nickase.Use can cut the enzyme in binding site downstream polymerase is extended more easily and Nickase need not be replaced.It is desirable that under the reaction condition identical with polymerase, nickase comes into force.Exemplary nickase includes, But be not limited to N.Bst9I, N.BstSEI, Nb.BbvCI (NEB), Nb.Bpu10I (Fermentas), Nb.BsmI (NEB), Nb.BsrDI(NEB)、Nb.BtsI(NEB)、Nt.AlwI(NEB)、Nt.BbvCI(NEB)、Nt.Bpu10I(Fermentas)、 Nt.BsmAI, Nt.BspD6I, Nt.BspQI (NEB), Nt.BstNBI (NEB) and Nt.CviPII (NEB).Table 1 provides otch The sequence of enzyme recognition site.

Table 1. nickase recognition sequence

Nickase also includes being generated by modifying the cleavage activity limiting enzyme (NEB formula, in July, 2006 roll up 1.2) The nickase of design.It when limiting the recognition sequence that enzyme is attached in their DNA, is used for hydrolyzing every chain, is positioned within each enzyme Two catalyst site drive two the independent hydrolysis that can parallel carry out.Can the restriction enzyme of design variation, it only hydrolyzes A double-helical chain is to generate the DNA molecular being switched " off " (3 '-hydroxyl, 5 '-phosphate) and not being cut.Nickase also may be used Including modify CRISPR/Cas protein, transcriptional activator analog effector nuclease (TALENs) and there is nickase Zinc-finger the nuclease of activity.

Cut off amplified reaction and generally include nucleosides, such as dideoxyribonucleoside triphosphate (dNTPs).Reaction also can be include can (including but not limited to labelled with radioisotope is (for example for the dNTPs of detection part³²P,³³P,¹²⁵I,³⁵S), enzyme (such as alkalescence Phosphatase), fluorescence labeling (such as fluorescein isothiocynate (FITC)), biotin, avidin, digoxigenin, antigen, haptens Or fluorescent dye) in the presence of carry out.Reaction also includes specific salts and buffer solution, and they can be nickase and polymerase provides and lives Property.

Advantageously, when reaction temperature is about constant during amplified reaction, amplified reaction is cut off at substantially isothermal bar Carry out under part.Because temperature does not needs to circulate between higher temperature and lower temperature, can be difficult to so cutting off amplified reaction Carry out carrying out under conditions of Standard PCR.Generally, reaction is about at 35 DEG C and 90 DEG C (for example about the 35th, the 37th, the 42nd, the 55th, the 60th, the 65th, 70th, the 75th, 80 or 85 DEG C) between carry out.Advantageously, it is unnecessary for maintaining temperature with very big accuracy.Temperature has some to become It is acceptable for changing performance.

Select Δ Δ G≤-15 ,-16, the 17th ,-18 ,-19 ,-20 ,-25 ,-30kcal/mole or more amplified reaction Primer sets.Amplification can be changed by increasing one or more oligonucleotides (for example one or more primers and/or probe) concentration The performance characteristic of reaction.The high concentration of primer is also supported to form primer-dimer.In different embodiments, the concentration of primer is 100th, the 200th, the 300th, the 400th, the 500th, the 600th, the 700th, the 800th, the 900th, 1000nM or more.Melt temperature (Tm) and reaction rate modifying agent Also can be used to reduce the melt temperature of oligonucleotides, such as (but being not limited to) ethylene glycol and glycerine.In addition, archaeal dna polymerase is anti- Rate improvement agent (such as dNTP and magnesium density) is answered also to can be used to change reaction rate.In a particular embodiment, forward and reverse primer 5 ' end tail sequence there is identical nucleotide sequence.

Present invention provides design to cut off the test of reagent dependent isothermal strand displacement amplification and need not tentative screen The method of the combination of a large amount of forward primers to be selected and/or reverse primer to be selected.Length is 35 to be positioned within target sequence to 70bp To be considered to have in middle part length be 12 to arrive 20bp sequence, its Tm >=test temperature (such as～55 DEG C) in district.According to above-mentioned Standard, identifies the downstream being located immediately at middle part (length is 15 to 20bp) and upstream, length are 12 flanking sequences arriving 20bp. Deviation between the Tm of the upstream and downstream flanking sequence of selected double-strand is less than ± 3 DEG C.By will stablize dimer-formation primer 5 ' end tailers be attached to 5 ' terminals of flanking sequence at 12 to 20 alkali yl upstreams and 12 to 20 base downstream parts 5 ' terminals of flanking sequence complementary strand form forward and the reverse primer pair of desired specificities.When with forward primer, reverse primer Combine with probe, drive the primer synthesizing the chain being complementary to probe with about 1.1:1 to 10:The mol ratio of 1 is more than other primers And it is excessive.In test, the combined concentration of primer is not higher than 1000nM.Test design method also can be used to amplicon≤70bp's Predetermined PCR test is converted to cutting agent dependence isothermal chain-displacement amplification test.

Target nucleic acid molecules

The amplification of the method for the present invention and the target nucleic acid molecules to test sample for the component and/or differentiate useful.Target sequence Row amplification from almost any sample (including target nucleic acid molecules), including but not limited to includes fungi, spore, virus or thin The sample of born of the same parents' (such as prokaryotic, eukaryotic).In a particular embodiment, component and the method for the present invention have detected bacillary Canker Pseudomonas ulcer, bacterial canker Pseudomonas Potato Ring Rot, pseudomonas syringae tomato sick cause a disease change, sarson Cause a disease change, Alternaria, Cladosporium, cephalo sickle-like bacteria, Verticillium dahlia, pseudomonad of Xanthomonas campestris capsicum spot disease is thin Piece mirror clam, carrot soft rot Erwinia belong to and bacterial wilt.Exemplary test sample include body fluid (for example blood, serum, blood plasma, Amniotic fluid, sputum, urine, cerebrospinal fluid, lymph, tear liquid, ight soil or gastric liquid), tissue extract, culture medium (such as cell, lift The liquid of individual example pathogen cells growth), environmental sample, agricultural product or other food and their extract and DNA mirror Distinguishing label.If it is desirable, sample is carrying out utilizing any standard method (to be commonly used to from Biosample separate nucleic acid to divide Son) cut-out amplified reaction before be purified.

In one embodiment, there is pathogen to detect in the target nucleic acid of primer amplification pathogen in sample.Example Pathogen includes fungi, bacterium, virus and yeast.Can be by differentiating nucleic acid molecules (in test sample encoding pathogen egg White matter, such as toxin) detect such pathogen.Exemplary toxin is including but not limited to Aflatoxin cholera toxin, diphtheria Toxin, salmonella toxin, shiga toxin, clostridium botulinum toxin, endotoxin and mycotoxin.For environmental applications, test examination Sample can include water, the liquid extract of air cleaner, soil sample, construction material (for example dry wall, ceiling board, wallpaper, face Material, wallpaper and base plate covering), environment assay specimen or its sample any.In one embodiment, primer tasteless nucleotide will be used Make molecular breeding test (for enhancing, for example, drought resistance in plants, the herbicide-resistant of plant or resistance to insect predatism) inner internal control Plant target nucleic acid amplification.

Target nucleic acid molecules includes double-strand and single stranded nucleic acid molecule, and (such as art is known can be with nucleic acid described herein The DNA of molecular hybridization and other core base polymer).It is suitable for utilizing the detectable oligonucleotide probe of the present invention or primer inspection Survey DNA molecular including but not limited to double-strand DNA (such as genomic DNA, DNA/mitochondrial DNA, viral DNA and Synthetic dsdna).Single stranded DNA target nucleic acid molecules includes, for example, and viral DNA, cDNA and synthesizing single-stranded DNA or other institutes The DNA of genus field known type.

Generally, the length of the target sequence of detection between 10 to 100 (for example the 10th, the 15th, the 20th, the 25th, the 30th, the 35th, the 40th, the 45th, 50th, the 60th, the 70th, the 80th, the 90th, 100 nucleotides) nucleotides.Select the G/C content of target nucleic acid molecules less than the 45%th, the 50%th, 55% or 60%.Desirably, selecting target nucleic acid and nickase, such target sequence does not comprise cutting of any nickase Disconnected site, it can be contained in reactant mixture.

Application

The target nucleic acid amplification utilizing the primer of the present invention has the favourable feature (accompanying drawing of the quick detection to target nucleic acid 10).Such reaction is characterised by ([RFU_MAX-RFU_BL]), slope ([RFU_MAX-RFU_BL]/[T_OSEA-T_RFUmax] high number Value), relatively early start index amplification stage (T_OSEA<10 minutes) and same sample replicated test reaction between relatively low signal Difference.In a particular embodiment, T_OSEA-T_RFUmax≈ 3 minutes.

The invention provides monitoring isothermal amplification in real time.When needing quickly to detect (for example the 20th, the 15th, the 10th, the 9th, the 8th, the 7th, the 6th, Carry out the amplification of detectability under conditions of 5 minutes or less), component and the method for the present invention are favourable for human diagnosis.? In specific embodiment, the invention provides cut-out amplified reaction purposes in human diagnostic under clinical setting.Implement at other In example, when heat circulating equipment can not be utilized or it is expensive, the invention provides cut-out amplified reaction test at diagnosis scene Purposes in work.Further, in other embodiments, when the amplification of needs Rapid nucleic acid and detection, the invention provides Cut off purposes in academic background for the amplified reaction test.

Detectable oligonucleotide probe

The invention provides cut off in amplified reaction utilize non-amplification property, detectable oligonucleotide probe (include to A few polymerase capture molecule) detect target nucleic acid molecules or its amplicon (for example by the nucleotides change of oligonucleotides coloring Body or other parts, its energy combining target nucleic acid molecules, but detectable oligonucleotide probe can not be utilized to support as target Polymeric enzymatic amplification).It is not intended to be limited to theory, there is one or more part (not allowing polymerase to advance) and few core may be caused Thuja acid and non-nucleic acid skeleton capture polymerase or captured polymerase by delaying the polymerase that replicates (i.e. C3-spacer region, impaired DNA base, other spacer moieties, O-2-Me base).Therefore, during cutting off amplified reaction, these structures stop or subtract The informal amplification of few probe.They are just distinguished by this with conventional detection probe, it is necessary to add at the end cutting off amplified reaction To stop their amplification.

Conventional detection probe cuts off in amplified reaction in real-time detection and proves infeasible.If conventional detection probe is simultaneously Entering to cut off amplified reaction, these augmentation detection probes are simultaneously and target amplification.Detect the original of probe owing to what reaction started Molecular amounts, expands these detection molecules and has covered up the detection to regular target amplicon.

The invention provides non-amplification property, detectable polynucleotide probes, they include at least one polymerase capture Molecule.The polymerase capture molecule of the present invention including but not limited to, utilize repetition DNA polymerase blockade amplification but can realize Suitable hybrid effect or by the nucleotide variants of the amplification replisome of nucleotide spacer to target molecule or target molecule or other It partly (is therefore prevented from augmentation detection molecule).In one embodiment, the detected oligonucleotides of the present invention includes 3 carbon intervals District's (C3 spacer region), it can stop or reduce unconventional augmentation detection molecule.

In one embodiment, oligonucleotide probe can be detected and include that the nucleotide base of one or more modification (has The enhanced compatibility being incorporated into complementary nucleotide).The base example modified is including but not limited to 2 ' flutolanils and 2 ' OMe RNA acid amides (also plays the effect that polymerase capture molecule arrives).The available difference coloring of the detected oligonucleotide probe of the present invention Fluorescein synthesizes and may be designed as and any target sequence heterozygosis.In view of they are significantly specific, the non-amplification of the present invention Detectable polynucleotide probes be used for detecting simple target nucleic acid molecules in sample, or and detectable oligonucleotides visit Pin (each and different target nucleic acid molecules combine) is used together.Therefore, the non-amplification property of the present invention, detectable oligonucleotides Can be used to detect one or more of same reaction target nucleic acid molecules so that these targets detect simultaneously.The present invention includes Work in coordination with detectable oligonucleotide probe described herein and use such fluorescein.

Non-amplification property, the purposes of detectable polynucleotide probes

Non-amplification property, detectable polynucleotide probes have to cutting off amplification and detection target nucleic acid molecules in amplified reaction Profit.The method relates under substantially isothermy and in the presence of suitable buffer and dNTPs, by target nucleic acid molecules and polymerization Enzyme, two primers (each is specifically connected to the complementary series on target nucleotide acid molecule), nickases and few core can be detected Thuja acid probe contacts；Generate the amplicon including at least part of described target nucleic acid molecules；And the reaction based on fluorescence intensity During detect existence by detection oligonucleotide probe (real-time heterozygosis target adjust molecule) from reaction middle probe molecule Target nucleic acid molecules in reaction.

Generally, cutting off amplified reaction and including the non-amplification property of the present invention, detectable oligonucleotide probe, described cut-out is expanded Increase reaction to include:(1) target nucleic acid molecules：(2) two primers (complementary and target nucleic acid of a number of oligonucleotides is included Molecule) and available nickase cutting site；(3)dNTPs；(4) strand displacement polymerase；And (5) nickase.Therefore, originally Invention provides the method utilizing these components detection target to adjust molecule.

Perform in hardware and/or software

Method described herein can perform on the hardware of general service or special programming or software.For example, the method can Performed by computer-readable medium.Therefore, present invention provides and (be arranged to carry out according to any embodiment of the present invention Algorithm and/or method) software and/or computer program.It is known that those skilled in the art knows how to arrange Software, it can perform algorithm and/or method according to any embodiment of the present invention.Computer-readable medium can for permanent and/or Tangible.For example, computer-readable medium can be non-perpetuity reservoir (such as random access memory and the like) or permanent Memory (such as read-only storage, hard disk, floppy disk, tape, CD, paper platform, punch card and the like).Computer can perform The combination instructing writable suitable computer language or several language.Basic computational biology method exists, such as Setubal and Meidanis et al., the introduction of calculation biology method (PWS publishing house, Boston, 1997)；Salzberg,Searles, Kasif, (Ed.), molecular biology computer approach, (Ai Siweier, Amsterdam, 1998)；Rashidi and Buehler, Bioinformatics Basics；Bioscience and medical application (CRC publishing house, London, 2000) and Ouelette and Bzevani, raw Thing informatics：The practical guide of gene and protein analysis (Wiley＆Sons, Inc., the second edition, 2001) described in.

The present invention is alternatively different purpose and uses different computer program and software, and such probe designs, data Management, analysis and instrumentation (fist is 5,593,839,5,795,716,5,733,729,5,974,164,6,066, 454th, the 6,090,555th, the 6,185,561st, the 6,188,783rd, the 6,223,127th, 6,229,911 and 6,308,170 United States Patent (USP)). In addition, the present invention just has preferred embodiment, they include that offer travels through such as United States serial 10/197, the 621st, 10/063, 559 (US publication 20020183936), the 10/065,856th, the 10/065,868th, the 10/328,818th, the 10/328,872nd, 10/ The method of the gene information in the network of the internet of 423,403 and 60/482,389 display.

Kit

Present invention provides the kit of amplification target nucleic acid molecules.Amplification and detection are taken from master by such kit Target nucleic acid in the Biosample of body is effective.As described herein, the kit of the present invention can include, for example, and one or many Individual polymerase, forward and reverse primer and one or more nickase.When a target will expand, one or two nickase May be included in kit.When multiple target sequences will expand, the primer for the design of these target sequences includes phase isoschizomer Cut-out site, then one or two nickase can include wherein.When primer passes through different incisions enzyme identification, more cut-out enzyme Kit can be included in, for example, give an example, 3 or more.

On the one hand, the invention provides the kit of amplification of nucleic acid, described kit include archaeal dna polymerase, one-level primer, Secondary primer, specific nickase and triphosphoric acid and deoxynucleotide are had to the nickase binding site in primer (dNTP ' s) (for example at the cushioning liquid comprising the component enough expanding).In different embodiments, one-level primer and two grades draw Thing each have and be complementary to or substantially complementary 3 ' the terminal specificity region sequences in target sequence are (when end cog region includes one Or multiple 2 ' terminal modified nucleotides) and include being positioned at 3 ' terminal specificity cog region sequences (and self can carry out dimerization, I.e. self-complementary) 5 ' terminal tail districts of the nickase binding site of upstream.In a particular embodiment, one or more primers There is primer-dimer configuration (for example by about generating in Tm heating and Slow cooling).

The kit of the present invention may also comprise one or more any number of independent container, bag, conduit (for example< 0.2ml、0.2ml、0.6ml、1.5ml、5.0ml、>5.0ml), bottle, microtiter plate are (for example<96 holes, 96 holes, 384 holes, 1536 holes,>1536 holes), the one or more components in ArrayTape and analog, or component can with in such container Different components and combine.In different embodiments, kit also include can in conjunction with and expand drawing for a pair of canonical sequence Thing.In a particular embodiment, kit includes the primer of one or more primer-dimer configuration (for example by about at Tm Heating and Slow cooling generate).In other embodiments, kit includes the sterile chamber containing primer；Such container can Fill or other suitable containers known to art for box, ampoule, bottle, bottle, flexible pipe, sack, protection set, plastic uptake. Such container can be by plastics, glass, composite bed platen, metal forming or the other materials manufacture being suitable for receiving nucleic acid.

The component of kit, for example, can be in occurring in one or more container, for example, all components can be an appearance In device, or for example, enzyme may be present in independent container and primer separates.Component, gives an example, and can be dried (such as powder) or put Put in stabilizing buffer (such as chemically stable, Thermodynamically stable).Dried ingredients, for example, by desivac, vacuum and centrifugal Dry and/or constant pressure and dry is assisted to prepare.In different embodiments, polymerase and nickase in independent container with lyophilized shape Formula exists and primer is dried in different vessels, freeze-drying or in buffer solution.In certain embodiments, polymerase, cut Mouthful enzyme and primer presented in lyophilized in independent container.In other embodiments, polymerase and nickase is separable arrives In different vessels.

Kit also includes, for example, the dNTPs of use in reaction, or the nucleotides modified, cuvette or reaction use Other containers, or the bottle water of rehydrated freeze-dried component or buffer solution.Use buffer solution can, for example, be suitable for polymerase and Nickase activity.

The kit of the present invention may also comprise or many performing one or more explanation described herein and describing this paper Individual component or reagent.Illustrate and/or describe to print and kit insert can be included in.Kit may also comprise to offer So explanation or internet location describing carries out written description.

Kit also includes the reagent that detection method (for example real-time or end points) uses, and for example, gives an example, hybridization probe Or DNA binding dye.Kit also includes the reagent that detection method uses, and for example, gives an example, the reagent of FRET use, horizontal stroke Stream device, oil meter, fluorescent dye, colloidal gold particle, latex particle, molecular beacon or polystyrene microbeads.Detected components can It is incorporated to lateral flow device.Lateral flow device can be used on clinical detection.

Unless otherwise stated, the enforcement of the present invention utilizes molecular biology, microbiology, cell biology, biochemistry With immunologic routine techniques (including recombinant technique), they are all within the limit of power of technical staff.Such technology exists Document is (for example,《Molecular cloning》：Test handbook, second edition (Sambrook, 1989)；《Oligonucleotide synthesis method》(Gait, 1984)；《Animal cell culture》(Freshney,1987)；Enzymology method,《Experiment immunization learns to do volume》(Weir,1996)；《Feed The transgene carrier of breast zooblast》(Miller and Calos,1987)；《Molecular biology experiment guide》(Ausubel, 1987)；PCR:《Polymerase chain reaction》(Mullis,1994)；《Immunological experiment handbook》(Coligan, 1991)) in global solution Release.These technology can be used for producing polynucleotides and the polypeptide of the present invention, and similarly it is contemplated that manufacture and implement the present invention. To specific embodiment, useful especially technology will discuss in following part.

Following example is proposed to provide complete disclosure and description how to implement to those skilled in the art and to use this The test of invention, screening and treatment method, and be not intended to limit the scope that inventor is regarded as their invention.

Example

Example 1. is determined by primer target combination stability design soybean agglutinin isothermal DNA amplification system

Merely with the design principle according to the present invention and not testing by design of primers, the detection of design successful validation is big Isothermal DNA amplification test (accompanying drawing 12) of beans agglutinin.

Arrive 60bp window sequence based on 30:

5’-ccaaggttctcattacctatgatgcctccaccagcctcttggttgcttctttggtctacccttcac agagaa-3’

Middle shortage SNP (SNP ' s), selects the test objective sequence of soybean agglutinin gene.Runic shows Be be respectively selected from forward and reverse primer design sequence area.

It in order to select the target binding sequence of forward primer (5 '-ATTACCTATGATGCC-3 '), is just being attached to target Do compare as follows to the stability of chain and the stability of forward primer self dimerization：

The Δ G of forward primer-target hybrids (PrTH)_25℃=-25.99kcal/mole；

The Δ G of primer-self dimer of target land (PrTBRHD)_25℃=-3.14kcal/mole；

ΔΔG_25℃=Δ G_PTH-ΔG_PTBRHD=-22.85kcal/mole.

Low Δ Δ G (≤about-16kcal/mole) shows that the complementary strand of target nucleic acid molecules can be annealed simultaneously by forward primer And start to synthesis.

It in order to select the target binding sequence of reverse primer (5 '-ACCAAAGAAGCAAC-3 '), is attached to the reverse of target The stability of the stability of primer and reverse primer self-dimer effect is done and is compared as follows：

Nearest (the Δ Δ G's) of the target land of stability (Δ G) and reverse primer 5 '-ACCAAAGAAGCAAC-3 ' Relative stability is identified below：

The Δ G of forward primer-target hybrids (PrTH)_25℃=-25.35kcal/mole；

The Δ G of primer-self dimer of target land (PrTBRHD)_25℃=-3.14kcal/mole；

ΔΔG_25℃=Δ G_PTH-ΔG_PTBRHD=-22.21kcal/mole.

Low Δ Δ G (≤about-16kcal/mole) shows that the complementary strand of target nucleic acid molecules can be annealed simultaneously by reverse primer And start to synthesis.

Cut off amplified reaction (50 μ l) and include 0.3mM dNTPs, 0.38U/ml Bst 2.0WarmStart archaeal dna polymerase (New England's biological experiment), 0.15 unit Nt.BstNBI (New England's biological experiment), 250nM forward chain, 250nM Reverse strand, utilizes CalRed (BioSearch) be identified in 5 ' terminals and utilize BHQ2 (BioSearch) to be identified in 3 ' terminals 200nM molecular beacon probe and wild soybean genomic DNA (1000 duplicate).Primer and probe sequence (pass through BioSearch Inc., Novato, CA synthesize) as follows：

Forward primer (" m "=2 '-methoxyl group nucleotides)

5’-ACGCGACTCGTCGACGAGTCGCGTATTACCTATGAmUmGmCmC-3’

Reverse primer (" m "=2 '-methoxyl group nucleotides)

5’-ACGCGACTCGTCGACGAGTCGCGTACCAAAGAAmGmCmAmAmC-3’

Molecular beacon probe (" I " represents general inosine nucleotide)

5’-CalRed₆₁₀-CGCGCTCCACCAICCTCTTGCGCG-BHQ2-3’

In IQ5 heat circulator (BioRad), hatch about 10 minutes in 56 DEG C by reaction.Fluorescence signal record is at ROX (excitation state on passage：575nm；Launch state:602nm).The curve that the reaction comprising soybean gDNA (n=3) generates s shape is (attached Figure 13).By contrast, do not comprise signal dna (n=3) control reaction and do not generate signal.The time of start index amplification is about It is 3 minutes and to start time of maximum Relative fluorescence units be about 6 minutes.The exponential amplification stage of reactionSlope is true It is set to 660RFU/ minute.

Example 2. is determined by the isothermal DNA amplification system of the stability Design salmonella invA that primer target combines

Merely with the design principle according to the present invention and not by design of primers test, design easy, exercisable The isothermal DNA amplification test of detection salmonella invA.

Arrive 60bp window sequence based on 30:

5’-ATACTCATCTGTTTACCGGGCATACCATCCAGAGAAAA-3’

Middle shortage SNP (SNP ' s), selects the test objective sequence of salmonella invA gene.Runic shows Show is the sequence area being respectively selected from forward and reverse primer design.

It in order to select the target binding sequence of forward primer (5 '-ATACTCATCTGTTTACC-3 '), is attached to target The stability of the stability of forward chain and forward primer self dimerization is done and is compared as follows：

The Δ G of forward primer-target hybrids (PrTH)_25℃=-26.11kcal/mole；

The Δ G of primer-self dimer of target land (PrTBRHD)_25℃=-1.95kcal/mole；

ΔΔG_25℃=Δ G_PTH-ΔG_PTBRHD=-24.16kcal/mole.

It in order to select the target binding sequence of reverse primer (5 '-TTTTCTCTGGATGG-3 '), is attached to the reverse of target The stability of the stability of primer and reverse primer self-dimer effect is done and is compared as follows：

The phase of nearest (the Δ Δ G) of the target land of stability (Δ G) and reverse strand 5 '-ACCAAAGAAGCAAC-3 ' Identified below to stability：

The Δ G of forward primer-target hybrids (PrTH)_25℃=-25.28kcal/mole；

The Δ G of primer-self dimer of target land (PrTBRHD)_25℃=-1.57kcal/mole；

ΔΔG_25℃=Δ G_PTH-ΔG_PTBRHD=-23.71kcal/mole.

Cut off amplified reaction (26 μ l) and include 0.3mM dNTPs, 0.38U/ml Bst 2.0WarmStart archaeal dna polymerase (New England's biological experiment), 0.15 unit Nt.BstNBI (New England's biological experiment), 250nM forward chain, 250nM Reverse strand, utilizes CalRed (BioSearch) be identified in 5 ' terminals and utilize BHQ2 (BioSearch) to be identified in 3 ' terminals 300nM molecular beacon probe and wild soybean genomic DNA (1000 duplicate).Primer and probe sequence (pass through BioSearch Inc., Novato, CA synthesize) as follows：

Forward primer 1 (" m "=2 '-methoxyl group nucleotides)

5’-ACGCGACTCGTCGACGAGTCGCGTATTACCTATGAmUmGmCmC-3’

Reverse primer (" m "=2 '-methoxyl group nucleotides)

5’-GGCTGACTCCTGCAGGAGTCAGCCTTTTCTCTGmGmAmUmGmG-3’

Molecular beacon probe (" I " represents general inosine nucleotide)

5’-ACCTGTTTACCGGGCATACAAACAGGT-BHQ2-3’

In IQ5 heat circulator (BioRad), hatch about 10 minutes in 56 DEG C by reaction.Fluorescence signal record is at ROX (excitation state on passage：575nm；Launch state:602nm).The curve that the reaction comprising soybean gDNA (n=3) generates s shape is (attached Figure 15).By contrast, do not comprise signal dna (n=3) control reaction and do not generate signal.The time of start index amplification is about It is 3 minutes and to start time of maximum Relative fluorescence units be about 6 minutes.The exponential amplification stage of reactionSlope is true It is set to 660RFU/ minute.

Accompanying drawing 16A and 16B shows the result of assay optimization.

Example 3. differentiates as relative thermal kinetic parameter (with the primer/probe groups to be selected for isothermal duplication experimental design Performance be related to) Δ Δ G.Determine that predictive designs primer tasteless nucleotide in the primer/probe groups of " on silicon chip " comes into force or lost efficacy Threshold value.

Analyze comprise on 5 ' end-3 ' extreme directions self-complementary the firstth district (there is 5 '-afterbody of nickase recognition sequence) The a large amount of ginsengs being generally used for design of primers algorithm with one group of 34 Oligonucleolide primers of the target sequence being complementary to the secondth district Number, the melt temperature (Tm) of such as hybrid duplexes, %GC content, sequence length and Δ G.Independently determined first and second draw The respective all parameters in thing district.The subset of 25 primers belongs to primer/probe groups to be selected, and they are not in experiment sieving experiment Generate probe-detectable amplification product.

It is utilized respectively X-axis and the design parameter various combination of Y-axis generates some two dimensions matrix point (accompanying drawing 17A-17H), mesh Be discrimination parameter combination, wherein the data point of failure test primer can obtain from the data point clustering of functional trial primer respectively Arrive.As shown in the point of accompanying drawing 17B-17H, do not have the combination of the standard design parameter that prior art (design primer) uses from Non-functional primer in two-dimensional points matrix generates cognizable feature separate.Few owing to feature and non-functional The extensive overlapping range of the standard parameter value in nucleotide primer, the data point of two primer groups, as expected, weigh widely It is laminated in these points.

It is surprising that as present inventor defines, the Δ Δ G of only new relative thermal kinetic parameter generates Matrix (is wherein associated with the primer sets experiment effect of filler test, the data point of feature and non-functional primer group respectively Poly-).The figure of accompanying drawing 17A shows matrix, and its X-axis and Y-axis each provide the Δ Δ G value describing complementary first guiding region The ratio of the Δ Δ G value of ratio and description target-complementary the second guiding region.All failure test primers have the second district/target Double helix (in most cases) or the Δ Δ G less than-15kcal/mol of the firstth district self-complementation double helix (in the case of Yi Zhong) Value.Therefore, the Δ Δ G value of about-15kcal/mol becomes the oligonucleotides number of this differentiation feature and non-functional primer Experimental threshold value according to group.

Δ Δ G is the relevant parameter of measurement difference, i.e. at room temperature and atmospheric pressure in dynamic equilibrium, forms the widow needing Nucleotide structure (specific primer/target hybrids and self dimer of the firstth district) thermokinetics preferable forms a large amount of pre-relatively The advantage of the preferable of the optional structure surveyed.During it is surprising that primer tasteless nucleotide to be selected is designed as silicon chip, this Δ G Advantage (Δ Δ G) proves the parameter of measurable success of the test.Calculated Δ Δ G is as the registration of feature isothermal test The purposes of scoring and prediction index reduces puts into practice described below and test isothermalTest is (in order to detect soybean lectin Plain gene and salmonella invA gene) example.The Δ Δ G value calculating is utilized only to screen primer to be selected on silicon chip for the first time And probe.In the case of in Mei, only select by test method and the single primer/probe groups of test.Maiden trial carries out two kinds of work( Can property test and a large amount of primer/probe groups to be selected of screening time-consuming and not with high costs.

Other embodiments

It is evident that from the description above the different usage of invention described herein and condition can use modification and Variant.Such embodiment is also in the scope of the claims below.

Quote a series of herein to variable any definition in element include that by variable-definition be any single-element or institute The combination (or sub-portfolio) of column element.Quote embodiment hereof include as single embodiment or and other embodiments any or its The embodiment of the combination of part.

The application can relate to international patent application no PCT/US2013/035750, and in application on April 9th, 2013, it requires Enjoying U.S. Patent number 61/621, the right of U.S. Provisional Application filed in 9,975,2012 on April, its content is passed through It is incorporated herein by reference.

The application can relate to international patent application no PCT/US2011/047049, and in application on August 9th, 2011, it requires Enjoying U.S. Patent number 61/621, the right of U.S. Provisional Application filed in 13,975,2010 on Augusts, its content is passed through It is incorporated herein by reference.

With each independent patent and open specifically with show to be incorporated by reference into degree identical individually, this specification carries And all patents and open be incorporated herein by.

Claims

1. the primer tasteless nucleotide separating, from 5 ' to 3 ' include,

I) the firstth district, described firstth district includes self-complementary sequences, and described self-complementary sequences from 5 ' to 3 ' includes that nickase is known The reverse complementary sequence of other sequence, palindromic sequence and described nickase recognition sequence, and

Ii) the secondth district, the length in described secondth district is at least 16 nucleotides, and described secondth district is specifically bound to target core Complementary region on acid molecule is to form double-stranded hybrids, and described double-stranded hybrids has any of described secondth district than including and replaces The Δ G of the low at least 15kcal/mol of Δ G of structure, wherein said secondth district includes the one or more 2 ' cores modified at 3 ' ends Thuja acid.

2. the primer tasteless nucleotide separating as claimed in claim 1, the wherein length of the described palindromic sequence in described firstth district Degree is the 2nd, 4 or 6 nucleotides.

3. the as claimed in claim 1 or 2 primer tasteless nucleotide separating, wherein said firstth district a length of 12nd, the 13rd, the 14th, 15th, the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, 23 or 24 nucleotides.

4. the primer tasteless nucleotide of the separation as according to any one of Claim 1-3, wherein said secondth district a length of 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, the 23rd, the 24th, the 25th, the 26th, the 27th, the 28th, 29 or 30 nucleotides.

5. the primer tasteless nucleotide of separation according to any one of claims 1 to 4, completely self is mutual in wherein said firstth district Mend.

6. the primer tasteless nucleotide of the separation as according to any one of claim 1 to 5, wherein said alternating structure be one or The heterozygote of some double-strands, the one or more partially double stranded heterozygote self can be formed by described secondth district, By the partial sequence in described secondth district and described firstth district formed, by the few nucleosides of other in described secondth district and amplified reaction Acid, primer or probe form or are formed by the nucleotide sequence in described secondth district and the partial complementarity outside target sequence district.

7. the primer tasteless nucleotide of the separation as according to any one of claim 1 to 6, the primer tasteless nucleotide of described separation in The form of homodimer, described homodimer is by first district's sequence of the described self-complementary of two primer tasteless nucleotide molecules The hybridization of row is formed.

8. the as claimed in claim 7 primer tasteless nucleotide separating, wherein said homodimer has and draws described in including The Δ G of the low at least 15kcal/mol of Δ G of any alternating structure of thing oligonucleotides.

9. the primer tasteless nucleotide of the separation as according to any one of claim 1 to 8, wherein said one or more 2 ' modify Nucleotides there are 2 ' variants, described 2 ' variants selected from by 2 '-O-methyl, 2 '-methoxy ethoxy, 2 '-fluoro, 2 '-hydroxyl, 2 '-alkyl, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4 '-(CH₂)₂-O-2 '-bridge, Group that 2 '-LNA and 2 '-O-(N-methyl carbamate) form or those structures including base analogue.

10. the primer tasteless nucleotide of the separation as according to any one of claim 1 to 9, wherein said one or more 2 ' repair The nucleotides of decorations is positioned at the 3 ' ends in described secondth district.

The primer tasteless nucleotide of 11. separation as described in claim 9 or 10, two or more 2 ' cores modified wherein said Thuja acid is adjacent.

12. primer tasteless nucleotides separating as claimed in claim 11, the quantity of 2 ' the wherein adjacent nucleotides modified is 4th, 5 or 6.

The primer tasteless nucleotide of 13. separation as according to any one of claim 1 to 12, wherein said nickase is One or more of Nt.BspD6I and Nt.BstNBI.

14. primer tasteless nucleotides separating as claimed in claim 13, the described nickase identification in wherein said firstth district Sequence is 5 '-GAGTC-3 '.

The primer tasteless nucleotide of 15. separation as according to any one of claim 1 to 14, wherein places the knowledge of described cutting agent Other sequence is to cut the phosphodiester bond between described firstth district and described secondth district.

The primer tasteless nucleotide of 16. separation as according to any one of claim 1 to 15, the primer tasteless nucleotide of described separation There is the firstth district including following nucleotide sequence：

5’-GACTCN₁N_1’GAGTC-3’；

5’-GACTCN₁N_1’GAGTCN-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’N-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N-3’；

5’-N₅N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N_5’-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTC-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTCN-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’N-3’；With

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTC-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNNN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NNN-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N-3’；

Wherein, " N " is that any nucleotides (for example, has adenine (A), thymidine (T), cytimidine (C) or guanine (G) Core base), and N₁And N_1’Complementation, N₂And N_2’Complementation, N₃And N_3’Complementation, N₄And N_4’Complementation, N₅And N_5’Complementation, N₆And N_6’Mutually Mend, and N₇And N_7’Complementary.

The primer tasteless nucleotide of 17. separation as according to any one of claim 1 to 16, wherein said firstth district includes sequence Sequence in list.

Primer-the dimer of 18. 1 kinds of separation including two kinds of oligonucleotide monomer, described oligonucleotide monomer from 5 ' to 3 ' is wrapped Include,

19. primer-the dimers separating as claimed in claim 18, are wherein positioned at the described palindromic sequence in described firstth district Length is the 2nd, 4 or 6 nucleotides.

Primer-the dimer of 20. separation as described in claim 18 or 19, wherein said firstth district a length of 12nd, the 13rd, 14th, the 15th, the 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, 23 or 24 nucleotides.

Primer-the dimer of 21. separation as according to any one of claim 18 to 20, wherein said secondth district a length of 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, the 23rd, the 24th, the 25th, the 26th, the 27th, the 28th, 29 or 30 nucleotides.

Primer-the dimer of 22. separation as according to any one of claim 18 to 21, wherein said firstth district completely self Complementary.

Primer-the dimer of 23. separation as according to any one of claim 18 to 22, wherein said alternating structure is one Or the heterozygote of some double-strands, the one or more partially double stranded heterozygote can be by described secondth district from figure Become, by the partial sequence in described secondth district and described firstth district is formed, by other widow's cores in described secondth district and amplified reaction Thuja acid, primer or probe form or are formed by the nucleotide sequence in described secondth district and the partial complementarity outside target sequence district.

Primer-the dimer of 24. separation as according to any one of claim 18 to 23, the primer-dimer of described separation Form in homodimer, described homodimer is by the first region sequence of the described self-complementary of two kinds of oligonucleotide monomer Hybridization formed.

25. primer-the dimers separating as claimed in claim 24, wherein said homodimer has than includes described widow The Δ G of the low at least 15kcal/mol of Δ G of any alternating structure of nucleotide monomer.

Primer-the dimer of 26. separation as according to any one of claim 18 to 25, wherein said one or more 2 ' repair The nucleotides of decorations has 2 ' variants, and described 2 ' variants are selected from by 2 '-O-methyl, 2 '-methoxy ethoxy, 2 '-fluoro, 2 '-hydroxyl Base, 2 '-alkyl, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4 '-(CH₂)₂-O-2’- Group that bridge, 2 '-LNA and 2 '-O-(N-methyl carbamate) form or those structures including base analogue.

Primer-the dimer of 27. separation as according to any one of claim 18 to 26, wherein said one or more 2 ' repair The nucleotides of decorations is positioned at the 3 ' ends in described secondth district.

Primer-the dimer of 28. separation as described in claim 26 or 27, two or more 2 ' cores modified wherein said Thuja acid is adjacent.

29. primer-the dimers separating as claimed in claim 28, the 4th, the quantity of 2 ' the wherein adjacent nucleotides modified be 5 or 6.

Primer-the dimer of 30. separation as according to any one of claim 18 to 29, wherein said nickase is One or more of Nt.BspD6I and Nt.BstNBI.

31. primer-the dimers separating as claimed in claim 30, the described nickase identification sequence in wherein said firstth district Row are 5 '-GAGTC-3 '.

Primer-the dimer of 32. separation as according to any one of claim 18 to 31, wherein places the knowledge of described cutting agent Other sequence is to cut the phosphodiester bond between described firstth district and described secondth district.

Primer-the dimer of 33. separation as according to any one of claim 18 to 32, described oligonucleotide monomer has bag Include the firstth district of nucleotide sequence as described below：

5’-GACTCN₁N_1’GAGTC-3’；

5’-GACTCN₁N_1’GAGTCN-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’N-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N-3’；

5’-N₅N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N_5’-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTC-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTCN-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’N-3’；With

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTC-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNNN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NNN-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N-3’；

Primer-the dimer of 34. separation as according to any one of claim 18 to 33, wherein said oligonucleotide monomer bag Including the firstth district, described firstth district includes the sequence in sequence list.

35. 1 kinds of oligonucleotide probes being used for detecting the separation of target nucleic acid molecules, including：

I) oligonucleotides；

Ii) fluorescent reporter；And

Iii) quencher molecule, described quencher molecule can absorb excitation energy from described fluorescent reporter；

Wherein, described fluorescent reporter covalently attaches to 5 ' and 3 ' relative ends of described oligonucleotides with described quencher molecule,

Wherein, described oligonucleotides includes the firstth district, and described firstth district has the nucleic acid sequence being substantially complementary to target nucleic acid sequence Row, and

A) be positioned at described first upstream, district the secondth district 5 ', and

B) be positioned at described first downstream, district the 3rd district 3 ', the 3 ' of described 3rd district have the nucleic acid complementary with described secondth district Sequence,

Wherein, when described oligonucleotides is not associated with to target nucleic acid molecules, described oligonucleotides can by described secondth district and The heterozygosis effect in described 3rd district forms loop-stem structure hairpin structure, and

Wherein, the Δ G ratio of the double-stranded hybrids between described target sequence and the described First ray of described oligonucleotide probe The low at least 15kcal/mol of Δ G of any alternating structure comprising described oligonucleotide probe.

36. oligonucleotide probes separating as claimed in claim 35, wherein said alternating structure is one or more parts The heterozygote of double-strand, the one or more partially double stranded heterozygote self can be formed by described firstth district, by described The partial sequence in one district and described firstth district formed, by described firstth district and other oligonucleotides in amplified reaction, primer or Probe formed or described firstth district with formed by the nucleotide sequence of the partial complementarity outside described target sequence district.

The oligonucleotide probe of 37. separation as described in claim 35 or 36, wherein said secondth district and described 3rd district Length is 4 to 8 nucleotides.

The method of 38. 1 kinds of specific amplification products in cutting and extension amplified reaction, described method includes：

(a) under substantially isothermy, by target nucleic acid molecules and polymerase, two or more primers, nickase and can The oligonucleotide probe contact of detection, each in the two or more kinds of primer is specifically bound to target nucleic acid molecules On complementary series, at least one of which primer from 5 ' to 3 ' includes,

Ii) the secondth district, the length in described secondth district is at least 16 nucleotides, and described secondth district is specifically bound to target core Complementary region on acid molecule is to form double-stranded hybrids, and described double-stranded hybrids has any of described secondth district than including and replaces The Δ G of the low at least 15kcal/mol of Δ G of structure, wherein said secondth district includes the one or more 2 ' cores modified at 3 ' ends Thuja acid；And

B) generating amplicon, described amplicon includes the described target nucleic acid molecules of at least a portion.

The method of 39. 1 kinds of detection specific product in cutting and extension amplified reaction, described method includes：

(a) under substantially isothermy, by target nucleic acid molecules and polymerase, two or more primers, nickase and can The oligonucleotide probe contact of detection, in the two or more kinds of primer, each is specifically bound in target nucleic acid molecules Complementary series, at least one of which primer from 5 ' to 3 ' includes,

Ii) the secondth district, the length in described secondth district is at least 16 nucleotides, and described secondth district is specifically bound to target core Complementary region on acid molecule is to form double-stranded hybrids, and described double-stranded hybrids has any of described secondth district than including and replaces The Δ G of the low at least 15kcal/mol of Δ G of structure, wherein said secondth district includes the one or more 2 ' cores modified at 3 ' ends Thuja acid；

B) generating amplicon, described amplicon includes the described target nucleic acid molecules of at least a portion；And

C () detection is by the signal specific of oligonucleotide probe heterozygosis to described target nucleic acid molecules or its amplicon, wherein said Signal shows there is described target nucleic acid molecules in sample or its amplicon.

40. methods as claimed in claim 39, wherein said oligonucleotide probe includes：

I) oligonucleotides；

Ii) fluorescent reporter；And

Wherein, when described oligonucleotides is not associated with to target nucleic acid molecules, described oligonucleotides can by described secondth district and The heterozygosis effect in described 3rd district forms loop-stem structure hairpin structure.

41. methods as according to any one of claim 38 to 40, wherein said polymerase is Bacillus or stearothermophilus bud The DNA polymerase i of spore bacillus or active fragment and its derivative.

42. methods as claimed in claim 41, wherein said polymerase be Bst DNA polymerase i, Gst DNA polymerase i or One or more in Gka DNA polymerase i.

43. methods as claimed in claim 42, wherein the length at the described palindromic sequence in described firstth district is the 2nd, 4 or 6 Nucleotides.

44. methods as according to any one of claim 38 to 43, wherein said firstth district a length of 12nd, the 13rd, the 14th, the 15th, 16th, the 17th, the 18th, the 19th, the 20th, the 21st, the 22nd, 23 or 24 nucleotides.

45. methods as according to any one of claim 38 to 44, wherein said secondth district a length of 16th, the 17th, the 18th, the 19th, 20th, the 21st, the 22nd, the 23rd, the 24th, the 25th, the 26th, the 27th, the 28th, 29 or 30 nucleotides.

46. methods as according to any one of claim 38 to 45, the wherein said first complete self-complementary in district.

The primer tasteless nucleotide of 47. separation as according to any one of claim 38 to 46, wherein said alternating structure is one The heterozygote of individual or some double-strands, the one or more partially double stranded heterozygote can be by described secondth district from figure Become, by the partial sequence in described secondth district and described firstth district is formed, by other widow's cores in described secondth district and amplified reaction Thuja acid, primer or probe form or are formed by the nucleotide sequence in described secondth district and the partial complementarity outside target sequence district.

The primer tasteless nucleotide of 48. separation as according to any one of claim 38 to 47, the few nucleosides of the primer of described separation The form in homodimer for the acid, described homodimer is by the first of the described self-complementary of two kinds of primer tasteless nucleotide molecules The hybridization of region sequence is formed.

49. primer tasteless nucleotides separating as claimed in claim 48, wherein said homodimer has more described than including The Δ G of the low at least 15kcal/mol of Δ G of any alternating structure of primer tasteless nucleotide.

50. methods as according to any one of claim 38 to 49, the nucleotides tool that wherein said one or more 2 ' modify Have 2 ' variants, described 2 ' variants selected from by 2 '-O-methyl, 2 '-methoxy ethoxy, 2 '-fluoro, 2 '-hydroxyl, 2 '-alkyl, 2 '-O-[2-(methylamino)-2-oxygen ethyl], 4 '-sulphur generation, 4 '-CH₂-O-2 '-bridge, 4 '-(CH₂)₂-O-2 '-bridge, 2 '-LNA and Group that 2 '-O-(N-methyl carbamate) form or those structures including base analogue.

51. methods as according to any one of claim 38 to 50, the nucleotides position that wherein said one or more 2 ' modify 3 ' the ends in described secondth district.

52. methods as described in claim 38 or 51, two or more 2 ' nucleotides modified wherein said are adjacent.

53. methods as claimed in claim 52, the quantity of 2 ' the wherein adjacent nucleotides modified is the 4th, 5 or 6.

54. methods as according to any one of claim 38 to 53, wherein said nickase be Nt.BspD6I and One or more of Nt.BstNBI.

55. methods as claimed in claim 54, the described nickase recognition sequence in wherein said firstth district is 5 '-GAGTC- 3’.

56. methods as according to any one of claim 38 to 55, wherein place the recognition sequence of described cutting agent to cut Phosphodiester bond between described firstth district and described secondth district.

57. methods as according to any one of claim 38 to 56, wherein said primer has and includes nucleic acid sequence as described below Firstth district of row：

5’-GACTCN₁N_1’GAGTC-3’；

5’-GACTCN₁N_1’GAGTCN-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’-3’；

5’-N₂GACTCN₁N_1’GAGTCN_2’N-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’-3’；

5’-N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’-3’；

5’-N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N-3’；

5’-N₅N₄N₃N₂GACTCN₁N_1’GAGTCN_2’N_3’N_4’N_5’-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTC-3’；

5’-GACTCN₂N₁N_1’N_2’GAGTCN-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’-3’；

5’-N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’-3’；

5’-N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’-3’；

5’-N₅N₄N₃GACTCN₂N₁N_1’N_2’GAGTCN_3’N_4’N_5’N-3’；With

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTC-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNN-3’；

5’-GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCNNNN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NN-3’；

5’-N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’NNN-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’-3’；

5’-N₅N₄GACTCN₃N₂N₁N_1’N_2’N_3’GAGTCN_4’N_5’N-3’；

58. methods as according to any one of claim 38 to 57, wherein said primer includes the firstth district, described first district's bag Include the sequence in sequence list.

The kit of 59. 1 kinds of amplification target sequences in cutting off amplified reaction, described kit includes one or more primers Oligonucleotides, described primer tasteless nucleotide from 5 ' to 3 ' includes,

And the operation instruction of the described primer tasteless nucleotide in claim 38 to 58 either method.

60. kits as claimed in claim 59, also include oligonucleotide probe, and described oligonucleotide probe includes：

I) oligonucleotides；

Ii) fluorescent reporter；And

Wherein, when described oligonucleotides is not associated with to target nucleic acid molecules, described oligonucleotides can by described secondth district and The heterozygosis effect in described 3rd district forms loop-stem structure hairpin structure；

61. 1 kinds tangible, and permanent computer-readable medium, including perform to select the computer of the method for primer tasteless nucleotide Programmed instruction, described primer tasteless nucleotide includes：

Ii) the secondth district, the length in described secondth district is at least 16 nucleotides, and described secondth district is specifically bound to target core Complementary region on acid molecule；

Described method includes：

A) the secondth district of described primer tasteless nucleotide, wherein said secondth district and described target nucleic acid molecules heterozygosis effect shape are selected The low at least 15kcal/mol of Δ G of Δ G any alternating structure in described secondth district than including of the double-stranded hybrids becoming；

B) the firstth district of described primer tasteless nucleotide, the described self-complementary first of two of which primer tasteless nucleotide molecule are selected The Δ G of Δ G any alternating structure in described secondth district than including of the homodimer that the heterozygosis effect in district is formed is low at least 15kcal/mol.